ID: 954217897

View in Genome Browser
Species Human (GRCh38)
Location 3:49134481-49134503
Sequence CAAAATAAATAGATGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1122
Summary {0: 1, 1: 0, 2: 9, 3: 138, 4: 974}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954217897 Original CRISPR CAAAATAAATAGATGGGGCC TGG (reversed) Intergenic
900129195 1:1080449-1080471 CAGAATTGAGAGATGGGGCCTGG + Intergenic
900211521 1:1458573-1458595 CAAAAAAGTTAGCTGGGGCCTGG - Intronic
900999442 1:6141318-6141340 AATAATAATTAGTTGGGGCCAGG + Intronic
901495099 1:9616420-9616442 CAAGAAAATTAGCTGGGGCCGGG + Intergenic
901608845 1:10480688-10480710 CAAAATAAAAAGTTGAGGCCAGG - Intronic
901695995 1:11008658-11008680 ATAAATAAATAAATAGGGCCGGG + Intergenic
901697377 1:11018482-11018504 TAAAAAAGAGAGATGGGGCCAGG - Intronic
902142028 1:14365036-14365058 AAAAAAAAAGAGAGGGGGCCGGG - Intergenic
902293248 1:15448639-15448661 CAAAAAAATTAGCTGGGGCCGGG - Intronic
902324646 1:15691795-15691817 CAAAAAAATTAGCTGGGGGCGGG + Intronic
902543278 1:17169530-17169552 AAAAATCAATAAATGAGGCCGGG - Intergenic
902661070 1:17904273-17904295 CTAAATAAACAAAAGGGGCCTGG + Intergenic
902868822 1:19299901-19299923 AAAAATAAATAAGTGAGGCCAGG - Intergenic
902882684 1:19383148-19383170 CAAAAAAATTAGCTGGGGCTGGG + Intronic
903428260 1:23270924-23270946 CAAAAAAAAAAGGGGGGGCCGGG - Intergenic
903455989 1:23487133-23487155 AAAAAAAAAAAGAGGGGGCCGGG - Intergenic
903876747 1:26479929-26479951 ATAAATAAATAAATGAGGCCAGG - Intergenic
904175518 1:28625834-28625856 AAAAAAAATTAGCTGGGGCCAGG - Intronic
904193313 1:28764566-28764588 AAAAATAAAAAATTGGGGCCGGG - Intronic
904229261 1:29053852-29053874 AAAAAATAATAGTTGGGGCCGGG - Intronic
904230570 1:29067200-29067222 CAAAAAAATTAGCCGGGGCCAGG + Intronic
904324247 1:29717520-29717542 CAAAATAAAGGGATGGGCTCTGG + Intergenic
904612647 1:31733831-31733853 GAAAAAAAGCAGATGGGGCCTGG + Intronic
904634572 1:31869901-31869923 AAAAAAAAATAGGTGGGGCTGGG + Intergenic
904691269 1:32294807-32294829 AAAAAAAAAAAGTTGGGGCCGGG - Intronic
904735665 1:32630713-32630735 CTAAAAAAATAAATGAGGCCGGG + Intronic
904737217 1:32643788-32643810 AAAAAAAATTAGCTGGGGCCAGG - Intronic
904752694 1:32750799-32750821 ATAAATAAATAAAAGGGGCCGGG - Intronic
905217586 1:36420269-36420291 TCAAAAAAAGAGATGGGGCCGGG - Intronic
905219687 1:36436403-36436425 CTAAAAAAATAGAGAGGGCCGGG - Intronic
905383534 1:37581956-37581978 TAAAAAAAAAAGATGTGGCCGGG - Intronic
905577958 1:39061072-39061094 TAAAATAAAAAAATAGGGCCAGG + Intergenic
905643088 1:39605598-39605620 CATAATAAATAAATGGGTCCTGG - Intergenic
905723110 1:40224567-40224589 AAAAAAAAAAAGATGTGGCCAGG - Intronic
905816806 1:40957665-40957687 AAAAATGAAAAAATGGGGCCGGG + Intergenic
906010544 1:42520623-42520645 AAAAAAAAAAAGATGAGGCCGGG - Intronic
906289990 1:44613592-44613614 AAAAATAAATAAATAAGGCCAGG + Intronic
906993381 1:50763100-50763122 CAAAAAAATTAGCTGGGGCATGG + Intronic
907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG + Intronic
907045388 1:51297206-51297228 AAAAAAAAAAAGATGGGACCGGG - Intronic
907149467 1:52269936-52269958 CCAAATAAACAGTTGTGGCCAGG - Intronic
907181469 1:52574000-52574022 TAAAATAAAAATATTGGGCCGGG + Intergenic
907210042 1:52812980-52813002 CAAAACAAATAAATAGGGCTGGG - Intronic
907213107 1:52839957-52839979 AAAAATAAAAAAATAGGGCCGGG - Intergenic
907365816 1:53958879-53958901 AGAAATAAATAAATAGGGCCAGG - Intronic
908501554 1:64747808-64747830 TAAAATAAAGAAATGAGGCCAGG - Intronic
908883022 1:68754653-68754675 AAAGATTAAAAGATGGGGCCGGG + Intergenic
909475797 1:76079636-76079658 CAAGATAAATATATGAGGACAGG - Intronic
910212419 1:84807024-84807046 AAAAATAAAATGCTGGGGCCGGG - Intergenic
910696365 1:90021942-90021964 GAAAATTAATAGTTGGGGGCTGG + Intronic
911113421 1:94217236-94217258 TAAAATTAAATGATGGGGCCGGG + Intronic
912362742 1:109108436-109108458 AAATAAAACTAGATGGGGCCGGG - Intronic
913168705 1:116212699-116212721 AAAAAAAAAAAGATGGGGCAAGG + Intergenic
913296505 1:117326358-117326380 AAAAATAAAAATAAGGGGCCAGG + Intergenic
913553412 1:119938973-119938995 GAAAATAAATGAATGGGGCCGGG - Intronic
913667030 1:121058032-121058054 CAAAAGAAAGAGAAAGGGCCGGG + Intergenic
913977813 1:143478181-143478203 CACAACAGATAGATGGGGTCAGG + Intergenic
914072217 1:144303810-144303832 CACAACAGATAGATGGGGTCAGG + Intergenic
914106938 1:144662546-144662568 CACAACAGATAGATGGGGTCAGG - Intergenic
914294134 1:146303778-146303800 ATAAATAAATAGATCGGGCGTGG - Intergenic
914555178 1:148754561-148754583 ATAAATAAATAGATCGGGCGTGG - Intergenic
914685007 1:149970612-149970634 CTAAATAAATACATAAGGCCAGG - Intronic
914721445 1:150292514-150292536 ATAAATAAATAAATAGGGCCAGG - Intergenic
914746803 1:150507272-150507294 AAAAAAAAATAAATTGGGCCAGG + Exonic
915104481 1:153524869-153524891 AAAAATAAATGAATCGGGCCAGG + Intergenic
915154264 1:153861393-153861415 TAAAATAAATAGAGATGGCCCGG - Intronic
915175080 1:154007867-154007889 AAAAATAAATAAATAAGGCCGGG - Intronic
915175957 1:154015211-154015233 CAAAATAAATATGTGGGGCATGG - Intronic
915502747 1:156330691-156330713 AAAAATAAATAAATAAGGCCAGG + Intronic
915562983 1:156698372-156698394 CAAAAGAAACAGATGAGGCCGGG + Intergenic
916624860 1:166544429-166544451 CACAATAAAGAGCTGGGGACTGG - Intergenic
916628983 1:166591665-166591687 CATTCTAAATAGATGGGGCGGGG - Intergenic
916737306 1:167619363-167619385 TAAAGAAAGTAGATGGGGCCGGG + Intergenic
916811558 1:168309999-168310021 CAAAATTAAAAGATGAGGCTTGG + Intronic
917088031 1:171323213-171323235 GAAGATGAATAGATGGGGGCTGG + Intronic
917265478 1:173216451-173216473 CAAGCTAACTAAATGGGGCCAGG + Intergenic
917558521 1:176118465-176118487 CAAAATAGCTAGAAGAGGCCAGG + Intronic
917573330 1:176293587-176293609 AAAAATAAATCAATGGGACCTGG + Intergenic
918217182 1:182402095-182402117 ATAAATAAATAAATGGGGCCAGG - Intergenic
918307511 1:183260520-183260542 AAAAGTAAATGGCTGGGGCCGGG + Intronic
918445610 1:184614014-184614036 AAAAATAAAGAGATGGGAGCAGG + Intronic
918916506 1:190646844-190646866 AAAAAATAATAGTTGGGGCCGGG - Intergenic
919132326 1:193466805-193466827 TAAAATTAATAGAGGTGGCCGGG - Intergenic
919719441 1:200816295-200816317 AAAAATATATATATAGGGCCAGG + Intronic
919890010 1:201964941-201964963 ATAAATAAATAAATAGGGCCGGG - Intronic
920012239 1:202877111-202877133 GAAAACAAATTCATGGGGCCAGG - Intergenic
