ID: 954216628

View in Genome Browser
Species Human (GRCh38)
Location 3:49128423-49128445
Sequence GTGGTAGCACTCACAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954216628_954216633 0 Left 954216628 3:49128423-49128445 CCTGCCATTGTGAGTGCTACCAC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 954216633 3:49128446-49128468 CAGTGCCCTCACCTGGCATGTGG 0: 1
1: 0
2: 2
3: 48
4: 457
954216628_954216630 -7 Left 954216628 3:49128423-49128445 CCTGCCATTGTGAGTGCTACCAC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 954216630 3:49128439-49128461 CTACCACCAGTGCCCTCACCTGG 0: 1
1: 0
2: 3
3: 12
4: 221
954216628_954216637 16 Left 954216628 3:49128423-49128445 CCTGCCATTGTGAGTGCTACCAC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 954216637 3:49128462-49128484 CATGTGGTTGCAGAGTCCCTTGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954216628 Original CRISPR GTGGTAGCACTCACAATGGC AGG (reversed) Intronic
902073395 1:13762346-13762368 GTGGTGGCACTCACAATAGTAGG - Intronic
909565905 1:77053309-77053331 GTGGCAGAGCTCACATTGGCTGG + Intronic
915477774 1:156163086-156163108 GGGGTAGTACTCACACTGCCTGG - Exonic
918292899 1:183126170-183126192 GGGCTGGCACTCACACTGGCCGG - Exonic
919299720 1:195744418-195744440 GTGTTGGCACTCAGAGTGGCCGG + Intergenic
921101633 1:211933693-211933715 GTGATAACACTCACAAAGCCTGG - Intergenic
922338260 1:224635145-224635167 GTGGTAGGACAGAGAATGGCGGG + Intronic
923818820 1:237411857-237411879 GTGGCAGCACTCACAATGAAAGG + Intronic
924471425 1:244346043-244346065 GTGATAGCAAACACAATGTCTGG - Intergenic
1069726682 10:70584640-70584662 GTGGAAACACTAACAAAGGCAGG + Intergenic
1071828339 10:89347948-89347970 GTGGTAGGCCTCACCATGGAAGG - Intronic
1073082443 10:100868601-100868623 GGGCGAGCACACACAATGGCTGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1094480271 12:30875944-30875966 GGGGTTGCACTGACAATGACAGG - Intergenic
1106232024 13:27827895-27827917 GTGGTAGCAGTCCAAGTGGCAGG - Intergenic
1109282152 13:60369312-60369334 GTGGTAACACTGAGAATTGCAGG - Intergenic
1111672902 13:91350336-91350358 GTGGTGGCTCTTCCAATGGCTGG - Intergenic
1119409194 14:74418820-74418842 ATGGCTTCACTCACAATGGCTGG - Intronic
1120746106 14:88153335-88153357 ATGGTAGTGCTCACAGTGGCCGG - Intergenic
1125920184 15:43520774-43520796 GTGGTAGCACTGGCAAGGGTGGG - Intronic
1137373400 16:47929628-47929650 GTGCCACCACTCACCATGGCAGG + Intergenic
1137654826 16:50151269-50151291 GTGGAAGCCCTCACGAGGGCAGG + Intergenic
1138198978 16:55075029-55075051 GGAGTAGCACTCCCCATGGCCGG + Intergenic
1140075845 16:71698191-71698213 GTGGAAGCCCTCACAAGAGCAGG + Intronic
1140703245 16:77601979-77602001 GTGTTGGCACTCAGAGTGGCTGG + Intergenic
1147668986 17:42165935-42165957 GTGATAAAAATCACAATGGCCGG + Intronic
1149056224 17:52369528-52369550 CTGGTAGCACTCTCAACAGCTGG + Intergenic
1149481254 17:57005182-57005204 ATGGTGGCACTCAAAAAGGCTGG + Intronic
1150898414 17:69240387-69240409 ATGGTAGCACTCTCAGAGGCAGG + Intronic
1151200927 17:72467650-72467672 GGGGTAGTACTCACAGGGGCAGG - Intergenic
1152142400 17:78544481-78544503 GTGGTAGAACTCCCACTTGCAGG - Intronic
1153618968 18:6958414-6958436 GTGTTAGCACTCACCATGAAAGG + Intronic
1156060027 18:33063205-33063227 GTGTTGGCACTGGCAATGGCAGG - Intronic
1158362051 18:56685964-56685986 GTGGTAGCACTCTCGGTGACTGG + Exonic
925907630 2:8548669-8548691 CTTGTAGCACCCACAAAGGCAGG - Intergenic
931546728 2:63396555-63396577 GTGAGAGCACACACCATGGCTGG + Intronic
932928081 2:76000235-76000257 GTGGGAGCACCCACATTAGCAGG - Intergenic
938699473 2:133863288-133863310 GTGGGAGCATGCACACTGGCAGG + Intergenic
948409927 2:237751388-237751410 GTAGAAGAACTCACAATGGCAGG + Intronic
1168903994 20:1389705-1389727 GGGGCTGCTCTCACAATGGCAGG + Intronic
1169152126 20:3297643-3297665 GTGGTACCATTCGCAAGGGCAGG + Intronic
1169920424 20:10729099-10729121 GTGAAAGCAGCCACAATGGCAGG + Intergenic
