ID: 954214456

View in Genome Browser
Species Human (GRCh38)
Location 3:49116720-49116742
Sequence GCAACCTTGGTGGATGGTAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 328}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954214456_954214460 9 Left 954214456 3:49116720-49116742 CCTTTACCATCCACCAAGGTTGC 0: 1
1: 0
2: 1
3: 17
4: 328
Right 954214460 3:49116752-49116774 TGCCACTGCCATCTCCTCCTTGG 0: 1
1: 0
2: 6
3: 29
4: 400
954214456_954214466 29 Left 954214456 3:49116720-49116742 CCTTTACCATCCACCAAGGTTGC 0: 1
1: 0
2: 1
3: 17
4: 328
Right 954214466 3:49116772-49116794 TGGCACAGTCATCTTTCCCAGGG 0: 1
1: 0
2: 4
3: 18
4: 197
954214456_954214465 28 Left 954214456 3:49116720-49116742 CCTTTACCATCCACCAAGGTTGC 0: 1
1: 0
2: 1
3: 17
4: 328
Right 954214465 3:49116771-49116793 TTGGCACAGTCATCTTTCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954214456 Original CRISPR GCAACCTTGGTGGATGGTAA AGG (reversed) Exonic
900731121 1:4261021-4261043 GCAATCATGGTGGAAGGTAAAGG - Intergenic
900770190 1:4535090-4535112 ACAATCATGGTGGATGGCAAAGG - Intergenic
902676875 1:18014920-18014942 GCAATCATGGTGGAAGGTGAAGG + Intergenic
902788269 1:18746938-18746960 GCAACCTTGGTTGATCTTGATGG - Intronic
903695298 1:25201767-25201789 ACAATCATGGTGGAAGGTAAAGG - Intergenic
905002102 1:34680616-34680638 TCAATCATGGTGGAAGGTAAAGG + Intergenic
905023836 1:34836523-34836545 GCAACCTTGGCGGAGGCTCAGGG - Intronic
906664462 1:47609515-47609537 ACAATCATGGTGGAAGGTAAAGG + Intergenic
906898400 1:49805841-49805863 GCAAATTTGGTGTCTGGTAAAGG - Intronic
907559139 1:55372377-55372399 ACAATCATGGTGGAAGGTAAAGG - Intergenic
908003924 1:59709221-59709243 ACAATCATGGTGGAAGGTAAAGG + Intronic
908293771 1:62692961-62692983 ACAACCATGGTGGAAGGTGAAGG + Intergenic
908820664 1:68083023-68083045 GCAATCATGGTGGAAGGCAAAGG + Intergenic
909813505 1:79960619-79960641 GCAATCGTGGTGGAAGGCAAAGG + Intergenic
910656090 1:89620082-89620104 GCAGATTTGGTGGCTGGTAAGGG + Intergenic
911735375 1:101331182-101331204 TCAATCATGGTGGATGGCAAAGG + Intergenic
915160812 1:153919246-153919268 GCAACCTAGGTAAATGGCAAAGG + Intronic
917508813 1:175652691-175652713 ACAACCATGGTGGAAGGCAAAGG - Intronic
917692508 1:177483832-177483854 GTAGCCTTGCTCGATGGTAAGGG - Intergenic
917963712 1:180165712-180165734 GGAACTTTGGTGGATGCTCACGG + Intronic
918323190 1:183384111-183384133 GCAATCATGGTGGAAGGTGAAGG + Intronic
918934987 1:190911137-190911159 GCAATCATGGTGGAAGATAAAGG + Intergenic
920107226 1:203562560-203562582 ACAATCATGGTGGAAGGTAAAGG + Intergenic
921405320 1:214772677-214772699 ACAATCATGGTGGATGGTGAAGG - Intergenic
923941425 1:238831711-238831733 GCAACTTTGGAAGTTGGTAATGG + Intergenic
924550426 1:245071008-245071030 GCAGCCTTGGTGTCTGGTGAAGG - Intronic
1063085059 10:2809316-2809338 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1063256121 10:4329171-4329193 ACCACCTTGGTGGATGGTGGAGG + Intergenic
1063653866 10:7967443-7967465 ACCACCTTGGTGGAAGGCAAAGG + Intronic
1064338175 10:14462694-14462716 ACAACCATGGTGGAAGGCAAAGG + Intergenic
1065223968 10:23524173-23524195 ACAATCATGGTGGATGGCAAAGG + Intergenic
1065905534 10:30247938-30247960 GCAATCATGGTGGAAGGTGAAGG - Intergenic
1067191431 10:44071509-44071531 GCAACCTAGATGGATCATAAGGG - Intergenic
