ID: 954216188

View in Genome Browser
Species Human (GRCh38)
Location 3:49125762-49125784
Sequence GGCCAAAGCCATAGTAGCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954216185_954216188 -7 Left 954216185 3:49125746-49125768 CCTTGACAGCCTGTGGGGCCAAA 0: 1
1: 0
2: 0
3: 20
4: 139
Right 954216188 3:49125762-49125784 GGCCAAAGCCATAGTAGCCAGGG 0: 1
1: 0
2: 1
3: 11
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954216188 Original CRISPR GGCCAAAGCCATAGTAGCCA GGG Exonic
903802085 1:25976699-25976721 GGCCAAAGCCAGAATAGCTGTGG + Exonic
904351476 1:29909901-29909923 GGACAAATGCATAGTTGCCAAGG - Intergenic
905952211 1:41961384-41961406 TGCCATAGCAATAGTAACCAAGG + Intronic
908226150 1:62057784-62057806 GGCAAATGCCATAGCATCCAGGG + Intronic
908731545 1:67231157-67231179 TGTCAAAGCCACAGTAACCAAGG - Intronic
915078812 1:153337211-153337233 GGGCAATGTCATCGTAGCCAGGG + Exonic
915082362 1:153360875-153360897 GGCCACAGTCATGGTGGCCACGG + Exonic
915598123 1:156906773-156906795 AGGCAGGGCCATAGTAGCCAGGG - Exonic
922607114 1:226896467-226896489 GGCCAAAGCCAGAGAAGGAAAGG - Intergenic
1070562821 10:77580699-77580721 GTCCCAAGCCATAGCAGCCAAGG + Intronic
1071008131 10:80907266-80907288 TACCGAAGCCAAAGTAGCCATGG - Intergenic
1074565063 10:114570141-114570163 GGCAAAAGCCACAGAACCCAAGG + Intronic
1075223767 10:120606882-120606904 GTCAAAAGATATAGTAGCCAGGG - Intergenic
1075245473 10:120818446-120818468 GGCCAGAGCCAGAGAATCCAAGG + Intergenic
1075877990 10:125823487-125823509 GGACCAGCCCATAGTAGCCAAGG - Intergenic
1080814034 11:35736690-35736712 GGCTTTAGCCATAGTAGACAAGG - Intronic
1082617704 11:55381381-55381403 GGCAGTAGCCAGAGTAGCCATGG + Intergenic
1083363910 11:62129922-62129944 AGCCAATGCCATGGTAGCCGCGG - Exonic
1083418393 11:62539806-62539828 GGCCACAGCCAGAGCAGGCAGGG - Intronic
1084173720 11:67412660-67412682 GGCAAAAGCCAGAGCAGCCAGGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1085384602 11:76149886-76149908 GGCCAAAGACCCAGGAGCCATGG + Intergenic
1087170706 11:95047395-95047417 GCCCAAAGCATTTGTAGCCATGG - Intergenic
1088871592 11:113894739-113894761 AGACAAAGCTTTAGTAGCCAAGG - Intergenic
1091170723 11:133517666-133517688 GGGCAAAGCCATCGGTGCCAGGG + Intronic
1091926120 12:4351308-4351330 GGCCATGGCCAAAGCAGCCAGGG + Exonic
1097824076 12:64156763-64156785 GCCCAAAGCCATAGAAAACATGG - Exonic
1099285718 12:80712149-80712171 GGCCAAAGCCAAAATAAACAGGG + Intergenic
1099741789 12:86646937-86646959 GGCCAAAGTGACATTAGCCAAGG + Intronic
1106093603 13:26621992-26622014 GACCCAAGCAAAAGTAGCCAGGG - Intronic
1107823051 13:44303816-44303838 GGCTAAAGCCAAAATAGCAAGGG - Intergenic
1108785991 13:53901936-53901958 GGCCAATATCATAGAAGCCAAGG - Intergenic
1109249408 13:60000938-60000960 GGCTAAAGGAAAAGTAGCCAAGG + Intronic
1109625651 13:64970408-64970430 GGAGAAAACCAGAGTAGCCACGG - Intergenic
1114548847 14:23522037-23522059 GGCAAAAGCCACAGCAGCCGAGG + Exonic
1118682928 14:68261994-68262016 GCTCAAAGCCATACTAGCCATGG + Intronic
1118950626 14:70433679-70433701 GGCCATAGCCAGAGCAGCCTTGG + Intergenic
1121774331 14:96580493-96580515 GGCCAAAGCCAGTGTAGCATAGG + Intergenic
1125296770 15:38211863-38211885 GGTCAATGCCGTATTAGCCAGGG + Intergenic
1127569019 15:60222552-60222574 GGCCATTGCTCTAGTAGCCAAGG - Intergenic
1131576685 15:93599222-93599244 GTCAAAGGCCACAGTAGCCATGG - Intergenic
1131982737 15:98011034-98011056 GGCAAAAGCCAGGGCAGCCAGGG - Intergenic
1138442355 16:57042632-57042654 GGCCAAAGCCAGAGGAGCCCAGG + Intronic
1138894077 16:61181831-61181853 GGCCTAAGACATAGTAGAAAAGG + Intergenic
1139659853 16:68413236-68413258 GGCCAAAGCTATGGAGGCCAGGG - Intronic
1140679182 16:77367555-77367577 GGCCAGAGCCGGGGTAGCCACGG + Exonic
1143701897 17:8666741-8666763 TGTCAAAGTCACAGTAGCCAAGG + Intergenic
1151211848 17:72550309-72550331 GACCACAGCCCTAGTAGCTAGGG - Intergenic
1155602768 18:27568727-27568749 GGGCAAGGAAATAGTAGCCAGGG + Intergenic
1156331220 18:36125476-36125498 GGCCATAGCCATAGCAGCCCTGG - Intronic
1156654799 18:39272429-39272451 GACCAAACACATAGTAGCGAGGG - Intergenic
1156777588 18:40811543-40811565 GACCAATGCCTTAGTGGCCATGG + Intergenic
1158388591 18:57022980-57023002 TGCCAAAGCCAAAGCAGCCCAGG + Intronic
1163862768 19:19750740-19750762 GGCCACAGTCACTGTAGCCATGG - Intergenic
926204989 2:10829446-10829468 GCCAAAAGCCATAATAACCAAGG + Intronic
927607847 2:24504324-24504346 GGCCAAAGCCACAGTAACCAAGG - Intronic
930701670 2:54463891-54463913 TGCTAAAGCCTTAGTAGCTAAGG + Intronic
931778749 2:65562186-65562208 GGCCACAGCCAGCTTAGCCATGG + Intergenic
940851023 2:158688388-158688410 GGCAGAAGCCATAGTACCCAGGG + Intergenic
946047171 2:216830851-216830873 GACAAAAGCCATACTGGCCATGG + Intergenic
946961187 2:224987532-224987554 GGCCAAAGCCAAAATAGTGAGGG - Intronic
947009606 2:225551215-225551237 GGCCAAAGCCAGAGTGGACGTGG - Intronic
1175941146 20:62538053-62538075 GGCCAACGTCAGAGGAGCCACGG - Intergenic
1175942731 20:62545437-62545459 GGACAAAGCCCCAGCAGCCAAGG - Intergenic
1177377227 21:20286859-20286881 GGCCAATGGCATAGTAACCTTGG - Intergenic
1178290773 21:31366167-31366189 GGCCAAGGGCATAGTATTCATGG - Intronic
1179240034 21:39581757-39581779 TGACAAAACCAGAGTAGCCAGGG - Intronic
1180103120 21:45599172-45599194 GGCCAGAGCCATCCTAGCCAGGG - Intergenic
1181036422 22:20171822-20171844 GGCCTGGGCCATGGTAGCCAGGG + Intergenic
1181689745 22:24552232-24552254 GGCCAAGGCAAGAGGAGCCAAGG + Intronic
1184238950 22:43201637-43201659 GTCCAAAGCCCGAGAAGCCAGGG - Exonic
952886697 3:38016787-38016809 GGCCAAGGCCACAGTAGAGAGGG + Intronic
953606438 3:44415957-44415979 GGCTTAAGCCAAAGTAGACAAGG + Intergenic
954216188 3:49125762-49125784 GGCCAAAGCCATAGTAGCCAGGG + Exonic
956087397 3:65627056-65627078 GGTCAAAGCCATACTTACCATGG + Intronic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
963132143 3:141868168-141868190 AGCCAAAACCACAGTAGCTATGG - Intergenic
963888608 3:150608211-150608233 GACTAAGGACATAGTAGCCAGGG + Intronic
966392425 3:179466390-179466412 GCCCAAAGCCAAAATAGACAAGG - Intergenic
970103102 4:12547700-12547722 GGCCAAAGAAATAGTAGAAAAGG + Intergenic
971703311 4:30008008-30008030 AGCAAAAGCCATAGGAGCCCTGG + Intergenic
980065666 4:128186065-128186087 ATACAAAGCCATAGTAACCAAGG - Intronic
982441517 4:155441669-155441691 GGCAAAAGCCATGGCTGCCAGGG - Intergenic
983458419 4:167994936-167994958 GACAAAAGCCATAGTAGGCCTGG - Intergenic
989149060 5:38280412-38280434 GGCTAAACCCAAAGAAGCCAGGG - Intronic
991501163 5:67278945-67278967 GCCCAGAGACATAGAAGCCATGG + Intergenic
992005137 5:72470248-72470270 GGCCAAATCCTAAGTTGCCATGG + Intronic
992958213 5:81932153-81932175 AGGGAAATCCATAGTAGCCATGG - Intergenic
999278210 5:150346600-150346622 GGACAAGGCCATAGAACCCATGG - Intergenic
1007118145 6:39358481-39358503 AGCGAAAGCCAGAGTAGGCAAGG - Intronic
1018810231 6:167293584-167293606 AGCCAACCCCATAGTAGCCTTGG - Intronic
1022960362 7:35420003-35420025 GGCAAAGGACATAGCAGCCAAGG + Intergenic
1026967201 7:74447847-74447869 GGCCAAACCCACAGCAGCCCAGG - Intergenic
1035030269 7:155852334-155852356 CACCAAAGCCATAGGACCCATGG + Intergenic
1036210891 8:6840539-6840561 GGAGAAAGCCATGGTTGCCAAGG + Intergenic
1037185736 8:16060553-16060575 GGCAAAATCCATAGTTGCAAAGG - Intergenic
1037741005 8:21609184-21609206 TGACAAAGTCACAGTAGCCAGGG + Intergenic
1040017104 8:42708632-42708654 GGCCAAGGCCACAGGAGCCATGG + Intronic
1041253101 8:55953877-55953899 GTCCCAAGCCACAGAAGCCATGG + Exonic
1047764507 8:127979628-127979650 GGCCAATGCCAGAGGAGCCTGGG + Intergenic
1048035961 8:130677305-130677327 GGCCAAAGGCATTGTGTCCAGGG - Intergenic
1050410360 9:5357617-5357639 GGCCAAAGCCATACTTGGCCAGG - Intergenic
1051971316 9:22890862-22890884 GACCAAAGCCAGATTAGCCTAGG - Intergenic
1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG + Intergenic
1052594338 9:30539136-30539158 TTCCAAAGCCGTAGTAACCAAGG - Intergenic
1190453927 X:50607424-50607446 CACCAATGCCATAGTAGCAAGGG + Exonic
1190631220 X:52388609-52388631 GGCCAAGGCCATACCAGCCAGGG + Intergenic
1192196814 X:69034104-69034126 GGCCATTGCCATGGCAGCCAGGG + Intergenic
1193560945 X:83014864-83014886 AGCAAATGCCATAGTAACCAAGG - Intergenic
1199024912 X:142925091-142925113 GGCAAAAGCCATAGGAGACAGGG + Intergenic
1200213592 X:154357652-154357674 GGCCCAAGCCCGAGTAGCCCCGG + Intronic