1170493916 20:16906094-16906116 GTGGTAGAATTCAGAGTGGCTGG + Intergenic
1175760875 20:61561534-61561556 CTGGTAGAAAACACAATGGCAGG + Intronic
1180968460 22:19802577-19802599 TCGGCAGCACTCACAGTGGCTGG - Intronic
1184431543 22:44444086-44444108 CTGGAAGCACTCACAATACCAGG - Intergenic
949356335 3:3184021-3184043 GTGGTTGCACACACAAATGCAGG - Intergenic
951609994 3:24480851-24480873 GTGGCAGCTTTCACAATGCCTGG - Intronic
952417804 3:33105376-33105398 GTGGTGGTACCCACAAGGGCAGG + Intergenic
954216628 3:49128423-49128445 GTGGTAGCACTCACAATGGCAGG - Intronic
954812582 3:53257114-53257136 GTGGTAGCCATGACAATGCCAGG + Intergenic
956821973 3:72962109-72962131 GTGGTTGCACGCTCAAGGGCAGG - Intronic
956911935 3:73827207-73827229 GTGGTATCATGCATAATGGCTGG - Intergenic
960674551 3:120181721-120181743 GTGGTAGCACTCACTATCAGAGG - Intronic
962781843 3:138726495-138726517 GTGGTAGCAGTGGCAGTGGCAGG - Intronic
963065453 3:141260373-141260395 TTGTTGGCACTCACAGTGGCCGG + Intronic
969530055 4:7725560-7725582 GTGGTAGAAGTCACAGAGGCAGG + Intronic
973942441 4:55924340-55924362 CTGGTAGCTCTCAGCATGGCTGG - Intergenic
974154428 4:58052768-58052790 ATGGTAGCACTCAGAAGGGCAGG + Intergenic
977869325 4:102071093-102071115 ATGGTTTCACTCACAGTGGCTGG + Intronic
989796603 5:45482260-45482282 GTGGCAGCACCAACAGTGGCAGG + Intronic
994583933 5:101682203-101682225 GTGCTAGCTTTCAGAATGGCAGG - Intergenic
998808871 5:145945814-145945836 CTGATAGTCCTCACAATGGCAGG - Intronic
999266745 5:150271483-150271505 GTGGCAGTCCTCACAGTGGCTGG - Intronic
1002417012 5:179125984-179126006 CTGGGGGCACTCACACTGGCTGG + Exonic
1002720354 5:181256600-181256622 GTGGCAGCACTCAGAATGCAAGG + Exonic
1016743638 6:147554505-147554527 CTGGCTGCACTCACAATTGCTGG + Intronic
1018909617 6:168094466-168094488 GTGGAACCACTCTGAATGGCTGG - Intergenic
1019717218 7:2544895-2544917 GTGGGCGCACTCACCATGGTCGG + Exonic
1019906071 7:4066270-4066292 GAGGTAGGGCTCTCAATGGCAGG + Intronic
1021798781 7:24284267-24284289 GTCGTAGCACTCACGGTGGCTGG - Exonic
1022219553 7:28299170-28299192 GTAAAAGCAATCACAATGGCCGG - Intergenic
1025189190 7:56883769-56883791 GTGCTAGCAATCAAAATAGCAGG + Intergenic
1025682749 7:63693148-63693170 GTGCTAGCAATCAAAATAGCAGG - Intergenic
1042082855 8:65074838-65074860 TTGGTAGAATTTACAATGGCTGG - Intergenic
1044384103 8:91567016-91567038 ATGGTAGCGCTCACATTTGCTGG - Intergenic
1046197338 8:110882455-110882477 GTGGTAGCACTCGCCATGAAAGG + Intergenic
1046728259 8:117697620-117697642 GTGGTGGCACACACACTGGGTGG - Intergenic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1047413406 8:124642968-124642990 TTGTTAGTTCTCACAATGGCTGG - Intronic
1050281554 9:4055666-4055688 GTGTTATCACTTTCAATGGCAGG + Intronic
1051590515 9:18772760-18772782 AAGGAAGCACTCACCATGGCTGG + Intronic
1052163138 9:25290196-25290218 CTGGTAACACTCACAATGGAGGG + Intergenic
1052271113 9:26628859-26628881 GTGGTATCACTCAAAATAGGAGG + Intergenic
1053237215 9:36466433-36466455 GAGGTAGCAGGCACAATGGGAGG + Intronic
1053667504 9:40326374-40326396 GTGGCAGCACTCCCAGTGTCTGG - Intronic
1053917085 9:42951477-42951499 GTGGCAGCACTCCCAGTGTCTGG - Intergenic
1054378649 9:64466401-64466423 GTGGCAGCACTCCCAGTGTCTGG - Intergenic
1054517107 9:66049911-66049933 GTGGCAGCACTCCCAGTGTCTGG + Intergenic
1054944791 9:70784237-70784259 GTGGTGGCACTCATAGTGGAAGG - Exonic
1055440024 9:76328159-76328181 GTGGAAGCACTTAACATGGCAGG - Exonic
1056513455 9:87328074-87328096 GTGGGGACATTCACAATGGCAGG + Intergenic
1060277236 9:122191537-122191559 GTGGCAGAGCTCACAATGGCCGG - Intronic
1188712441 X:33416746-33416768 GTGGTAGCTCTCTCAAATGCTGG - Intergenic
1192560999 X:72127967-72127989 GTGGTGGGACTCTGAATGGCTGG + Exonic
1194033050 X:88839399-88839421 GGGTTAGCACTCACAATACCTGG + Intergenic
1197896390 X:131319980-131320002 ATGGTAGGACTCAGAATGGTGGG - Intronic