1067578489 10:47423430-47423452 GCAATCATGGTGGAAGGTGAAGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1068220069 10:54032849-54032871 ACAATCATGGTGGATGGTGAAGG + Intronic
1068334579 10:55616093-55616115 GCAACTTTGCTGCATGGTAATGG - Intronic
1069112359 10:64463732-64463754 GCAATCATGGTGGAAGGCAAAGG + Intergenic
1069239112 10:66116770-66116792 ACAATCATGGTGGAAGGTAAAGG + Intronic
1072210321 10:93240258-93240280 GGACCCTTGGTGGAAGTTAAAGG + Intergenic
1072483681 10:95833746-95833768 GCAGGCTTGGTGTCTGGTAAGGG + Intronic
1072554599 10:96505144-96505166 ACAATCATGGTGGAAGGTAAAGG + Intronic
1074561231 10:114537066-114537088 CCATTCCTGGTGGATGGTAAAGG - Intronic
1074789528 10:116872546-116872568 ACAATCATGGTGGAAGGTAAAGG - Intronic
1076191313 10:128485448-128485470 ACAATCGTGGTGGAAGGTAAAGG + Intergenic
1076529599 10:131135752-131135774 GCAGCCTTGCTGGAAGGTACAGG - Intronic
1077712928 11:4554116-4554138 GCAACTTTGGGGCATGGAAATGG - Intergenic
1078809777 11:14747031-14747053 ACAACCATGGTGGAAGGCAAAGG + Intronic
1081425455 11:42921698-42921720 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1082208856 11:49472413-49472435 GCAAACTTGGTGTCTGGTGAGGG - Intergenic
1087427256 11:98006282-98006304 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1087628426 11:100622790-100622812 ACAACCATGGTGGAAGGCAAAGG + Intergenic
1088645627 11:111913978-111914000 GCATCCTTGGGGGAAGGGAAAGG + Exonic
1089841798 11:121425092-121425114 CCAACCATGGTGGAAGGTGAAGG - Intergenic
1090022602 11:123141033-123141055 GCAATCATGGTGGAAGGCAAAGG - Intronic
1090842167 11:130499760-130499782 GAAACCTTTGTGGAAGGTATTGG - Intergenic
1092310427 12:7345829-7345851 ACAACCATGGTGGAAGGCAAAGG + Intergenic
1092656164 12:10687431-10687453 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1093513783 12:19960807-19960829 GCAATCATGGTGGAAGGCAAAGG + Intergenic
1093821879 12:23629775-23629797 GGATCCTTGGTGGATGATAGAGG - Intronic
1095362472 12:41359688-41359710 ACAATCATGGTGGAAGGTAAAGG - Intronic
1095395517 12:41757954-41757976 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1095929157 12:47608458-47608480 AGAACATTGATGGATGGTAAAGG - Intergenic
1096913461 12:55007461-55007483 ACAACCATGGTGGAAGGCAAAGG - Intergenic
1097400966 12:59127242-59127264 ACAACCATGGTGGAAGGTGAAGG + Intergenic
1097513231 12:60568984-60569006 ACAATCTTGGTGGAAGGCAAAGG - Intergenic
1099062878 12:77934194-77934216 GCAGCCTTGGTGGGTAGCAATGG - Intronic
1099573018 12:84348842-84348864 GCAACCAAGGTGGATGGCAGAGG + Intergenic
1099914280 12:88872776-88872798 GCAATCATGGTGGAAGGTGAAGG - Intergenic
1100072345 12:90736011-90736033 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1101724741 12:107379497-107379519 ACAATCATGGTGGAAGGTAAAGG - Intronic
1104205924 12:126638379-126638401 CCAATCATGGTGGAAGGTAAAGG + Intergenic
1104393029 12:128407278-128407300 ACAATCATGGTGGAAGGTAAAGG - Intronic
1105718998 13:23095352-23095374 GCAGGCTTGGTGTCTGGTAAGGG - Intergenic
1105955599 13:25279358-25279380 ACAATCTTGGTGGAAGGTGAAGG - Intronic
1108323300 13:49306687-49306709 GTTACATTGGTTGATGGTAAAGG + Intergenic
1108882442 13:55137150-55137172 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1109252305 13:60033495-60033517 GGAAGCTTGGTGGAAGGTGAAGG + Intronic
1109687289 13:65838183-65838205 ACAACCATGGTGGAAGGCAAAGG + Intergenic
1110632137 13:77721270-77721292 GCAATCATAGTGGAAGGTAAAGG - Intronic
1111209299 13:85055905-85055927 ACAACCGTGGTGGAAGGCAAAGG + Intergenic
1111772153 13:92610712-92610734 ACAATCTTGGTGGAAGGTGAAGG + Intronic
1112052923 13:95662149-95662171 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1112223943 13:97519024-97519046 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1112286239 13:98107032-98107054 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1112790416 13:102996499-102996521 GCAATCATGGTGGAAGGTGAAGG + Intergenic
1114466096 14:22923938-22923960 GCAACCTGGGAGGAGGGTACAGG - Intronic
1115004330 14:28463564-28463586 GCAATCATGGTGGAAGGTGAAGG + Intergenic
1115079887 14:29437598-29437620 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1115121555 14:29942795-29942817 ACAATCTTGGTGGAAGGTGAAGG - Intronic
1116078904 14:40147627-40147649 GCAAATTTGGTGTCTGGTAAGGG - Intergenic
1117226833 14:53669723-53669745 GCAGCCTTGGTAAAAGGTAAGGG - Intergenic
1118755428 14:68839555-68839577 TCAACCATGGTGGAATGTAAAGG - Intergenic
1119038123 14:71247772-71247794 GCAATCATGGTGGAAGGTGAAGG + Intergenic
1119906830 14:78312714-78312736 GCAGCCTTGGGGGATGTTGATGG + Intronic
1120265754 14:82248681-82248703 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1120623156 14:86791168-86791190 CCAATCATGGTGGAAGGTAATGG - Intergenic
1120912290 14:89678197-89678219 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1122043851 14:99009527-99009549 GCAATCATGGTGGAAGGCAAGGG - Intergenic
1126882149 15:53110609-53110631 ACAACCATGGTGGAAGGCAAGGG - Intergenic
1129463410 15:75711131-75711153 CAAGCCTTGGTGGATGGGAAGGG - Intronic
1129721477 15:77880271-77880293 CAAGCCTTGGTGGATGGGAAGGG + Intergenic
1129970756 15:79775926-79775948 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1130049101 15:80468382-80468404 GAAACCTTGCTGGACAGTAAAGG - Intronic
1130163576 15:81427489-81427511 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1131694674 15:94863749-94863771 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1131847494 15:96503398-96503420 GCAATCATGGTGGACGGCAAAGG + Intergenic
1131904647 15:97129827-97129849 CCCAGCTTGGTGCATGGTAACGG + Intergenic
1134303105 16:13008728-13008750 ACAATCATGGTGGAAGGTAAAGG - Intronic
1134558219 16:15184598-15184620 GCAACCAGGGAGGATGCTAAAGG - Intergenic
1134918751 16:18096200-18096222 GCAACCAGGGAGGATGCTAAAGG - Intergenic
1135273967 16:21094940-21094962 ACAACCATGGTGGAAGGTGAAGG - Intronic
1135783586 16:25327836-25327858 GCAATCATGGTGGAAGGTGAAGG - Intergenic
1138030762 16:53557869-53557891 GCAGCCTTGGTAGATTGGAATGG + Intergenic
1138861354 16:60762142-60762164 ACAACCATGGTGGAAGGCAAAGG + Intergenic
1139245077 16:65433629-65433651 ACAATCATGGTGGATGGCAAAGG - Intergenic
1139320827 16:66112404-66112426 GCAAATTTGGTGTCTGGTAAGGG - Intergenic
1140146743 16:72318988-72319010 GCAATCATGGAGGAAGGTAAAGG + Intergenic
1140706880 16:77639019-77639041 GCAAACTTGGTATATGGTAAGGG - Intergenic
1145190411 17:20837315-20837337 GCAACTTTGCTGCATGGTAGTGG - Intronic
1145401629 17:22541197-22541219 GCAACTTTGCTGCATGGTAATGG - Intergenic
1148762451 17:50013845-50013867 GCAATCATGGTGGAAGGCAAAGG + Intergenic
1149067979 17:52503089-52503111 ACAACCATGGTGGAAGGTGAAGG - Intergenic
1153689198 18:7574516-7574538 GGCCCCTTTGTGGATGGTAATGG + Intronic
1155287495 18:24305898-24305920 ACAATCTTGGTGGAAGGTGAAGG - Intronic
1155309284 18:24508635-24508657 CCAACCTTGCTGCATGGAAATGG + Intergenic
1157524903 18:48373318-48373340 GCCATCATGGTGGAAGGTAAAGG - Intronic
1157911412 18:51620425-51620447 GCAAATTTGGTGTGTGGTAAAGG - Intergenic
1158018774 18:52815531-52815553 GCAAACTTGGTTCCTGGTAAGGG - Intronic
1158108861 18:53917464-53917486 ACAACCATGGTGGAAGGCAAAGG - Intergenic
1158211143 18:55051725-55051747 GCAATCATGGTGGAAGGTAAAGG - Intergenic
1158729973 18:60011541-60011563 ACAATCTTGGTGGAAGGTGATGG + Intergenic
1159951692 18:74488734-74488756 ACAACCATGGTGGAAGGTGAAGG - Intergenic
1160068252 18:75598514-75598536 GAACCCTTGGTGGAGGGTGAAGG - Intergenic
1160536025 18:79592787-79592809 ACAACCATGGTGGAAGGCAAAGG + Intergenic
1162419055 19:10555443-10555465 GCAACCCTGCTGGGTGGTAGCGG - Intronic
927269144 2:21187130-21187152 ACAATCATGGTGGATGGTGAAGG + Intergenic
928327529 2:30331742-30331764 GCAATCATGGTGGAAGGCAAAGG - Intergenic
930989259 2:57631209-57631231 ACAATCATGGTGGAAGGTAAAGG + Intergenic
932325703 2:70860063-70860085 ACAATCTTGGTGGAAGGCAAAGG + Intergenic
932509252 2:72268819-72268841 ACAACCATGGTGGAAGGTGAAGG - Intronic
933000273 2:76912854-76912876 CCAAACTTGGTGGAAGGCAAAGG - Intronic
933082414 2:78007151-78007173 GCAAACTTGGGGGATGGGAAGGG + Intergenic
933113893 2:78441514-78441536 GCAATCATGGTGGAAGGTGAAGG - Intergenic
933361731 2:81295345-81295367 TCAACCATGGTGGAAGGCAAAGG - Intergenic
935826000 2:106950349-106950371 ACAATCTTGGTGGAAGGTGAAGG + Intergenic
936713328 2:115158927-115158949 GAAAATATGGTGGATGGTAAGGG + Intronic
939061576 2:137428985-137429007 GCAAACTTGGTGTCTGGTGATGG - Intronic
939783047 2:146473590-146473612 GCAATCGTGGTGGAAGGTGAAGG - Intergenic
940488526 2:154327233-154327255 TCAACCATGGTGGAAGGCAAAGG - Intronic
940622266 2:156126930-156126952 ACAATCATGGTGGAAGGTAAAGG + Intergenic
942129982 2:172868877-172868899 GCAATCATGGTGGAAGGTGAAGG + Intronic
942234473 2:173890554-173890576 ACAAGCTTGGTGGAAGGTGAAGG - Intergenic
942723094 2:178974747-178974769 GGAACCTTGCTAGATGCTAAGGG + Intronic
942935576 2:181552486-181552508 ACAACCATGGTGGAAGGCAAAGG - Intronic
943185815 2:184606278-184606300 ACAATCATGGTGGATGGTGAGGG + Intronic
943208618 2:184932371-184932393 ACAATCTTGGTGGAAGGCAAAGG + Intronic
945414060 2:209548846-209548868 GCAAGCATGGTGGAAGGCAAAGG - Intronic
946809277 2:223506100-223506122 CCAATCATGGTGGAAGGTAAAGG - Intergenic
947259805 2:228208387-228208409 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1169301269 20:4443774-4443796 GCAGGCTTGGTGTCTGGTAAGGG + Intergenic
1169954642 20:11087736-11087758 GCACTCATGGTGGAAGGTAAAGG + Intergenic
1171362360 20:24596946-24596968 GCAGCCTGTGTAGATGGTAAAGG + Intronic
1172210211 20:33192383-33192405 GCAGACTTGGTGTCTGGTAAAGG + Intergenic
1173365474 20:42380950-42380972 ACAATCATGGTGGATGGCAAAGG + Intronic
1175626966 20:60496884-60496906 GCAACATTGGTGCATTTTAATGG + Intergenic
