ID: 954216671

View in Genome Browser
Species Human (GRCh38)
Location 3:49128631-49128653
Sequence TCAGCCCCAGATTAGATAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954216667_954216671 -8 Left 954216667 3:49128616-49128638 CCCACACCCAGAGGTTCAGCCCC 0: 1
1: 0
2: 2
3: 35
4: 269
Right 954216671 3:49128631-49128653 TCAGCCCCAGATTAGATAACAGG 0: 1
1: 0
2: 0
3: 5
4: 95
954216668_954216671 -9 Left 954216668 3:49128617-49128639 CCACACCCAGAGGTTCAGCCCCA 0: 1
1: 0
2: 2
3: 33
4: 351
Right 954216671 3:49128631-49128653 TCAGCCCCAGATTAGATAACAGG 0: 1
1: 0
2: 0
3: 5
4: 95
954216664_954216671 23 Left 954216664 3:49128585-49128607 CCTGGGAAAACGGGATGATGGAG 0: 1
1: 0
2: 1
3: 8
4: 138
Right 954216671 3:49128631-49128653 TCAGCCCCAGATTAGATAACAGG 0: 1
1: 0
2: 0
3: 5
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954216671 Original CRISPR TCAGCCCCAGATTAGATAAC AGG Intronic
908672057 1:66558987-66559009 TCATCCCCAGATGAAATAAAGGG - Intronic
909273434 1:73654158-73654180 GCAACCTCAGAATAGATAACTGG - Intergenic
913082177 1:115398930-115398952 TAAACCCTAGTTTAGATAACTGG - Intergenic
913495067 1:119420922-119420944 TCACCCCCACTTTATATAACTGG + Intronic
917625034 1:176837031-176837053 ACATCGCCAGATTATATAACAGG + Intronic
918258015 1:182767722-182767744 TTATCCCCAGATAAGAAAACAGG - Intergenic
919532486 1:198741274-198741296 TCAGCCCCAGATTAGAGCTCAGG - Intronic
923708636 1:236367183-236367205 TCAAGCCAAGATGAGATAACAGG - Intronic
924256455 1:242188070-242188092 TCAGTCCCAGAGTAGAGCACTGG + Intronic
1067358986 10:45559477-45559499 TCAGCCTCAGCTGAGATTACGGG + Intronic
1067667042 10:48287751-48287773 TCTGCCCCAGATTTGAAACCTGG - Intergenic
1067992799 10:51234488-51234510 TCAGCCTTAGATTTGATAGCTGG + Intronic
1070833263 10:79432925-79432947 TGAGGCCCAGAGTAGTTAACTGG - Intronic
1080418933 11:32093310-32093332 CAGGCCCCAGTTTAGATAACTGG + Intronic
1080650506 11:34219085-34219107 TCCCCTCCAGATTAGAAAACTGG - Intronic
1081881164 11:46453829-46453851 TCAGCATCAGATTAAATGACTGG - Intronic
1089313793 11:117577071-117577093 GGAGCCCCACATTAGGTAACAGG + Intronic
1098932392 12:76434593-76434615 TTAGCCCCATATTAGATACATGG - Intronic
1100504292 12:95204668-95204690 TCAGCCCCAGCTTGCATCACAGG + Intronic
1101618535 12:106361346-106361368 TCAATCCCAAATTAGATACCCGG - Intronic
1102885133 12:116516246-116516268 TCAGCTCCAAATTAGATACCTGG - Intergenic
1104287660 12:127439778-127439800 CCATCCCCAGATTCAATAACTGG + Intergenic
1105969367 13:25414070-25414092 TCACTCCCAGATTAGGAAACCGG + Intronic
1110745029 13:79042533-79042555 TCAGGCCCAGATTTTAAAACCGG - Intergenic
1118607537 14:67514868-67514890 CCAGCCGCAGATTAGATAGGTGG - Intronic