920118017 1:203634957-203634979 ATAAATAAATAAATGGGGCCGGG - Intronic
920580741 1:207105260-207105282 AAAAATAAAGAGATTTGGCCAGG + Intronic
920583512 1:207135643-207135665 TAAAATAAATGCATGGGTCCAGG - Intronic
921224838 1:213008157-213008179 CATAAGAAAAAGTTGGGGCCGGG - Intronic
921402513 1:214741505-214741527 CAAAAAAATTAGCTGGGACCAGG - Intergenic
921464734 1:215473927-215473949 CAAAATAAATAGAATTGACCTGG - Intergenic
922442313 1:225666037-225666059 AAAAATAAATAAATAGGGTCGGG - Intergenic
923627723 1:235627883-235627905 TAAAATACAGATATGGGGCCGGG + Intronic
923999053 1:239530196-239530218 CAAAAAAAATAATTTGGGCCGGG - Intronic
924096959 1:240562242-240562264 CAATATAAACAGATGGCCCCAGG + Intronic
924097139 1:240564208-240564230 AAAAATAAATAAATAGGGCTGGG + Intronic
924150734 1:241126442-241126464 CAAAAAATATAAATGGGGCCAGG - Intronic
924246649 1:242092121-242092143 AAAAATAAATAAATCAGGCCCGG - Intronic
924269912 1:242321598-242321620 CAAAAAGAATAGATGGGGCCGGG - Intronic
924282790 1:242454887-242454909 GAAAAGAAATAGATGGTCCCAGG - Intronic
924287067 1:242498256-242498278 AAAAATAAATTGAAGAGGCCAGG - Intronic
924366887 1:243303775-243303797 CAAAAGTTATACATGGGGCCAGG + Intronic
924463389 1:244279467-244279489 TAAAAAAAATAGCTGGGGCTGGG + Intergenic
924621085 1:245661281-245661303 CAAAATAATTAAAATGGGCCAGG - Intronic
924694430 1:246383664-246383686 CAAAATATCAAGATGGGGTCAGG + Intronic
1062892029 10:1069908-1069930 CAAAATACAAAGTTGAGGCCAGG + Intronic
1063093956 10:2892804-2892826 AAAAATAAATAAATATGGCCGGG + Intergenic
1063380122 10:5579199-5579221 CAAAAAAAAAAAAGGGGGCCAGG + Intergenic
1063393930 10:5669067-5669089 CAAAATAAATAGCTTGGGTGAGG + Intergenic
1064094749 10:12415593-12415615 AAATATAAATACAGGGGGCCAGG - Intronic
1064136718 10:12757266-12757288 TAAAATGAATAAATGAGGCCGGG - Intronic
1064149820 10:12853346-12853368 CAAAAAAAAAAGTTGTGGCCAGG - Intergenic
1064152598 10:12877227-12877249 AAAAATAAATAAATATGGCCAGG - Intergenic
1064427799 10:15245360-15245382 CAAAGTCAACAGATTGGGCCGGG - Intronic
1064646161 10:17461872-17461894 ATAAACAAATAGATGTGGCCAGG - Intergenic
1064989630 10:21244712-21244734 AAAAATAAATAAATTAGGCCAGG + Intergenic
1065086056 10:22178196-22178218 AAGAAGAAATAGCTGGGGCCAGG + Intergenic
1065513821 10:26505638-26505660 CAAAATCATTAGCTGAGGCCAGG - Intronic
1065601387 10:27372645-27372667 TAAAATAAATAGCTTGTGCCAGG + Intergenic
1065957697 10:30707501-30707523 CAAAAAAAATAAATAGGGCCGGG - Intergenic
1066532845 10:36358993-36359015 AAAAATAAATCAGTGGGGCCAGG - Intergenic
1066674788 10:37876619-37876641 AAAATTGAAAAGATGGGGCCGGG - Intergenic
1066715001 10:38277168-38277190 CAAAAACAATAGATGGGGCTGGG + Intergenic
1066718520 10:38312751-38312773 CAAAATAAGTAGAAGGGGGTCGG - Intergenic
1066783079 10:38973532-38973554 CAAAAACAATAGATGGGGCTGGG - Intergenic
1067003818 10:42642170-42642192 AAAAATGAATAGCTGTGGCCAGG - Intergenic
1068784775 10:60959743-60959765 AAAAATAACTAGATGGGACTTGG + Intronic
1069088616 10:64172400-64172422 TAAAATACATAAATGGCGCCAGG + Intergenic
1069169250 10:65204585-65204607 AGAAATAGATAGATAGGGCCGGG + Intergenic
1069262207 10:66412752-66412774 AAAAATTAATATTTGGGGCCAGG - Intronic
1069477420 10:68746871-68746893 TAAAAAAAGTAGATGGGGCTGGG - Intronic
1069815207 10:71189419-71189441 AAAAATAGGTATATGGGGCCAGG - Intergenic
1069871664 10:71536767-71536789 CACAATGAAGAGAAGGGGCCAGG + Intronic
1069970317 10:72162464-72162486 AAAAATAAAAAAATTGGGCCAGG - Intronic
1070315017 10:75301534-75301556 CAAAACAAATAGAAATGGCCGGG - Intergenic
1070384149 10:75908831-75908853 CAAACAAAATAGAAGGAGCCTGG + Intronic
1070467526 10:76738642-76738664 CAAACTACAGAGAAGGGGCCTGG - Intergenic
1070610822 10:77931248-77931270 AAAAATAAATAAATAGGGCGGGG - Intergenic
1070994786 10:80768147-80768169 CCAAAAAAATAGGTGGGGCTAGG - Intergenic
1071155446 10:82683248-82683270 CAAAATTAAAACATGAGGCCGGG - Intronic
1071246019 10:83764673-83764695 CAAAATAAATAAATAAAGCCAGG + Intergenic
1072140811 10:92587708-92587730 CAAACAAATTAGCTGGGGCCGGG - Intergenic
1072768690 10:98117708-98117730 GAAAATAAATACATAAGGCCGGG - Intergenic
1072895124 10:99359937-99359959 CAAAAAAAAAAGCGGGGGCCGGG + Intronic
1072953007 10:99864698-99864720 TAAAATAAATAGATGATGCTGGG - Intergenic
1072992484 10:100210380-100210402 CAAAATAAATAACTTAGGCCGGG - Intronic
1073113230 10:101075163-101075185 ATAAATAAATAGCTGGGGCTTGG - Intergenic
1073225113 10:101911739-101911761 CATAAAAAAGACATGGGGCCAGG + Intronic
1073764403 10:106666133-106666155 AAAAATACATAGAAGTGGCCGGG - Intronic
1074115385 10:110454086-110454108 CAAAAAAAAAAAACGGGGCCGGG + Intergenic
1074499714 10:114012534-114012556 CAAAAAAGATAGATAAGGCCGGG - Intergenic
1075036602 10:119074636-119074658 AAAAATAGAAAAATGGGGCCGGG + Intronic
1075283953 10:121166828-121166850 CAAAAAGAAAACATGGGGCCAGG + Intergenic
1075790934 10:125084074-125084096 CAAAAAACGTAGCTGGGGCCAGG - Intronic
1076249714 10:128976207-128976229 TCAAAGAAATAGTTGGGGCCAGG + Intergenic
1077098112 11:808431-808453 GAAAAAAAAAAGTTGGGGCCGGG + Intronic
1077243581 11:1524851-1524873 CAAAATAATGAAATGGGACCCGG - Intergenic
1077808770 11:5616244-5616266 AAAAGTAAAAAGATGAGGCCGGG - Intronic
1078235654 11:9482263-9482285 AAAAAAAAAGAGTTGGGGCCGGG - Intronic
1078243692 11:9553302-9553324 AATAATAAATAAATGAGGCCGGG + Intergenic
1078372140 11:10757291-10757313 AAAAAAAAATAGATAGGGTCTGG + Intronic
1078708491 11:13767854-13767876 CAAAACAAATAGATGTGGTTAGG + Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079511177 11:21212205-21212227 CTAAATGAATAAATGGGGACAGG - Intronic
1080530495 11:33170752-33170774 AAAAATAAATAAATTCGGCCGGG + Intergenic
1081822001 11:46007608-46007630 CATAAAAGATAGATGGGGCCGGG - Intronic
1081874445 11:46399067-46399089 AAAAATAAATAAATATGGCCAGG - Intronic
1081903987 11:46654721-46654743 CAAAAAAAACAGTTGAGGCCAGG + Intronic
1081924656 11:46815341-46815363 AAAAATAAATAAATATGGCCAGG - Intronic
1081979260 11:47256329-47256351 AAAAATAAATAGAACGGGCACGG - Intronic
1081983254 11:47283386-47283408 AAAAATAAATAAATAAGGCCGGG - Intronic
1082071900 11:47946088-47946110 CAATATACATATAGGGGGCCAGG - Intergenic
1082089173 11:48075418-48075440 AAAAATAAATAAATAAGGCCAGG - Intronic
1082104780 11:48209848-48209870 CAAAATACATGGCTGGGGCTGGG + Intergenic
1083453004 11:62758876-62758898 GAAAAAAAAAAGGTGGGGCCGGG + Intergenic