1177290314 21:19103078-19103100 ACAACCATGGTGGAAGGTGAAGG - Intergenic
1177525053 21:22279791-22279813 GCAATCATGGTGGAAGGCAAAGG + Intergenic
1177634268 21:23766880-23766902 GCAATCATGGTGGAAGGTGAAGG - Intergenic
1178371534 21:32031127-32031149 GCAATCATGGTGGAAGGTGAAGG - Intronic
1178602206 21:34004418-34004440 CCATCTTTGGTGGATGGAAATGG - Intergenic
1178806731 21:35845620-35845642 GCACCATTGGTGGATGGAAAAGG - Intronic
1182356672 22:29725215-29725237 GCATCCTTGGGGGCTGGAAAAGG + Intronic
1182920527 22:34075151-34075173 GCAGACTTGGTGTCTGGTAAGGG + Intergenic
1183073615 22:35412809-35412831 GCAAGCTTGGGGGCTGGCAAAGG - Intronic
950101945 3:10362605-10362627 GGTCCCTTGGTGGATGGTACGGG + Intronic
951644434 3:24872538-24872560 CCAACCATGGTGGAAGGTGAAGG + Intergenic
951949781 3:28187163-28187185 ACAATCATGGTGGAAGGTAAAGG + Intergenic
952662850 3:35872331-35872353 ACAATCATGGTGGAAGGTAAGGG + Intergenic
954214456 3:49116720-49116742 GCAACCTTGGTGGATGGTAAAGG - Exonic
955474815 3:59325885-59325907 ACAACCATGGTGGAAGGCAAAGG + Intergenic
956109474 3:65856181-65856203 GCTACCATAGTGGATAGTAAAGG + Intronic
956252835 3:67252786-67252808 GCAATCATGGTGGATGGTGAAGG - Intergenic
956578701 3:70784713-70784735 ACAATCATGGTGGATGGCAAAGG - Intergenic
956860518 3:73319229-73319251 ACAATCATGGTGGAAGGTAAAGG - Intergenic
957332689 3:78786735-78786757 ACAACCCTGGTGGAAGGCAAAGG - Intronic
958175619 3:89992104-89992126 ACAATCATGGTGGAAGGTAAAGG - Intergenic
961179877 3:124868117-124868139 ACAACCGTGGTGGAAGGTGAAGG - Intronic
961818352 3:129562773-129562795 TCGACCTTGGTGGGTGGGAATGG - Exonic
962852757 3:139319988-139320010 GCAACACTGGTGGATGGAGAAGG + Intronic
963538795 3:146561423-146561445 ACAACCATGGTGGAAGGTAAAGG + Intergenic
966342923 3:178945553-178945575 TTAACCATGGTGGAAGGTAAAGG + Intergenic
966448902 3:180036173-180036195 GCAACCTTTTCAGATGGTAAAGG + Intronic
967567268 3:190987396-190987418 GCAATCATGGTGGAGGGCAAAGG - Intergenic
967776856 3:193394351-193394373 ACAATCATGGTGGAAGGTAAAGG + Intergenic
967810709 3:193758713-193758735 ACAAACATGGTGGAAGGTAAAGG + Intergenic
968029488 3:195471246-195471268 GCAAACTTGCTGGATTGTCAAGG - Intergenic
968810426 4:2797316-2797338 GAAACCAGGGTGGGTGGTAAAGG - Intronic
968912120 4:3481588-3481610 GCCACCTTGGGGGATGGAGAGGG + Intronic
969168771 4:5341766-5341788 GCAGTCATGGTGGAAGGTAAAGG + Intronic
970072527 4:12177633-12177655 ACAACCATGGTGGAAGGCAAAGG + Intergenic
971278122 4:25217151-25217173 ACAATCATGGTGGAAGGTAAAGG + Intronic
972102107 4:35432735-35432757 ACAACCATGGTGGAAGGTGAAGG - Intergenic
972107383 4:35506376-35506398 ACAACCATGGTGGAAGGCAAAGG - Intergenic
973780545 4:54284493-54284515 CCAATCATGGTGGAAGGTAAAGG + Intronic
974980895 4:68956054-68956076 GCAACTTTGGAGCTTGGTAATGG + Intergenic
976680629 4:87752567-87752589 ACAATCATGGTGGAAGGTAAAGG + Intergenic
977579993 4:98714459-98714481 ACAACCATGGTGGAAGGTGAGGG + Intergenic
977589161 4:98807488-98807510 GCAGACTTGGTGTCTGGTAAGGG - Intergenic
978913131 4:114089411-114089433 ACAATCATGGTGGAAGGTAAAGG - Intergenic
981698238 4:147580524-147580546 GCAATCATGGTGGAAGGCAAAGG + Intergenic
981709542 4:147695543-147695565 GCAGCTTTGGTGTCTGGTAAGGG + Intergenic
982336851 4:154249655-154249677 GCAACCTAGGTGCCTGTTAATGG + Intronic
982652930 4:158109365-158109387 GTAATCATGGTGGAAGGTAAAGG - Intergenic
983029128 4:162776822-162776844 GCAGCCTTAGTGCATGTTAAGGG - Intergenic
983309279 4:166037103-166037125 GAAACCTTGGTGGTTGCTATAGG + Intronic
983432949 4:167674409-167674431 GCAGATTTGGTGTATGGTAAGGG + Intergenic
984389620 4:179111991-179112013 ACAATCATGGTGGAAGGTAAAGG + Intergenic
985047444 4:185954190-185954212 GCAACCTTGATGAATGGCAACGG - Intronic
986160754 5:5226279-5226301 GCAATCATGGTGGAAGGCAAAGG + Intronic
987441665 5:17964536-17964558 ACAATCATGGTGGAAGGTAAAGG + Intergenic
987806851 5:22780458-22780480 ACAATCATGGTGGATGGTGAAGG + Intronic
988524083 5:31971225-31971247 GCAAGCTTGGTGTCTAGTAAGGG + Intronic
990213583 5:53507142-53507164 ACAATCATGGTGGAAGGTAAAGG + Intergenic
991222800 5:64235852-64235874 GCAATCATGGTGGAAGGTAAAGG - Intronic
991223084 5:64237901-64237923 GCAATCATGGAGGAAGGTAAAGG - Intronic
992236895 5:74719410-74719432 GAATCCTTGGTGGATGGGACAGG + Intronic
994187458 5:96831145-96831167 ACAATCATGGTGGAAGGTAAAGG + Intronic
995336118 5:111001825-111001847 GCAGACTTGGTGTCTGGTAAGGG + Intergenic
997404586 5:133634998-133635020 GCATCCTTGGTGGAAGGTAAAGG + Intergenic
998800558 5:145864673-145864695 ACAATCTTGGTGGAAGGTGAAGG - Intronic
1000361227 5:160449404-160449426 ACAATCATGGTGGATGGTAAAGG - Intergenic
1000414113 5:160965397-160965419 GCAATCATGGTGGAGGGCAAAGG - Intergenic
1000559383 5:162767108-162767130 GCAATCATGGTGGAAGGCAAAGG + Intergenic
1001033345 5:168278717-168278739 GCCACCTTGGTGCATGGTATAGG + Intergenic
1001069577 5:168573283-168573305 GAAAAGTTGGTGGCTGGTAATGG + Intronic
1002317710 5:178354662-178354684 ACAATCATGGTGGATGGTGAAGG - Intronic
1004235685 6:13872936-13872958 TAAACCTGGGTGGGTGGTAAGGG - Intergenic
1004287695 6:14337910-14337932 GTAACCTGAGTGCATGGTAAAGG + Intergenic
1006636684 6:35466340-35466362 GGTCCCTTGGTGGATGGTCAGGG - Exonic
1007523343 6:42468614-42468636 GCAGCTTTGGTGTTTGGTAAGGG + Intergenic
1010686876 6:78863752-78863774 GCAACCTTGGTGGGTGGCATGGG - Intergenic
1010919871 6:81668228-81668250 AGAATCTTGGTAGATGGTAATGG + Intronic
1012693512 6:102348283-102348305 ACAATCGTGGTGGAAGGTAAAGG - Intergenic
1013404391 6:109830205-109830227 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1014044015 6:116862688-116862710 CCAATCATGGTGGAAGGTAAAGG - Intergenic
1014336449 6:120142610-120142632 GCAGCTTTGGTGGCTGGTTAGGG - Intergenic
1015175564 6:130303711-130303733 GCAAGCTAGGTGAATGGTGATGG - Intronic
1015369346 6:132433609-132433631 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1016338647 6:143035858-143035880 GTAATCTTGGTAGATGCTAAAGG - Intergenic
1017498824 6:155005073-155005095 GAAGGCTTGGAGGATGGTAATGG + Intronic
1018535571 6:164815194-164815216 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1019618902 7:1979991-1980013 GGAACCTAGGTGGATGGGATGGG + Intronic
1020795302 7:12671617-12671639 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1021761090 7:23903790-23903812 TCAATCTTGGTGGAAGGTGAAGG + Intergenic
1022727141 7:32991644-32991666 GCAAGATTGGTGGAGGGGAAAGG + Intronic
1022841500 7:34168343-34168365 ACAATCTTGGTGGAAGGCAAAGG - Intergenic
1023368841 7:39491772-39491794 GCAAATTTGGAGGCTGGTAAGGG - Intronic
1024325403 7:48105654-48105676 GCAAACTTGGTGTCTGGTGAGGG + Intronic
1025046440 7:55695986-55696008 GCAAGATTGGTGGAGGGGAAAGG - Intergenic
1026719545 7:72818725-72818747 CCAATCTTGGTGGAAGGCAAAGG + Intronic
1027269802 7:76513146-76513168 GCTACCTTGGTGGAGAGTGATGG - Intronic
1028517072 7:91689622-91689644 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1029232759 7:99085034-99085056 TCAACCATGGTGGAAGGTGAAGG - Intronic
1029393538 7:100291112-100291134 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1029883344 7:103840050-103840072 ACAATCATGGTGGATGGTGAAGG - Intronic
1029981156 7:104880311-104880333 CCAATCTTGGTGGAAGGTAAAGG - Intronic
1030502405 7:110376434-110376456 GCAATCATGGTGGAAGGCAAAGG + Intergenic
1032777814 7:135132764-135132786 GCAATCTTGGCGGAAGGCAAAGG - Intronic
1032988273 7:137362600-137362622 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1033672466 7:143505977-143505999 GCAATCATGGTGGAAGGTGAAGG - Intergenic
1034061982 7:148100315-148100337 GTCACCTTTGTGGATGGTAATGG - Intronic
1034941622 7:155234323-155234345 GCCACCTTGCTGGATGGTTGAGG - Intergenic
1035859541 8:3013023-3013045 ACAATCATGGTGGAAGGTAAAGG - Intronic
1035898093 8:3426935-3426957 ACAATCGTGGTGGAAGGTAAAGG + Intronic
1037055955 8:14442371-14442393 ACAATCATGGTGGAAGGTAAAGG - Intronic
1037065425 8:14571118-14571140 ACAATCTTGGTGGAAGGTGAAGG + Intronic
1037521685 8:19686112-19686134 TCAACCTTGGCCGATGGAAATGG + Intronic
1039410166 8:37348279-37348301 ACAACCATGGTGGAAGGCAAAGG + Intergenic
1039632949 8:39133276-39133298 CCATCCATGGTGGAAGGTAAAGG - Intronic
1039853018 8:41387638-41387660 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1041216811 8:55608836-55608858 GCAATCATGGTGGAAGGTGAAGG + Intergenic
1041430820 8:57778731-57778753 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1042066503 8:64883241-64883263 AAAACCATGGTGGATGGTGAAGG + Intergenic
1042739283 8:72025378-72025400 GCAATCATGGTGGAAGGTGAAGG - Intronic
1043050912 8:75384414-75384436 GCCCCCATGGTGGATGGTAGAGG - Intergenic
1043217962 8:77620261-77620283 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1043675883 8:82953041-82953063 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1043779287 8:84312067-84312089 GCAATCATGGTGGAAGGTGAAGG + Intronic
1045097165 8:98809995-98810017 CCAACCATGGTGGAAGGCAAAGG + Intronic
1045526803 8:102947596-102947618 ACAACCATGGTGGAAGGCAAAGG + Intronic
1045996131 8:108364384-108364406 ACAATCATGGTGGATGGCAAAGG + Intronic
1046013890 8:108583037-108583059 ACAGCCTTGGTGCATAGTAAGGG - Intergenic
1046104523 8:109649595-109649617 GGAACGTTGAAGGATGGTAAGGG + Intronic
1046782703 8:118232469-118232491 GCAAAGTTGGGGAATGGTAAGGG + Intronic
1048114588 8:131507442-131507464 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1048679154 8:136819965-136819987 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1049148843 8:141021351-141021373 CCAGCCTTGGTGGAGGGTGAGGG + Intergenic
1049521916 8:143095659-143095681 GCAACCATGGCGGAAGGCAATGG - Intergenic
1050148279 9:2593012-2593034 GCAATCATGGTGGAAGGTGATGG + Intergenic
1052208426 9:25871200-25871222 ACAACCATGGTGGAAGGCAAAGG + Intergenic
1054820860 9:69519163-69519185 CAAACCTTGATGGATGGTTAAGG + Intronic
1054848640 9:69823127-69823149 ACAACCATGGTGGAAGGCAAAGG + Intronic
1055561993 9:77530354-77530376 ACAATCATGGTGGAAGGTAAAGG - Intronic
1055861616 9:80756967-80756989 ACAATCATGGTGGAAGGTAAGGG + Intergenic
1056256843 9:84808161-84808183 GCATCCTGAGTGGATGGCAATGG + Intronic
1056819249 9:89825736-89825758 ACAACCATGGTGGAAGGTGAAGG + Intergenic
1057232568 9:93333049-93333071 ACAATCGTGGTGGATGGCAAAGG - Intronic
1058385234 9:104428392-104428414 TCAATCATGGTGGAAGGTAAAGG - Intergenic
1059104053 9:111496336-111496358 ACAATCTTGGTGGAAGGTGAAGG - Intergenic
1059371654 9:113844438-113844460 GCATCATTGGTGGGTGGTGAAGG + Intergenic
1060211588 9:121713660-121713682 ACAAGCTTGGTGGATGGCCAGGG + Intronic
1060327826 9:122634473-122634495 GCAATCATGGTGGAGGGCAAAGG + Intergenic
1061891961 9:133626760-133626782 ACAATCTTGGTGGAAGGTAAAGG + Intergenic
1061977927 9:134081490-134081512 ACAACCATGGTGGAAGGCAAAGG - Intergenic
1186103398 X:6180449-6180471 ACAATCTTGGCGGAAGGTAAAGG - Intronic
1186125976 X:6414306-6414328 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1186347169 X:8705599-8705621 GCAACATAGGTGGATCGTGATGG - Intronic
1187795070 X:22994684-22994706 GCAGACTTGGTGTCTGGTAAGGG + Intergenic
1187882681 X:23861365-23861387 GCAATCATGGTGGAAGGCAAAGG - Intronic
1188030329 X:25256321-25256343 GAAATCATGGTGGAAGGTAAAGG - Intergenic
1188348085 X:29093278-29093300 ACAATCATGGTGGAAGGTAAAGG + Intronic
1188619662 X:32204758-32204780 CCAACCATGGTGGAAGGCAAAGG + Intronic
1189401827 X:40676806-40676828 ACAATCGTGGTGGAAGGTAAAGG - Intronic
1193889454 X:87026878-87026900 GCAATCATGGTGGAAGGTGAAGG + Intergenic
1193988557 X:88276496-88276518 ACAATCATGGTGGAAGGTAAGGG - Intergenic
1194154948 X:90376117-90376139 GCAATCATGGTGGAAGGTGAAGG + Intergenic
1194288110 X:92036531-92036553 ACAATCTTGGTGGAAGGTGAAGG - Intronic
1194409703 X:93543008-93543030 GCAATCATGGTGGAAGGTGAAGG + Intergenic
1195276897 X:103289969-103289991 GCAAACTTGGTGTTTGGTGAGGG - Intergenic
1196382351 X:115104515-115104537 GCAGACTTGGTGTCTGGTAAGGG - Intergenic
1196986271 X:121275751-121275773 ACAATCATGGTGGATGGAAAAGG - Intergenic
1197366633 X:125572080-125572102 ACAACCATGGTGGAAGGCAAAGG + Intergenic
1197551686 X:127899998-127900020 ACAATCATGGTGGAAGGTAAAGG - Intergenic
1197602263 X:128543967-128543989 GAAACCTTGGTTGCTGGTGAAGG + Intergenic
1197921692 X:131601453-131601475 ACAATCATGGTGGAAGGTAAAGG + Intergenic
1199075937 X:143526102-143526124 GCAAACTTGGTAGGTGGTATGGG + Intergenic
1199203706 X:145123584-145123606 ACAACCGTGGTGGAAGGCAAAGG + Intergenic
1199240901 X:145546234-145546256 ACAACCATGGTGGAAGGCAAGGG + Intergenic
1199574407 X:149299568-149299590 GCAATCATGGTGGAAGGCAAAGG - Intergenic
1199795016 X:151186155-151186177 ACAACCATGGTGGAAGGTGAAGG + Intergenic
1199922351 X:152420942-152420964 ACAATCATGGTGGAAGGTAAAGG - Intronic
1200353912 X:155527360-155527382 ACAATCTTGGTAGAAGGTAAAGG - Intronic
1200501296 Y:3953003-3953025 GCAATCATGGTGGAAGGTGAAGG + Intergenic
1200718500 Y:6576696-6576718 ACAACCATGGTGGAAGGCAAAGG - Intergenic
1200758509 Y:7014331-7014353 ACAACCATGGTGGAAGGTGAAGG - Intronic
1201425255 Y:13843195-13843217 ACAACCATGGTGGAAGGCAAAGG + Intergenic