1120628702 14:86861606-86861628 TCAGCCCTAAATTCAATAACAGG - Intergenic
1124378271 15:29142276-29142298 ACAGCCCCAAATGAGATGACTGG + Intronic
1126667968 15:51092359-51092381 TCAGATACAGGTTAGATAACAGG - Intronic
1126869279 15:52970478-52970500 TCAGCCTCAGCTGAGATTACAGG + Intergenic
1129997468 15:80019007-80019029 TCAGGCCCAGATGAGTTCACTGG - Intergenic
1131530717 15:93189625-93189647 TCAGCCCCAGTTCATGTAACTGG - Intergenic
1134061194 16:11200630-11200652 ACAGCCCGAGATTGGATAGCGGG + Intergenic
1134294869 16:12936679-12936701 TCAGCACCAGATGAAGTAACTGG - Intronic
1135794557 16:25428775-25428797 TAAGACCCAGATTTGACAACAGG + Intergenic
1135957217 16:26965954-26965976 GCAGCCCCAGACAAGAGAACAGG + Intergenic
1136673793 16:31880763-31880785 TCACCCACACATTAGAAAACTGG - Intronic
1139955062 16:70689265-70689287 CCAGCCCCAGCTTAGGTATCTGG + Intronic
1146083545 17:29805619-29805641 TGAGCCCCTGCTTAGAAAACAGG + Intronic
1146621571 17:34402455-34402477 TCAGCACCTGATTAGAGACCAGG + Intergenic
1150512734 17:65774198-65774220 TCACCCCCAGACTAGAAAAGAGG + Intronic
1151133020 17:71917763-71917785 TCTGCCCCAGAAAAGAGAACAGG + Intergenic
1152777830 17:82213364-82213386 TCAGACCCTGATTAGGGAACTGG + Intergenic
1157346360 18:46838972-46838994 TCAGCACCCAATGAGATAACCGG + Intronic
1166880350 19:45925822-45925844 ACACCCCCAGTGTAGATAACTGG - Intergenic
1168388625 19:55987567-55987589 TGAGCCCCAGATAAGTTAAATGG + Intronic
930406041 2:50956867-50956889 TCAGCCCCAGTTTACATACACGG + Intronic
931289121 2:60856879-60856901 CCAGGCCCAGGTTAGATAATTGG + Intergenic
933407268 2:81876703-81876725 ATAGCCCCAGATTTGATAGCTGG + Intergenic
936940672 2:117881187-117881209 TTAGCCCCATATTAGATATATGG + Intergenic
936992847 2:118384274-118384296 GCTGCCCCAGGTGAGATAACAGG - Intergenic
942905910 2:181180426-181180448 TGAGCTCCTGATCAGATAACAGG + Intergenic
1169022133 20:2338133-2338155 TCAGTACCAGGTTAGATAATGGG - Intronic
1169031442 20:2411001-2411023 TCAGGCCCAGATTATGTCACTGG + Intronic
1170444186 20:16408073-16408095 TGAGCTCCAGAATAGATATCTGG - Intronic
1172321806 20:34000660-34000682 CCAACCCCAGAATAGAGAACAGG - Intronic
1175492340 20:59387682-59387704 TCAGCCTCAGATGTGACAACAGG - Intergenic
1180619555 22:17152007-17152029 TCACCCCCAGACTAGATGAGTGG + Intronic
1183834929 22:40444459-40444481 TAAACCCCAAATAAGATAACTGG + Intronic
954216671 3:49128631-49128653 TCAGCCCCAGATTAGATAACAGG + Intronic
961070125 3:123916353-123916375 TGAGCCCCAGAGTAAAAAACTGG + Intronic
969732737 4:8966316-8966338 TCAACCCCAGATAAGGTGACTGG + Intergenic
972252240 4:37314382-37314404 TCAGGCCCAGAGTATATAACTGG - Intronic
973924213 4:55720579-55720601 TCAGCTCCAGGTAAGATAAATGG - Intergenic
974403215 4:61430733-61430755 TCAACCCCATATTATATAAGGGG - Intronic
976140117 4:81982691-81982713 TCAGGCCCACACTACATAACAGG + Intronic
984973936 4:185213637-185213659 TCAGACCCAGGTGAGTTAACTGG - Intronic
985654419 5:1122397-1122419 TCAACACCAGCTCAGATAACTGG + Intergenic
986280465 5:6318010-6318032 TCTGCACCAGATTTGATAACTGG + Intergenic
988503401 5:31801611-31801633 CCAGCTCCAGAACAGATAACTGG + Intronic
990903022 5:60773593-60773615 TCAGCTCCAGACTAGATCCCAGG + Intronic
995366850 5:111371540-111371562 TCAGCCCCATGTTAAATAATTGG - Intronic
997052380 5:130398342-130398364 TCAGCCCCAGCTCAGCTAAAAGG + Intergenic
997939065 5:138140063-138140085 GCAGCTCCAGGTTAGAAAACAGG + Exonic
998142748 5:139709399-139709421 TTAGCCGCAGATCAGATAAGCGG - Intergenic
1003134885 6:3427469-3427491 TCAGCACCAGATTAGAAAGTGGG + Intronic
1004070330 6:12291708-12291730 TCAGCCCCACCTTAGGTCACTGG + Intronic
1008604944 6:53131265-53131287 TCACCCCCAGTTTACAGAACAGG + Intronic
1012421565 6:99071339-99071361 CAAGCCCCAGATTAGAGCACAGG + Intergenic
1014592183 6:123287337-123287359 TAAGCCCAAGAGTAGATTACTGG + Intronic
1017551520 6:155514385-155514407 TCAGGCCCAGATTGGTTCACAGG - Intergenic
1019087591 6:169494738-169494760 TCAGCATCAGATTGGAAAACTGG + Intronic
1019958474 7:4436242-4436264 TCAGCACCTGATTAGAAAATGGG - Intergenic
1022733027 7:33049293-33049315 TCATCCCCATTCTAGATAACTGG + Intronic
1029885338 7:103863887-103863909 TGAGCACCAGATTAGGTAGCAGG + Intronic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1034999267 7:155598854-155598876 TCAGCCCCATATTCTAAAACTGG + Intergenic
1035790618 8:2301086-2301108 CCAGCCCCAGATAAGTTTACAGG + Intergenic
1035802187 8:2420619-2420641 CCAGCCCCAGATAAGTTTACAGG - Intergenic
1038649363 8:29388505-29388527 TCAGCCCCTGGCTAGATACCTGG - Intergenic
1039092335 8:33845390-33845412 TCAGGCTCAGCTGAGATAACGGG - Intergenic
1041879084 8:62726733-62726755 TCAGGCCCAGATGAGTTCACAGG + Intronic
1046911533 8:119632943-119632965 TCAGCCCTAGCTGAGATTACAGG - Intronic
1049148891 8:141021712-141021734 TGAGGCCCAGATTGGGTAACTGG + Intergenic
1051988452 9:23120678-23120700 TGTGCCCCAGTTTGGATAACTGG + Intergenic
1058475535 9:105328977-105328999 CCCACCCCAGATTAGATGACTGG + Intronic
1058702741 9:107614323-107614345 CCAGACACAGATTAGAAAACTGG + Intergenic
1059289241 9:113207744-113207766 TCACCCCCAGACTAGATCATAGG - Intronic
1059537177 9:115091904-115091926 TGAGCCTCAGTTTAGACAACTGG - Intronic
1060285981 9:122252940-122252962 TCACCCCCACATCAGATGACAGG - Intronic
1198560664 X:137846817-137846839 TCTGCACCAGATTGGATATCAGG + Intergenic
1198656438 X:138918546-138918568 TCATCCCCACATTTGATAAAGGG + Intronic