1083756630 11:64795375-64795397 AAAAATCAAAAAATGGGGCCAGG - Intronic
1083905870 11:65669922-65669944 AAAAATAAAGAACTGGGGCCGGG + Intergenic
1083908801 11:65692957-65692979 ATCAATAAATAGATGAGGCCGGG + Intergenic
1084015214 11:66374931-66374953 AAAAATAAATAAATAGGGCCAGG - Intergenic
1084102755 11:66960608-66960630 AAAAATTAAAAAATGGGGCCGGG + Intergenic
1085594338 11:77794384-77794406 CCATACAAATACATGGGGCCAGG + Intronic
1086087331 11:82968762-82968784 CAAAATCAATGAATGGGGCAAGG - Intronic
1086105093 11:83138773-83138795 CTAAATAAATGAATGGTGCCAGG + Intergenic
1086301612 11:85432019-85432041 CAAAATAAATGAATAGGGCCTGG + Intronic
1086390272 11:86356452-86356474 CAAAATAATCAGTTGTGGCCAGG - Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1086484467 11:87283561-87283583 GAAAATAAATTAATGGGGCTGGG + Intronic
1086664388 11:89461347-89461369 AAAAATAAATAAATAAGGCCAGG + Intronic
1087401338 11:97669999-97670021 AAACATAAGTAGATGGGGCATGG - Intergenic
1087818850 11:102688890-102688912 CAAAATAAATAAATAAGGCCGGG + Intergenic
1088820511 11:113452636-113452658 AAAAAAAAAAAGATGGGGACTGG - Intronic
1088880026 11:113966014-113966036 GTAAATAAATAAATGGGGCATGG - Intergenic
1089543285 11:119204084-119204106 AAAAATAAAAAAATGAGGCCGGG - Intergenic
1090543849 11:127739730-127739752 CAGCAGAAAAAGATGGGGCCAGG + Intergenic
1091005088 11:131945847-131945869 TAAAATGAATAGATGGCGTCTGG + Intronic
1091462379 12:654227-654249 AAAAGTAAATGGATGGGGTCAGG + Intronic
1091622160 12:2097439-2097461 CAAAAAAATTAAATGTGGCCAGG - Intronic
1091739902 12:2953625-2953647 CAAAAAAAAAAAATGTGGCCAGG - Intergenic
1091901758 12:4149713-4149735 AAAAATAAATATATACGGCCAGG - Intergenic
1092189958 12:6511984-6512006 CAAAAAAAATAGATAGGGCCAGG + Intronic
1092212238 12:6654130-6654152 AAAAATAAATAGATTAGGCCAGG - Intronic
1092876186 12:12850184-12850206 AAATATAAATAGACGTGGCCGGG + Intergenic
1092877629 12:12862331-12862353 CAAAATAAAGTGAGTGGGCCGGG + Intergenic
1094007754 12:25773454-25773476 GGAAATATATAGATGAGGCCAGG - Intergenic
1094354213 12:29560461-29560483 AAAAAGAAATGTATGGGGCCGGG + Intronic
1094544283 12:31390341-31390363 TAAATTAAATAGATTTGGCCAGG + Intronic
1094578538 12:31711167-31711189 TAAAATAAATAAATAGGGCTGGG - Intronic
1094728880 12:33151871-33151893 CAAAACAAAGGGATGGGCCCTGG + Intergenic
1095128557 12:38510284-38510306 CAAAATAAAGGGATGGGGCCAGG + Intergenic
1096046169 12:48564268-48564290 GAAAAGAAATATTTGGGGCCGGG + Intergenic
1096058251 12:48673650-48673672 CAAAATTAAGAGATGAGGCCAGG + Intronic
1096128275 12:49136153-49136175 CAAAACAAATAGACCTGGCCGGG - Intergenic
1096129858 12:49149501-49149523 CAAAAAAAATAAAAAGGGCCGGG - Intergenic
1096305863 12:50474640-50474662 CAAAAGAAACAGAATGGGCCAGG - Intronic
1096623855 12:52881022-52881044 AAAAAAAAATTGCTGGGGCCGGG - Intergenic
1096643698 12:53015680-53015702 CAAAAAAAAAAAATGGGGCCGGG + Intronic
1096701632 12:53387244-53387266 CAAAAGAACTAGAAGTGGCCAGG - Intronic
1097001222 12:55878682-55878704 AAAAGTAAATACATGGGGCCGGG + Intergenic
1097072814 12:56367785-56367807 CAAAAAAAAGACATGGGGCGGGG + Intergenic
1097093317 12:56525015-56525037 AAAAATAAAAATATGGGGCCAGG - Intronic
1097121361 12:56735391-56735413 CAAAAATAAGACATGGGGCCGGG - Intronic
1097164384 12:57075526-57075548 ATAAATAAATAGTTGGGCCCAGG + Intronic
1097204476 12:57308396-57308418 TAAAACCTATAGATGGGGCCAGG + Intronic
1097835858 12:64272207-64272229 TAAAATAAATAAATGCGGCCAGG + Intronic
1098002504 12:65960182-65960204 TAAAAGACATGGATGGGGCCAGG - Intronic
1098320270 12:69237029-69237051 CCAATTAAATATATGTGGCCGGG - Intergenic
1099035476 12:77582102-77582124 CAAAATAAAAAGATGCAACCTGG - Intergenic
1099114342 12:78605774-78605796 CCTAAAAAATAAATGGGGCCAGG + Intergenic
1099129256 12:78805262-78805284 TAAAATACATAGATGGATCCTGG + Intergenic
1100289040 12:93196386-93196408 CAAAATAAAAAGTTGGGGTGGGG - Intergenic
1100431052 12:94532231-94532253 AAAAATAAATAAATAAGGCCAGG + Intergenic
1100936239 12:99670314-99670336 CATAATAAATAGATGGTCCTAGG + Intronic
1100974850 12:100111901-100111923 AAAAATAACTAGCTGGGGCTGGG - Intronic
1101106281 12:101443756-101443778 TAAAATAAATAAATAAGGCCGGG - Intergenic
1101117201 12:101543559-101543581 AAAAAAAAAAAAATGGGGCCAGG - Intergenic
1101122147 12:101593535-101593557 AAAAAGATATATATGGGGCCTGG - Intronic
1101220007 12:102628886-102628908 CAAAATGTATAGAGGAGGCCAGG - Intergenic
1101283605 12:103285948-103285970 AAAAATAAATGAATGAGGCCGGG + Intronic
1101907900 12:108841510-108841532 TAAAAAAAATATATAGGGCCGGG + Intronic
1102080814 12:110096681-110096703 AAAAATAAATAAATAAGGCCGGG - Intergenic
1102167451 12:110818062-110818084 CAAAATAAAAAATTGTGGCCGGG - Intergenic
1102185297 12:110942967-110942989 CAAAATAAAGAGTTGGGGGCAGG + Intergenic
1102213806 12:111145998-111146020 AAAAATAAATAGCCAGGGCCGGG - Intronic
1102322229 12:111946441-111946463 CAAAACAAAGAGATGGGCTCTGG + Intronic
1102325855 12:111983140-111983162 AAAAAAAATTAGCTGGGGCCAGG + Intronic
1102335317 12:112073726-112073748 TTAAATGAATAAATGGGGCCGGG - Intronic
1102439921 12:112954589-112954611 CAAAAACAAGAAATGGGGCCAGG - Intronic
1102499049 12:113338643-113338665 GAAGAAAGATAGATGGGGCCTGG + Intronic
1102693084 12:114776874-114776896 AAAAATAAATAAATAAGGCCGGG + Intergenic
1103111655 12:118285336-118285358 TAAAATAAATAGATTAGGCCTGG - Intronic
1103638507 12:122329331-122329353 AAAAATAAATAAAGGAGGCCAGG + Intronic
1103759395 12:123237159-123237181 AAAAAAAAATAAACGGGGCCAGG + Intronic
1104184101 12:126411691-126411713 CAAAATAAAGTGATGGGGAAAGG + Intergenic
1104358953 12:128114093-128114115 CAAAATAGTTAGAAGAGGCCGGG - Intergenic
1104445768 12:128832127-128832149 AAAAAAAAAAAGGTGGGGCCGGG + Intergenic
1105015008 12:132781264-132781286 CAAAAAAAAAAGAATGGGCCGGG + Intronic
1105031063 12:132884121-132884143 AAAAATAAATATATCAGGCCGGG + Intronic
1105066728 12:133207511-133207533 AAAAAGAGATATATGGGGCCAGG + Intergenic
1105387492 13:19944964-19944986 CAAAATAAAAAATAGGGGCCGGG - Intergenic
1105588189 13:21764092-21764114 CAAAAAAATTAGCCGGGGCCGGG - Intergenic
1105814333 13:24020746-24020768 AAAAATAAATAATTTGGGCCGGG + Intronic
1106630018 13:31461579-31461601 TAATAAAAAAAGATGGGGCCGGG - Intergenic
1107015343 13:35704435-35704457 ATAAATAAATAAATGGGGGCAGG - Intergenic
1107283469 13:38762729-38762751 AAATATAAATAGATTGGGGCCGG - Intronic
1107489575 13:40868432-40868454 CAAAATAAATGGATGGAGGAAGG - Intergenic
1107852617 13:44586475-44586497 AAAAATAAGTAGAGGGGGCCAGG + Intergenic
1107859024 13:44643160-44643182 AAAAACAAAAAGATGAGGCCAGG - Intergenic
1107870160 13:44739024-44739046 AGAAATAAATACATGGGGCAGGG - Intergenic
1108008977 13:45983720-45983742 AAATATAAGTAGAAGGGGCCGGG - Intronic
1108338118 13:49467100-49467122 GAAAATAAATATACTGGGCCAGG + Intronic
1108381640 13:49860317-49860339 TAAAAGAAATAGATGGGGCTTGG + Intergenic
1108403896 13:50081266-50081288 CAATATAGATAGATGGGTGCCGG + Intergenic
1108410157 13:50137699-50137721 TAAAATGAAGAGTTGGGGCCAGG - Intronic
1108678301 13:52757477-52757499 AAAAATACCTAGATAGGGCCAGG + Intergenic
1109191400 13:59328173-59328195 AGAAAGTAATAGATGGGGCCGGG + Intergenic
1109297816 13:60556139-60556161 TAAAAGAAATAGGTTGGGCCGGG - Intronic
1110135312 13:72061042-72061064 CAAAAGACATAGATTGGGCCAGG + Intergenic
1110234396 13:73201291-73201313 CACAATAAATATATGGGACAAGG + Intergenic
1111092755 13:83468336-83468358 CAAAATAAATATATGGAGACAGG + Intergenic
1111369259 13:87294981-87295003 TAAAATAAATAGATGGGATAAGG + Intergenic
1111977812 13:94986036-94986058 AAAAATAAAAAGATAGGGCTGGG + Intergenic
1112546640 13:100377473-100377495 TAAAATAAAAAGATGGAGGCTGG - Intronic
1113471820 13:110552396-110552418 AAAAATAAATAAATAGGGCCAGG + Intronic
1114305731 14:21421054-21421076 AAAAATACATATATGAGGCCAGG - Intronic
1114622547 14:24105148-24105170 CAAAATGAAGAGATGGGCTCTGG + Intronic
1114633443 14:24173830-24173852 AAAAAGAAATAAATGGGGCATGG - Intronic
1114689656 14:24568830-24568852 TAAAAGATATAGATTGGGCCGGG + Intergenic
1115044363 14:28972474-28972496 AAAAATTAATAGATGAGGCCGGG - Intergenic
1115213600 14:30992581-30992603 AAAAAAAAAAAGATGGGGTCGGG + Intronic
1115221452 14:31062392-31062414 AAAAATAAATAGACCTGGCCGGG - Intronic
1115987051 14:39112819-39112841 CAAAATAAAAAAATCAGGCCGGG + Intergenic
1116238770 14:42313916-42313938 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1116381857 14:44278773-44278795 CAAAATAAGTAAATGGAGGCTGG - Intergenic
1116852124 14:49919128-49919150 TAAAATACAAATATGGGGCCGGG + Intergenic
1116857926 14:49969902-49969924 AAAAATAAATATTTGAGGCCGGG - Intergenic
1116918982 14:50552997-50553019 AAAAATAAATAAATGGGGCCAGG + Intronic
1117569294 14:57030305-57030327 CAAAATAAATAATCTGGGCCAGG - Intergenic
1117631173 14:57693533-57693555 CAAAATAAAGGGATGGGCTCTGG - Intronic
1117723485 14:58649349-58649371 AAAAATAAATAGGTCGGGCGCGG - Intergenic
1117871067 14:60200627-60200649 AAAAATAAATAAATGGTGCTGGG + Intergenic
1118040296 14:61909093-61909115 TAAAATGAATTGATGGGGCCAGG - Intergenic
1118290711 14:64519466-64519488 AAAAAAAAATAGAAGAGGCCAGG + Intronic
1118432790 14:65738292-65738314 CAAAATAGATAGATAGGGGCAGG - Intronic
1118834089 14:69463783-69463805 AAAAAAAATTAGCTGGGGCCAGG + Intergenic
1119057831 14:71441309-71441331 CAAAATATTTAGATGGGATCTGG + Intronic
1119255032 14:73188356-73188378 CTTAATAAATAGACGGGGTCGGG + Intronic
1119839502 14:77781448-77781470 AAAAATAATTAGGTGCGGCCGGG + Intergenic
1119956182 14:78801024-78801046 CTAAAGAAATACATGAGGCCGGG + Intronic
1120593434 14:86404210-86404232 AAAAATAAATAAATATGGCCGGG - Intergenic
1120886578 14:89456456-89456478 TAAAATAAATAAATGAGGCCGGG + Intronic
1121048354 14:90804038-90804060 CAAAAGAAAGAGCTGTGGCCGGG + Intronic
1121288769 14:92757505-92757527 CAAAATCAACAGATTGGGCAGGG - Intergenic
1121380315 14:93459963-93459985 AAAAATAAATATATAGGGCCGGG - Intronic
1121555000 14:94829779-94829801 AAAAAAAAAAAAATGGGGCCAGG - Intergenic
1122058942 14:99123805-99123827 GAATATAAAAAGATGGGTCCGGG - Intergenic
1122563893 14:102637421-102637443 TAAAATATATATATGCGGCCAGG - Intronic
1122702922 14:103602317-103602339 CAAAATAAATAAAAGTGGCCGGG + Intronic
1122739682 14:103864854-103864876 CAAAAAAAAAAAAGGGGGCCGGG - Intergenic
1122767814 14:104084007-104084029 CAAAATAATTATATGGGGCTGGG + Intergenic
1122887529 14:104716986-104717008 CTAAATAAAAAGGTGGGGGCTGG - Intronic
1123032297 14:105457628-105457650 CAAAATAAAAAGCTTGGGCCGGG + Intronic
1123679853 15:22754817-22754839 AAAAATATATAAATGTGGCCGGG + Intergenic
1123813852 15:23956178-23956200 AAAAATAAAAAGTTTGGGCCGGG - Intergenic
1123930260 15:25166067-25166089 CATAATCAATAGATGGGGCTTGG - Intergenic
1124332069 15:28829296-28829318 AAAAATATATAAATGTGGCCGGG + Intergenic
1124456993 15:29852612-29852634 CAAAATAAAAACTTAGGGCCGGG + Intronic
1124649878 15:31466614-31466636 CAAAAAAATTAGCCGGGGCCAGG - Intergenic
1124931935 15:34128607-34128629 CAAGAAAGATAAATGGGGCCGGG - Intergenic
1125063764 15:35457248-35457270 AAAATAAAATAAATGGGGCCAGG - Intronic
1125564451 15:40665460-40665482 AGAAACAAATATATGGGGCCAGG - Intergenic
1125643072 15:41247675-41247697 ATAAATAAATAAATAGGGCCGGG + Intronic
1125704901 15:41725536-41725558 AAAAATAAATAAGTAGGGCCGGG + Intronic
1127086560 15:55429222-55429244 AAAAATAAATAAATAAGGCCGGG + Intronic
1128013431 15:64320381-64320403 CCATATAAAAATATGGGGCCGGG + Intronic
1128482049 15:68047542-68047564 CAAAATTAGAAGGTGGGGCCGGG + Intergenic
1128488125 15:68117379-68117401 CAAAATAGCAAGAAGGGGCCAGG - Intronic
1128920994 15:71609983-71610005 CAAATTAAATACAGGCGGCCTGG + Intronic
1129634061 15:77296314-77296336 AAAAATAAATAAATGGGACCAGG + Intronic
1129784515 15:78300297-78300319 AAAAAAAAAGAGATGGGGCTGGG + Intergenic
1130037528 15:80375236-80375258 AAAAATAAATATTTAGGGCCGGG - Exonic
1130308707 15:82734155-82734177 CAAATAAATTAGCTGGGGCCAGG + Intergenic
1130410497 15:83644075-83644097 CCAAATTCATATATGGGGCCAGG - Intergenic
1130438442 15:83926086-83926108 TAAAATAAATTGGTGGGGCAGGG + Intronic
1130690718 15:86079551-86079573 CAAAATAAAGAGGTGGGGTGGGG + Intergenic
1130699371 15:86163429-86163451 AAAAATAAATAAATGAGGGCTGG + Intronic
1130930649 15:88424634-88424656 AAAAGTTAATAGAAGGGGCCAGG + Intergenic
1131320593 15:91386352-91386374 GAAAATAAGAAGATGGGGTCCGG + Intergenic
1131435471 15:92418304-92418326 CAAAAAAAAAATATGGGGCATGG + Intronic
1131741325 15:95395945-95395967 CAAAATATAACAATGGGGCCAGG - Intergenic
1131964040 15:97819597-97819619 CAAAAGAAATACCTGGGGCAGGG + Intergenic
1132015738 15:98314868-98314890 AAAAAAAAAAAAATGGGGCCAGG + Intergenic
1132094512 15:98972055-98972077 AAAAATAAATAGCATGGGCCAGG + Intronic
1132195427 15:99911053-99911075 CAAAATGAATACATGTTGCCGGG - Intergenic
1132401918 15:101515048-101515070 GAAAATCAATTGATGTGGCCAGG - Intronic
1132482026 16:171517-171539 AAAAATAAATACATAAGGCCGGG - Intergenic
1132491932 16:236614-236636 CAAAATAAATAGGCCGGGCGCGG + Intronic
1132531621 16:453372-453394 CATCAGAAATAGATGTGGCCAGG - Intronic
1132908172 16:2294685-2294707 TAAAATAAACAAATGTGGCCAGG + Intronic
1133249416 16:4470650-4470672 AAAAATAAAAAAATGAGGCCGGG + Intronic
1133636622 16:7672565-7672587 AAAAATAGATGGATGTGGCCAGG + Intronic
1133811586 16:9165013-9165035 AAAAAAAAAAAGATGGGGCGTGG + Intergenic
1133857435 16:9562825-9562847 CAAACGAAATAGAAGTGGCCTGG - Intergenic
1134087641 16:11369224-11369246 TAAAATATAGAGATGGGGCCGGG - Intronic
1134112159 16:11522383-11522405 CACTATTAATAGTTGGGGCCAGG + Intronic
1134130250 16:11644472-11644494 CAATATAAAGAAATGAGGCCGGG + Intergenic
1134556211 16:15167596-15167618 AAAAATAAATAAATAAGGCCGGG + Intergenic
1134916799 16:18079331-18079353 AAAAATAAATAAATAAGGCCGGG + Intergenic
1135143223 16:19939501-19939523 ATAAATAAATAAATAGGGCCAGG - Intergenic
1135566835 16:23517522-23517544 GAAAAAAATTAGCTGGGGCCGGG - Intronic
1135690433 16:24533026-24533048 CTAAAAAAAAAAATGGGGCCAGG + Intergenic
1135925114 16:26687251-26687273 TAAAATAAGAAGATGAGGCCTGG - Intergenic
1136127936 16:28198846-28198868 TAAAATAAATAAATCTGGCCAGG + Intronic
1136131634 16:28225642-28225664 AAAAATAAATAAATAAGGCCAGG + Intergenic
1136243321 16:28958152-28958174 AAAAATAAGAAGATGTGGCCAGG + Intronic
1136340350 16:29638976-29638998 AAAAATAAATAAATAAGGCCGGG + Intergenic
1136605909 16:31333602-31333624 TAAAATAAAGAGATGGCTCCAGG + Intergenic
1136659126 16:31739944-31739966 CAAAATAAAGGGATGGGCTCTGG - Intronic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137627378 16:49918000-49918022 CAAAAGAAGTAGATTAGGCCTGG - Intergenic
1138120387 16:54396570-54396592 AAAAATACATATATGGGGCCGGG - Intergenic
1138251345 16:55504157-55504179 CAAAAAAAAAGAATGGGGCCTGG + Intronic
1138486432 16:57347814-57347836 CAAAAAAATTAGCTGGGGCATGG + Intergenic
1138568822 16:57854330-57854352 AAAAGTATAAAGATGGGGCCAGG + Intronic
1138725110 16:59128156-59128178 AAAAAAAAATAGCTGGGCCCTGG - Intergenic
1139236381 16:65343799-65343821 TAAAAGAAGTAGATGAGGCCAGG + Intergenic
1139256336 16:65546533-65546555 CAGAATTAAGAGATGGGGGCAGG - Intergenic
1139523642 16:67499733-67499755 CAAGAAAAAAAGAAGGGGCCAGG + Intergenic
1139592457 16:67941006-67941028 AAAAATAAATAAATAGGGCCGGG + Intronic
1139682711 16:68577994-68578016 CAAAAGGAATAGATTGGGCCAGG + Intergenic
1139707539 16:68751796-68751818 AAAAATAAATAAATTGGGCCAGG - Intronic
1139723694 16:68878390-68878412 CAAAATAAAAAGTTGGGGGGAGG - Intronic
1139835194 16:69832836-69832858 AAAAATAAAAAGGTTGGGCCAGG - Intronic
1140169996 16:72594797-72594819 TAAAATATATATATAGGGCCAGG + Intergenic
1140300780 16:73755423-73755445 ATCAATAAGTAGATGGGGCCTGG + Intergenic
1140307021 16:73812511-73812533 CATAATAAAGAGATGGGGCAGGG + Intergenic
1140409633 16:74734087-74734109 CATAAGAAGTAAATGGGGCCCGG - Intronic
1141105142 16:81227261-81227283 AAAAAAAATTAGCTGGGGCCAGG - Intergenic
1141511121 16:84512829-84512851 TCAAATAAATAAATTGGGCCAGG - Intronic
1142025572 16:87811250-87811272 GAAAATGAATAGATGGGCCCGGG - Intergenic
1142068296 16:88075048-88075070 TAAAAAAATTAGCTGGGGCCGGG + Intronic
1142818371 17:2446485-2446507 CAAAATCAATTGTTGGGGCCAGG + Intronic
1143103618 17:4517360-4517382 CAAAATTAATAGAGCAGGCCAGG + Intronic
1143172348 17:4937648-4937670 GGAAATAAATAGAGGGGTCCAGG + Exonic
1143348117 17:6265354-6265376 AAAAAAAAAAAGATGGGACCAGG + Intergenic
1143363830 17:6392575-6392597 CAAAATCAAGAGACGGGGCTGGG + Intergenic
1143575272 17:7788867-7788889 AAAAATATGTAGATGGGGCTGGG + Intronic
1143656470 17:8296722-8296744 CCAAATACAAAGATGAGGCCAGG + Intergenic
1144075587 17:11716622-11716644 GAAAATAAATACATGGGACTGGG - Intronic
1144224387 17:13130872-13130894 AGAAATAAATAAATAGGGCCAGG + Intergenic
1144343194 17:14327624-14327646 AATAATAAACAGGTGGGGCCAGG - Intronic
1144351112 17:14397322-14397344 CAAAAAAGTTAGATAGGGCCAGG - Intergenic
1144398437 17:14869741-14869763 AAAAATAAATAAACTGGGCCAGG + Intergenic
1144522461 17:15962811-15962833 CAAAATAAATAACAGGGGCCGGG - Intronic
1144691245 17:17266501-17266523 TAAGATAAATAAATGAGGCCAGG + Intronic
1144868051 17:18349723-18349745 AAAAATAAATAGGCCGGGCCCGG + Intronic
1144868926 17:18356330-18356352 AAAAATAAATAGGTGGGGCGCGG - Intronic
1145349400 17:22067461-22067483 CAAAAAAATTAGCTGGGGCCGGG + Intergenic
1145923320 17:28627692-28627714 CAAAAAAAGAATATGGGGCCGGG - Intronic
1146015659 17:29231445-29231467 CAAAATAAATAAAATAGGCCGGG + Intergenic
1146287365 17:31582873-31582895 GAAAATGAAGAGATGAGGCCAGG + Intergenic
1146987069 17:37230087-37230109 TAAAATAAATAAATAAGGCCGGG + Intronic
1147293078 17:39459419-39459441 TAAAATAAAAAGATCAGGCCAGG - Intergenic
1147295140 17:39476397-39476419 AATAATAAATAGTTGGGGCACGG - Intronic
1147450061 17:40498842-40498864 CAAAATAAATAAATAAGGCCAGG - Intronic
1147648265 17:42047325-42047347 CAAAAAAATTAGCCGGGGCCAGG - Intronic
1147687256 17:42293917-42293939 AAAAATAGATAGAGAGGGCCAGG + Intronic
1147707802 17:42439536-42439558 ATAAATAAATAAATAGGGCCAGG - Intergenic
1147729543 17:42589727-42589749 AGACATAAATAGTTGGGGCCAGG - Intronic
1147799444 17:43072861-43072883 AAAAAAAACTAGCTGGGGCCAGG - Intronic
1148039676 17:44696968-44696990 AAAAAAAAAAAGATGGGTCCGGG - Intergenic
1148067696 17:44884594-44884616 CAAAATAAAGAGTTGAGGGCCGG + Intronic
1148412789 17:47482269-47482291 CAAAAAAAAAAAAGGGGGCCGGG + Intergenic
1148599990 17:48886966-48886988 TAAAAGAAATAGATTGGGCTGGG + Intergenic
1148837813 17:50475313-50475335 AAAAATAAAAAATTGGGGCCAGG - Intergenic
1149151371 17:53568263-53568285 GAAAGTAAGTAGAGGGGGCCGGG + Intergenic
1149151509 17:53570230-53570252 AAAAATAAACAGAGGAGGCCGGG + Intergenic
1149710279 17:58735490-58735512 CAAAATATAGAAATGAGGCCAGG - Exonic
1149749559 17:59132366-59132388 AAAAATAAGTATTTGGGGCCAGG + Intronic
1149787148 17:59445496-59445518 AAAAATATATAAATAGGGCCGGG + Intergenic
1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG + Intronic
1150155447 17:62849304-62849326 CAAAAAAAAAAAATTGGGCCGGG - Intergenic
1150306906 17:64093380-64093402 GAAACTGAACAGATGGGGCCAGG - Intronic
1150435905 17:65154009-65154031 TAAAATATATAGTTGTGGCCAGG + Intronic
1150455294 17:65302449-65302471 GAAAATAAATTTCTGGGGCCAGG - Intergenic
1150736649 17:67745842-67745864 AAAGATAAAAAGGTGGGGCCGGG - Intergenic
1150875782 17:68968794-68968816 CTAAAGAAGGAGATGGGGCCAGG - Intergenic
1151034635 17:70783941-70783963 ACAAATAAAGAGATGTGGCCTGG + Intergenic
1151697767 17:75726776-75726798 CAAAATAAATACATAAGGCCGGG + Intronic
1152584998 17:81185046-81185068 GAAAATAAAAAGAAGGGGCCGGG + Intergenic
1152591184 17:81213262-81213284 AAAAATTAATAAGTGGGGCCAGG + Intronic
1152948638 17:83212416-83212438 CAACATCAAGAGTTGGGGCCTGG + Intergenic
1153014492 18:571371-571393 AAAAATAACTAGCTGAGGCCGGG + Intergenic
1153311898 18:3685264-3685286 AAAAATCCAAAGATGGGGCCTGG + Intronic
1154075176 18:11193213-11193235 CAAAGTAAAGGGAAGGGGCCAGG - Intergenic
1154154671 18:11934663-11934685 AAAAATAGACAGAAGGGGCCGGG + Intergenic
1154257140 18:12792574-12792596 CAAAAAAAACAGTTTGGGCCGGG - Exonic
1154988670 18:21579474-21579496 AAAAACAAAAAAATGGGGCCAGG + Intronic
1155149001 18:23107594-23107616 AAAAATAAAGCAATGGGGCCGGG - Intergenic
1155295780 18:24383460-24383482 AAAAATAAATCTATTGGGCCGGG + Intronic
1155489330 18:26383998-26384020 AAAAATAAATAAATGTGCCCTGG - Intronic
1156375958 18:36515510-36515532 CAAAATAAATGGCTGTGGCCGGG - Intronic
1156623709 18:38883674-38883696 TAAAATAAATAATTGGGGCCTGG - Intergenic
1157235257 18:45959342-45959364 CAAAATACATAAATAGGGGCCGG + Intronic
1157354745 18:46922390-46922412 CAGAATAAAAAGTTGAGGCCGGG - Intronic
1157880694 18:51318551-51318573 AAAGATAAATACATGGTGCCTGG - Intergenic
1158469885 18:57726782-57726804 AAAAATAAATAGAATAGGCCGGG + Intronic
1159249166 18:65851097-65851119 CAAAATAAATTATTGAGGCCGGG - Intronic
1159919777 18:74216972-74216994 CAAAATAGATGGATGTGGACTGG + Intergenic
1160254970 18:77240449-77240471 CAAAATAACTAGAAGGGGGCTGG - Intergenic
1160737385 19:669926-669948 AAAAATAAATAAATAAGGCCAGG - Intergenic
1160788969 19:913973-913995 TAAAATAAAAAGAAAGGGCCGGG + Intergenic
1161110037 19:2463959-2463981 AAAAATAAATAAATAGGGCTGGG + Intergenic
1161195787 19:2985778-2985800 CAAAAAGAGTAGCTGGGGCCAGG + Intronic
1161264272 19:3356843-3356865 AAACATATATATATGGGGCCAGG - Intergenic
1161282150 19:3451819-3451841 AAAAAAAAAAAGACGGGGCCAGG + Intronic
1161312303 19:3601572-3601594 AAAAACAAAAAAATGGGGCCAGG + Intronic
1161364886 19:3872767-3872789 CAAAAAACATAAAAGGGGCCTGG + Intergenic
1161419195 19:4166689-4166711 CAATAGAAACAGATGGGGCCAGG - Intronic
1161419823 19:4170612-4170634 AAAAATAAATAAATAAGGCCTGG + Intronic
1161503255 19:4629411-4629433 AAAAAAGAAAAGATGGGGCCCGG - Intergenic
1161542068 19:4857977-4857999 AAAAAAAAAAAGAGGGGGCCGGG + Intronic
1161611436 19:5245283-5245305 AAAAATAAATAAAATGGGCCAGG - Intronic
1161757753 19:6146799-6146821 AAAAAAAATAAGATGGGGCCAGG + Intronic
1162009271 19:7801966-7801988 AAAAACAAATAAATGAGGCCAGG - Intergenic
1162050603 19:8030177-8030199 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1162051963 19:8039765-8039787 CAAAAAAAACACTTGGGGCCAGG + Intronic
1162081751 19:8222173-8222195 AAAAAAAAATAAATAGGGCCGGG - Intronic
1162104063 19:8359424-8359446 AAAAAAAATTAGCTGGGGCCCGG - Intronic
1162125110 19:8495393-8495415 TAAAAAAACTAGCTGGGGCCGGG - Intronic
1162309615 19:9898204-9898226 TAAAAAAATTAGCTGGGGCCAGG - Intronic
1162319692 19:9963871-9963893 AAAAATAACAACATGGGGCCAGG + Intronic
1162541938 19:11302117-11302139 CAAAATTGTTAAATGGGGCCGGG - Intronic
1162570658 19:11470368-11470390 TAAAATAAATAAATAAGGCCGGG + Intronic
1162587173 19:11567251-11567273 TAAAATAAATAAATTAGGCCGGG + Intronic
1162713619 19:12614387-12614409 CAAAATAAATTGGCCGGGCCTGG - Intronic
1162928684 19:13944456-13944478 CAAAATAAACAAATAGGGCCAGG - Intronic
1162941790 19:14014858-14014880 TAAAAAAAGTAGATGAGGCCGGG + Intergenic
1162957835 19:14109185-14109207 AAAAATAAAAAAATGAGGCCAGG + Intronic
1163172742 19:15543867-15543889 AAAAAAAAAAAGATGGGGGCGGG + Intronic
1163309999 19:16508396-16508418 AAAAATAAATAAATTGGGCCAGG - Intronic
1163361484 19:16849406-16849428 CAAAATGAATGGGTGTGGCCGGG + Intronic
1163500190 19:17671616-17671638 CAAAAAAAATAAGGGGGGCCTGG + Intronic
1163511877 19:17740291-17740313 CAAAATAAATAAATAAGGCCGGG + Intergenic
1163733543 19:18964423-18964445 CAAAACAATGAGCTGGGGCCAGG + Intergenic
1163916177 19:20242533-20242555 CAAAAAAAATTTATGGGGCCAGG + Intergenic
1164171663 19:22730660-22730682 CAAAACACATGGATGTGGCCGGG - Intergenic
1164176424 19:22779228-22779250 ATAAATAAATAAATCGGGCCGGG + Intronic
1164208746 19:23079099-23079121 AAAAATACATAGATAGGGCCGGG - Intronic
1164890859 19:31821921-31821943 AAAAATAAATAAATGAGGCTGGG + Intergenic
1165081931 19:33311896-33311918 AAAATTAACTAGGTGGGGCCAGG + Intergenic
1165097977 19:33420405-33420427 AAAAATAATTAGCTGTGGCCGGG + Intronic
1165235184 19:34415090-34415112 AAAAATAAATATATGGGCCAAGG - Intronic
1165350969 19:35275340-35275362 CAAAGTGAGTAGAAGGGGCCGGG - Intronic
1165414719 19:35685623-35685645 AAAAAGTAATAGATGGGGCCAGG - Intergenic
1165459056 19:35933553-35933575 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165459132 19:35934011-35934033 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165555087 19:36623793-36623815 CAAAAAAAAAAAAAGGGGCCGGG + Intronic
1165670554 19:37675048-37675070 CAAAATAAAAAGTTTTGGCCAGG + Intronic
1165865617 19:38935401-38935423 CAAAATAAACGGATGGGCTCTGG + Intronic
1165885014 19:39071751-39071773 TACAATAAATAGTTGGGGCCAGG + Intergenic
1165986927 19:39777662-39777684 TAAAAGACATAGATGGGGCCAGG + Intronic
1166682148 19:44775596-44775618 ATAAATAAATAGATTGGGCCGGG - Intergenic
1166743632 19:45129590-45129612 TAAAATAAATAAATAAGGCCGGG - Intronic
1166757805 19:45204343-45204365 CAAAAAAATTAGCTGGGGCATGG - Intronic
1166854492 19:45776753-45776775 CAAGAAAAAATGATGGGGCCAGG - Intronic
1167011587 19:46812346-46812368 AAAAATAAATAAATGAGGCCAGG + Intergenic
1167014506 19:46831914-46831936 CAAAATAAAGAAATAAGGCCAGG - Intergenic
1167075475 19:47246042-47246064 CAAAAAAAAAAAAGGGGGCCAGG - Intergenic
1167083403 19:47292556-47292578 AAAAATGAATAAATGAGGCCAGG - Intronic
1167167159 19:47806221-47806243 CAAAATAAATAAAAGTGGCTGGG + Intronic
1167330876 19:48855306-48855328 AAAAATAAAAAAATAGGGCCGGG + Intronic
1167342806 19:48925888-48925910 AAAAATAAATAAATAGGGCCAGG + Intergenic
1167365231 19:49051356-49051378 AAAAATAAATAAATAAGGCCGGG + Intergenic
1167398229 19:49245722-49245744 AAAAAAAAATAGCCGGGGCCAGG - Intergenic
1167481123 19:49732087-49732109 CAAAATAAGATGATGTGGCCGGG - Intergenic
1167518118 19:49935164-49935186 AAAAAAAATTAGGTGGGGCCGGG + Intronic
1167519947 19:49948573-49948595 AAAAATAAATAAATAAGGCCGGG - Intronic
1167558332 19:50209800-50209822 GAAAATAATTAGCCGGGGCCGGG + Intronic
1167961148 19:53105095-53105117 AAAAATAAATAGACCGGGCACGG - Intergenic
1167997681 19:53419721-53419743 AAAAATAAATAAATGTGGCCGGG + Intronic
1167997736 19:53420036-53420058 ATAAATAAATAAATGTGGCCGGG + Intronic
1168217555 19:54937394-54937416 AAAAAAAGATAGCTGGGGCCAGG + Intronic
1168352285 19:55683348-55683370 AAAAATAAATAAATAAGGCCGGG - Intronic
1168522844 19:57066269-57066291 AAAAAAAAATAGATATGGCCAGG + Intergenic
1168605080 19:57752163-57752185 CAAAACAAACAAATGAGGCCGGG - Intronic
1168675613 19:58275886-58275908 CAAAATGAATACACAGGGCCGGG + Intronic
1168709585 19:58491251-58491273 TAAAATAAATGTATGGGGCCGGG - Intronic
926149783 2:10418912-10418934 CAAAATAAAGAGGGTGGGCCGGG + Intronic
926246851 2:11128087-11128109 TAAAATAATGAGATGGGACCTGG - Intergenic
926439546 2:12873858-12873880 TAAAATAAATCCTTGGGGCCAGG - Intergenic
926652616 2:15362925-15362947 AGAAAGAAAGAGATGGGGCCAGG + Intronic
927800490 2:26094545-26094567 CATAATAAATAAATACGGCCAGG - Intronic
927801324 2:26102364-26102386 CAAAATATATAGATCTGCCCTGG - Intronic
927970055 2:27299966-27299988 AAAAATAAATAAATGGAGCTGGG - Intronic
928349918 2:30540956-30540978 TAAAAAAAATAAATGTGGCCGGG - Intronic
928546412 2:32333098-32333120 AAAAATAAATAGAAGAGGCTGGG + Intergenic
928635814 2:33245173-33245195 AAAAATAAATAAAAGTGGCCGGG - Intronic
928920553 2:36522504-36522526 AAGAATAAATAAATGAGGCCAGG + Intronic
929713708 2:44289924-44289946 AAAAATAAATAAATTGGGCCAGG - Intronic
930194392 2:48494709-48494731 AAAAATAAATAAATAAGGCCAGG - Intronic
930211672 2:48645560-48645582 CAAAATCAAGAGATGGTGCTCGG - Intronic
931171079 2:59804377-59804399 CCAGAAAAATTGATGGGGCCAGG + Intergenic
931314826 2:61118853-61118875 AAAAATACATAAATGTGGCCAGG - Intronic
931318292 2:61152551-61152573 TAAAAAAAAAAGCTGGGGCCGGG + Intronic
931409122 2:62012094-62012116 CAAAAAAATTAGCTGGGGCTGGG + Intronic
931420435 2:62122085-62122107 CAAAATAAATAAATATGGCCAGG - Intronic
931539462 2:63314170-63314192 AAAAAAAAGAAGATGGGGCCAGG - Intronic
932585808 2:73027955-73027977 AAGATTAAAAAGATGGGGCCAGG - Intronic
932612312 2:73208889-73208911 AAAATTAAGTAGATGTGGCCAGG + Intronic
933082264 2:78005596-78005618 AAAAAAAAAAAGATGGGGGCTGG - Intergenic
933103383 2:78288786-78288808 AAAAATAAATAAATAGGGCTGGG - Intergenic
933190122 2:79324919-79324941 CCAAATAAAGAAATAGGGCCAGG + Intronic
933662851 2:84941847-84941869 AAAAATTAATAAATTGGGCCAGG + Intergenic
934182520 2:89639176-89639198 CACAACACATAGATGGGGTCAGG + Intergenic
934292816 2:91713379-91713401 CACAACAGATAGATGGGGTCAGG + Intergenic
934648750 2:96074853-96074875 CAAAAGAAATAGAAAGGACCAGG - Intergenic
935521042 2:104105453-104105475 CAAAGTAAATAGATGGGGGCAGG + Intergenic
936611994 2:114010648-114010670 AAAAATAAAAAGATTAGGCCAGG + Intergenic
936693021 2:114914834-114914856 CCAAATAAAGAAATGGGGCCGGG + Intronic
936771170 2:115915174-115915196 CAAAACAAAGAGATGGGCTCTGG - Intergenic
937092584 2:119216316-119216338 CAAAGTCAATAGATGGGCCACGG + Intergenic
937191246 2:120101438-120101460 CCAAATAAATATATGTGGCTTGG + Intronic
938172844 2:129096810-129096832 CAAAATGGTGAGATGGGGCCGGG - Intergenic
938238168 2:129723017-129723039 CAAAATAAATGCATGCTGCCAGG + Intergenic
938415786 2:131102566-131102588 CAAAATAAATAGCTGGGTGTGGG + Intergenic
940033302 2:149287633-149287655 CAGAATACATAGGTGTGGCCAGG + Intergenic
940314840 2:152317470-152317492 CAAAATACATAGAGTGAGCCGGG - Intergenic
940432541 2:153610377-153610399 TAAAATAAACAGATTGGGCCGGG + Intergenic
940580740 2:155576195-155576217 TAAAATAAATAGAATAGGCCAGG + Intergenic
940621004 2:156113642-156113664 AACAATAAAAAGTTGGGGCCGGG - Intergenic
941629871 2:167872195-167872217 AAAAATAAGTAAATAGGGCCGGG - Exonic
942026400 2:171914820-171914842 TAAAAAAATTAGCTGGGGCCAGG + Intronic
942120865 2:172775373-172775395 CAGAATTAATAGATCAGGCCAGG - Intronic
942340277 2:174936878-174936900 TAAAATAATTAGTTGTGGCCTGG + Intronic
942718617 2:178923397-178923419 AAAAATAAACTGGTGGGGCCGGG - Intronic
942749116 2:179268094-179268116 AAAAATAAATAAATTAGGCCAGG - Intergenic
942941628 2:181625371-181625393 AAAAAAAAATAAATGGGACCAGG + Intronic
943662000 2:190569019-190569041 CAAAAGAAACAGCTGAGGCCAGG + Intergenic
944658561 2:201901011-201901033 AAAAATAAATAAATTGGGCCGGG + Intergenic
944707902 2:202309462-202309484 AAAAATAAATAAATGGTGCGGGG + Intergenic
944827024 2:203494511-203494533 GAAAATATTTACATGGGGCCAGG + Intronic
945162095 2:206902710-206902732 AAAAACAGATAGCTGGGGCCGGG + Intergenic
945243815 2:207699963-207699985 CAAAAAAACTAAATGAGGCCGGG - Intergenic
945752055 2:213799793-213799815 CAGAATAAATATATGGGTTCCGG + Intronic
946718482 2:222578682-222578704 CAAAAAAATTAGCTGGGGCCGGG + Intronic
947183110 2:227430206-227430228 CAAAATCAAGAAATGAGGCCGGG + Intergenic
947759275 2:232591691-232591713 TGAAATCAGTAGATGGGGCCAGG - Intergenic
949008214 2:241662779-241662801 CAAAATCAATAAAGCGGGCCGGG + Intronic
949008235 2:241662885-241662907 CAAAATCAATAAAGCGGGCCGGG + Intronic
1169763652 20:9125025-9125047 TGAAATAAATTAATGGGGCCAGG - Intronic
1169873508 20:10271933-10271955 CAAAATATAAAGATGGAGCGTGG + Intronic
1170151176 20:13227801-13227823 TAAATTAAAAAGTTGGGGCCGGG - Intronic
1170767098 20:19299573-19299595 CAAAATAAAAAGATCAGTCCAGG - Intronic
1170903119 20:20485394-20485416 CAACATAAATAGTTGGGTCTTGG + Intronic
1170981701 20:21220451-21220473 CAAAATAAATAAAAGAGGCAGGG - Intronic
1170989350 20:21287718-21287740 TAAAATCAAGGGATGGGGCCAGG + Intergenic
1170992803 20:21320592-21320614 AAAAATAAATAAATAAGGCCGGG - Intronic
1171032213 20:21687204-21687226 TAAAATACACAGATGAGGCCAGG - Intergenic
1171315491 20:24188732-24188754 ACAAATAAATAAATGGGGACTGG - Intergenic
1171453942 20:25256026-25256048 CAAAAGAAAGAGCTGGAGCCAGG - Intronic
1171559306 20:26108467-26108489 CCAAAAAATTAGCTGGGGCCGGG + Intergenic
1172048305 20:32097282-32097304 AAAAGTAAATAAATAGGGCCGGG + Intronic
1172074800 20:32287304-32287326 TAAAAAAAATAGATTGGGCCTGG - Intronic
1172134619 20:32678680-32678702 AACAATAAATAGAAGTGGCCGGG + Intergenic
1172254596 20:33506110-33506132 GAAAAGAAATAGAAGGGGCTGGG + Intronic
1172266455 20:33619227-33619249 CAAAATAAAAAGACCGGGCGCGG + Intronic
1172366532 20:34354272-34354294 CAAAAAAATTAGATGGGACTGGG - Intergenic
1172561189 20:35890022-35890044 AAAAATAAATAAATAGGGCCAGG - Intronic
1172573462 20:35988158-35988180 AAAAATAAATAGGCTGGGCCTGG - Intronic
1172682705 20:36729076-36729098 TACAATCAGTAGATGGGGCCTGG - Intronic
1173096680 20:40038123-40038145 CAAAGTACTTAGCTGGGGCCTGG + Intergenic
1173295773 20:41755110-41755132 CAAAGTAAAAAGATAAGGCCGGG - Intergenic
1173948953 20:46975372-46975394 CAAAATAAAAAGTTTTGGCCGGG + Intronic
1174009360 20:47437149-47437171 AAAAATAAAAATATGGGGCTGGG + Intergenic
1174225866 20:48999451-48999473 CAAAAGAAATGTATGTGGCCGGG + Intronic
1174389911 20:50212628-50212650 CAGAATCAAGGGATGGGGCCAGG - Intergenic
1174418314 20:50382613-50382635 CAATATAAATAAATGCTGCCAGG - Intergenic
1174430563 20:50465510-50465532 AAAAATAAATATACTGGGCCGGG + Intergenic
1174815396 20:53682922-53682944 CACAAGAAATACATGTGGCCAGG + Intergenic
1174985250 20:55444254-55444276 CATAATACATAAATGGGACCTGG + Intergenic
1175405211 20:58721725-58721747 TAAAAAATATAGATGGGCCCTGG + Intergenic
1175416887 20:58807374-58807396 CCAAATAACAACATGGGGCCGGG - Intergenic
1175651999 20:60733321-60733343 CAAATTAAATAGGTGGGTACAGG - Intergenic
1176208168 20:63902347-63902369 AAAAAAAAAAAGATGAGGCCAGG - Intronic
1176789260 21:13299967-13299989 AAAAATAACTATATGGAGCCAGG + Intergenic
1177799358 21:25812665-25812687 AAAAATAAATAGGTCGGGCGCGG + Intergenic
1177837145 21:26197199-26197221 AAAAATAAAGATGTGGGGCCCGG + Intergenic
1177922439 21:27169351-27169373 AAAAATACATACAAGGGGCCGGG + Intergenic
1178399253 21:32270100-32270122 AAAAATAAAAAGCTGGGGGCAGG + Intronic
1178525689 21:33326489-33326511 AAACATAAATAGATCGGGCGTGG - Intronic
1178983627 21:37284901-37284923 GAAAATAAACCAATGGGGCCGGG - Intergenic
1178995557 21:37396044-37396066 GAAAACAGATACATGGGGCCAGG - Intronic
1179483390 21:41692898-41692920 CAAAAGAAGTAGCCGGGGCCGGG + Intergenic
1180217830 21:46337270-46337292 ATAAGTAAATAAATGGGGCCGGG - Intronic
1180930751 22:19589193-19589215 CAAAAGGAATAAATGTGGCCGGG - Intergenic
1180974425 22:19839581-19839603 AAAAATAATTAGCTGGGGCAGGG + Intronic
1181283765 22:21737506-21737528 TAAAATAGTTAAATGGGGCCGGG - Intergenic
1181859325 22:25805946-25805968 AAAAATAAATAAAGGTGGCCAGG - Intronic
1182179268 22:28328456-28328478 AAAAATAAATAAATAGGGCCAGG + Intronic
1182502857 22:30760518-30760540 GAAAATCAATAAATGGGGCTGGG + Intronic
1182784779 22:32898286-32898308 TAAAAACAATAGCTGGGGCCGGG - Intronic
1183240006 22:36650670-36650692 AAAAATAAATAGAATGGGCTAGG - Intronic
1183245826 22:36692661-36692683 ACAAATAAAGAGATGGGGCCTGG - Intronic
1183816543 22:40306688-40306710 AAAAATAAATAAATAAGGCCAGG + Intronic
1183835330 22:40448014-40448036 CAAAAAAATTAGCTGGGGCTGGG + Intronic
1183895066 22:40961697-40961719 AAAAATAAAGAATTGGGGCCAGG - Intronic
1184018967 22:41807864-41807886 AAAAATAAATAAAAAGGGCCGGG + Intronic
1184368345 22:44067135-44067157 CAGAATAAATTAAAGGGGCCTGG - Intronic
1184586210 22:45449881-45449903 AAAAATAAATAAATAGGGCCAGG - Intergenic
1185255856 22:49830813-49830835 AAAAATAAAACGATGGGGCCAGG + Intergenic
1185271701 22:49932601-49932623 AAAAATACATAAATAGGGCCGGG - Intergenic
1185369039 22:50451032-50451054 TAAATTCATTAGATGGGGCCGGG + Intronic
949231470 3:1755985-1756007 TAAAATATTCAGATGGGGCCAGG + Intergenic
949254930 3:2034890-2034912 CAAAATAAGGAAATGGGGCGAGG + Intergenic
949475740 3:4443466-4443488 TAAAATAAAAAGAAGAGGCCAGG + Intronic
949650451 3:6152660-6152682 CTTAGTAAATTGATGGGGCCTGG - Intergenic
949976152 3:9462290-9462312 GAATATAGATAGATGGAGCCAGG + Intronic
949976204 3:9462610-9462632 GAATATAGATAGATGGGGCCAGG + Intronic
949994576 3:9606466-9606488 TTAAATATAGAGATGGGGCCAGG + Intergenic
950135306 3:10576767-10576789 CAATATAAGAAGCTGGGGCCGGG + Intronic
950300930 3:11877585-11877607 AAAAAAAAATAGATAAGGCCAGG - Intergenic
950550528 3:13663432-13663454 CCAAAAAAAAAGATGGGGCAAGG - Intergenic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951892348 3:27579098-27579120 GAAAGTCAATAGATGGGGCCAGG + Intergenic
952391019 3:32880322-32880344 AAAAATAAATGGATGAGGCTGGG - Intronic
953429309 3:42824523-42824545 CAAAATAGATTCATGGGGCAGGG - Intronic
953759487 3:45675232-45675254 CAAAAGAAATATAAGGGGCCGGG + Intronic
953829288 3:46281535-46281557 TAAAATAAATTGATGGGTCTTGG + Intergenic
953870062 3:46618543-46618565 AAAAATATATACATGCGGCCGGG + Intronic
953989332 3:47472136-47472158 AATAATAATTAAATGGGGCCGGG + Intronic
954198458 3:49010015-49010037 AAAAAAATAGAGATGGGGCCTGG - Intronic
954217897 3:49134481-49134503 CAAAATAAATAGATGGGGCCTGG - Intergenic
954240122 3:49287145-49287167 ATAAATAAATAAATAGGGCCAGG - Intronic
954802948 3:53197747-53197769 CTAAATAAATAAATAAGGCCGGG - Intergenic
955107981 3:55918305-55918327 AAAAATAAAAAGGTGGGGGCAGG + Intronic
955559948 3:60178217-60178239 TGAAATAAAAAGATGGGGCTTGG - Intronic
955734347 3:62020968-62020990 TAAAAAACATAGATGAGGCCAGG - Intronic
955842796 3:63129960-63129982 AAAAATAAATAAATAAGGCCTGG + Intergenic
956075925 3:65505401-65505423 AAAAAAAAATAACTGGGGCCAGG + Intronic
956819887 3:72944537-72944559 AAAAACAAACAGCTGGGGCCGGG - Intronic
957365042 3:79212018-79212040 CAAAATAAAGGGATGGGCTCTGG + Intronic
957627926 3:82678796-82678818 CATAAAACATAGCTGGGGCCAGG - Intergenic
958489477 3:94753538-94753560 CAAACTAAAAAGATGTGGCCGGG - Intergenic
958916521 3:100056702-100056724 AAAAAAAAAAAAATGGGGCCGGG + Intronic
959198519 3:103215716-103215738 CAAAATAAAGGGATGGGCTCTGG - Intergenic
959230642 3:103646622-103646644 GAAAATAAGTACATGGGGCAGGG - Intergenic
959265209 3:104128742-104128764 CAAAATAGATAAATGGGGAGGGG + Intergenic
959401139 3:105903716-105903738 AGAAATAAATAGAAGGGGCGGGG - Intergenic
959785177 3:110288330-110288352 GAAATTAAAAAGATGGGGCTGGG - Intergenic
960093703 3:113667582-113667604 AAAAATACATACATGGAGCCGGG + Intronic
960230226 3:115217414-115217436 CAAAATAAAAAGATGTAGCTCGG + Intergenic
960272887 3:115693768-115693790 TAAAATAAAATGATGGGGGCTGG + Intronic
960336197 3:116420569-116420591 AAAAATAAATAAATTGGGCCGGG + