ID: 954214062

View in Genome Browser
Species Human (GRCh38)
Location 3:49114710-49114732
Sequence CTAGTTCAGCTCAGCTATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954214062_954214068 -6 Left 954214062 3:49114710-49114732 CCAGAATAGCTGAGCTGAACTAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 954214068 3:49114727-49114749 AACTAGGGGGTCTCTTTCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 88
954214062_954214067 -7 Left 954214062 3:49114710-49114732 CCAGAATAGCTGAGCTGAACTAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 954214067 3:49114726-49114748 GAACTAGGGGGTCTCTTTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 94
954214062_954214074 22 Left 954214062 3:49114710-49114732 CCAGAATAGCTGAGCTGAACTAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 954214074 3:49114755-49114777 CATCACACCTTGGCACACACAGG 0: 1
1: 0
2: 0
3: 17
4: 151
954214062_954214075 23 Left 954214062 3:49114710-49114732 CCAGAATAGCTGAGCTGAACTAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 954214075 3:49114756-49114778 ATCACACCTTGGCACACACAGGG 0: 1
1: 0
2: 0
3: 11
4: 171
954214062_954214069 -5 Left 954214062 3:49114710-49114732 CCAGAATAGCTGAGCTGAACTAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 954214069 3:49114728-49114750 ACTAGGGGGTCTCTTTCCAGGGG 0: 1
1: 0
2: 0
3: 10
4: 213
954214062_954214071 12 Left 954214062 3:49114710-49114732 CCAGAATAGCTGAGCTGAACTAG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 954214071 3:49114745-49114767 CAGGGGAGCCCATCACACCTTGG 0: 1
1: 0
2: 0
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954214062 Original CRISPR CTAGTTCAGCTCAGCTATTC TGG (reversed) Intronic
900859167 1:5214014-5214036 TTAGTTAAGCTCAGCCATTCTGG - Intergenic
904548648 1:31297034-31297056 TTAGTTCAGCGCAGCGACTCGGG + Exonic
911788632 1:101982772-101982794 ATAGTTCTGGTCAGGTATTCTGG - Intronic
911807678 1:102232529-102232551 CTAGTTGAGGTCAGCTATAAGGG + Intergenic
911842958 1:102707890-102707912 GTAGATCAGCTCAGCTATTGTGG + Intergenic
912048260 1:105489144-105489166 CTGGTTCAAATCAGGTATTCTGG - Intergenic
917168812 1:172145593-172145615 CTAGTTTCCCTCAGCTATTTTGG + Intronic
918380471 1:183949269-183949291 CGAGTTTGTCTCAGCTATTCTGG - Intronic
919078460 1:192840471-192840493 TTAGTTCAGCTCAGGTCTTGGGG - Intergenic
919505137 1:198388843-198388865 CTATTGCAGCACATCTATTCTGG + Intergenic
1067384485 10:45806026-45806048 CCAGCTCAGATCAGCTAATCAGG - Intergenic
1067879707 10:50032780-50032802 CCAGCTCAGATCAGCTAATCGGG + Intergenic
1067892177 10:50146588-50146610 CCAGCTCAGATCAGCTAATCAGG - Intergenic
1071298962 10:84242346-84242368 CTATTTCAGCTGAGCCCTTCTGG + Intergenic
1073790816 10:106938476-106938498 CTAGTATAGCTAAGCTAATCAGG + Intronic
1074875877 10:117613124-117613146 CTGGTCCAGCTCACCTACTCTGG + Intergenic
1081678323 11:44984103-44984125 CGAGTGCAGCCCAGCTGTTCAGG + Intergenic
1084872707 11:72108893-72108915 ATAGCTCAGCTCACCTATGCTGG + Exonic
1085781600 11:79414252-79414274 CTATTCCAGGCCAGCTATTCTGG - Intronic
1088914475 11:114217128-114217150 CTATCTCAGCTGAGCTACTCAGG - Intronic
1089722860 11:120445513-120445535 GTAGCTCAGCTCATCTGTTCAGG + Intronic
1090879480 11:130821019-130821041 CTCTCTCAGCTCAGCTTTTCAGG + Intergenic
1091632279 12:2171100-2171122 CGAGTCCACCTCACCTATTCAGG - Intronic
1096417256 12:51424972-51424994 CTAGTTCGGCTCCGCCATGCCGG + Exonic
1105280926 13:18962195-18962217 CTGGTCCACCTCAGCTATGCAGG - Intergenic
1109191960 13:59335726-59335748 CTATTTCAGCACAGCAATTTTGG + Intergenic
1113119144 13:106907734-106907756 CTAGGTCCACTCAGCTATTGAGG - Intergenic
1118461842 14:65994579-65994601 TGAATGCAGCTCAGCTATTCTGG - Intronic
1119515022 14:75241077-75241099 GGAATTCAGCTCAGCAATTCTGG + Intronic
1120732411 14:88018446-88018468 TTAGGTTAGCTCAGCTACTCTGG - Intergenic
1125482458 15:40089981-40090003 TTTGTTCTGCTCAGATATTCTGG - Exonic
1126945023 15:53809898-53809920 CCATTCCAGCTCAGCTATCCTGG + Intergenic
1127765284 15:62179844-62179866 CTAGCTCAGCCCAGCTACTGAGG - Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128896432 15:71377679-71377701 CTGTTTCAGGGCAGCTATTCGGG + Intronic
1131380750 15:91962032-91962054 GAAGTTGAGCTCAGCTCTTCTGG + Intronic
1132172778 15:99679054-99679076 CTATTTCATCTTAGCAATTCTGG - Intronic
1139927434 16:70497697-70497719 ACAGCTCAGCTCAGCTCTTCAGG - Intronic
1149390179 17:56181536-56181558 CTAGTTAAGCTCAGGTAGGCTGG + Intronic
1153945701 18:10015368-10015390 CGGGTTGAGTTCAGCTATTCTGG + Intergenic
1156926124 18:42582151-42582173 CTAGTTCAGCTTTGCTAGTCTGG - Intergenic
1159042106 18:63334011-63334033 TTTGTTCAGCTCAGGGATTCTGG + Intronic
1162616454 19:11804717-11804739 CTAGTTCATCAGTGCTATTCAGG + Intronic
1164959726 19:32417442-32417464 CCTGTTAAGCTCAGCTACTCAGG - Intronic
1166253920 19:41589162-41589184 CTTGGTCAGCTCAGCTTCTCAGG - Intronic
929861270 2:45679831-45679853 CTGGTTCAGCTTGGCTCTTCCGG + Intronic
942711844 2:178845593-178845615 CTACTTAACCTCAGCTATTGAGG - Intronic
944638357 2:201696580-201696602 CTAGCTCAGCACAGTCATTCGGG - Intronic
944712144 2:202344030-202344052 CTAGTCCAGCTCTGCTAATTAGG - Intergenic
945263502 2:207867230-207867252 CTGTGGCAGCTCAGCTATTCAGG + Intronic
946952608 2:224893344-224893366 CTATTTCAGCCCAGCTAAGCTGG + Intronic
947132351 2:226941614-226941636 GTACTTGAGCTCATCTATTCTGG + Intronic
947239398 2:227977907-227977929 ATATTTCAGCTCAGCTTTTGGGG - Intergenic
1172640695 20:36438831-36438853 TGAGGTCAGCTCAGCTACTCGGG - Intronic
953250402 3:41241013-41241035 TTAGTTCATCTCATCTCTTCAGG + Intronic
953285914 3:41609266-41609288 TTAGTTCAGCCCATTTATTCAGG + Intronic
954214062 3:49114710-49114732 CTAGTTCAGCTCAGCTATTCTGG - Intronic
955932631 3:64072949-64072971 CTAGTTCAGCTGTTCTATGCTGG + Intergenic
959836761 3:110926879-110926901 GTAGTTCAGTTCAGCTATCTTGG - Intergenic
960155812 3:114296046-114296068 CTTGTTTAGCTCTGCTATTAGGG - Intronic
961023841 3:123534141-123534163 CTAGTGCTGCTCAGCTTTGCAGG - Intronic
964646066 3:158959651-158959673 CTAGCCCAGCTCAGCCATTCAGG - Intergenic
966435874 3:179883407-179883429 TTAGTTCAGCTAATCTATTTTGG + Intronic
975278173 4:72527238-72527260 CTAGTTGAGCTGAGCTTTTAAGG - Intronic
975486080 4:74935033-74935055 ACAGTTTAGCTCCGCTATTCCGG + Intronic
978535205 4:109754826-109754848 CTAGTACACCTCAGCTACACTGG - Intronic
978544998 4:109861492-109861514 CTTTTTCATTTCAGCTATTCTGG + Intronic
986811650 5:11366025-11366047 CTAGTTCAGCCTCTCTATTCCGG + Intronic
988826760 5:34944053-34944075 CTACTTCATCTCATCTGTTCAGG - Intronic
993926648 5:93873875-93873897 CATGCTCAGCTCAGCTCTTCAGG + Intronic
994763299 5:103884093-103884115 CTCATTCAACTCAGCAATTCAGG - Intergenic
998235243 5:140392968-140392990 GTAGTTCAGCCCAGATGTTCTGG - Intergenic
998883283 5:146667196-146667218 CAAATTCAGCTCAGCCATTGAGG - Intronic
1001412075 5:171519141-171519163 CTGGCCCAGCTCAGCTGTTCAGG + Intergenic
1002168425 5:177362163-177362185 CAATTCCAGCTCTGCTATTCGGG - Intronic
1014213235 6:118728687-118728709 ATAGTTCAGGTCAGATATTATGG - Intergenic
1015525531 6:134172452-134172474 CTTGTTCTGCTCATCTATTCTGG + Intronic
1015649253 6:135436469-135436491 TTACTTCAGCCCAGTTATTCTGG - Intronic
1018855988 6:167675525-167675547 TTGGGTCAGCTCAGCTTTTCAGG + Intergenic
1020825239 7:13019048-13019070 CTATTTCAGCTCAGCCACTGAGG + Intergenic
1022253073 7:28628134-28628156 CAGGATCAGCTCAGCTTTTCAGG + Intronic
1022801641 7:33782437-33782459 TCAGTTCAGCTCATCTAGTCTGG + Intergenic
1027255432 7:76427801-76427823 GTAGTCCATCCCAGCTATTCAGG - Intronic
1031023603 7:116655131-116655153 CTAGTTCAGCTCAACGAGGCTGG - Intergenic
1032852117 7:135804070-135804092 CTAGCTCATCTTGGCTATTCAGG + Intergenic
1035958153 8:4105933-4105955 CTAATTCAGGTCAGGTATTCAGG - Intronic
1038823880 8:30979225-30979247 CTACATCAGCAAAGCTATTCAGG - Intergenic
1044273895 8:90277880-90277902 ATACTTCAGCACAGATATTCAGG + Intergenic
1045706849 8:104933957-104933979 CTTGGTCAACTCAGCTATACTGG + Intronic
1046390190 8:113561808-113561830 CTTTTTCAGCTGAGTTATTCAGG + Intergenic
1048136580 8:131752309-131752331 CTAGTCCAGCTCAGATCATCAGG - Intergenic
1050090691 9:2015127-2015149 CTCGCTCAGCTCAGCGACTCCGG - Intergenic
1051743702 9:20275458-20275480 CTACCTCTGCTCAGCTAGTCTGG + Intergenic
1054379136 9:64470104-64470126 CTATGTCAGCTCTGCTTTTCAGG - Intergenic
1059501176 9:114755586-114755608 CTAGTTCAGGAAGGCTATTCTGG - Intergenic
1189073986 X:37896755-37896777 CTGGCTCAGCTCATCTTTTCTGG - Intronic
1190438134 X:50448258-50448280 CTATTTCAGATCAGCCATTTGGG - Intronic
1191730288 X:64326723-64326745 CAAGTTTGCCTCAGCTATTCGGG - Intronic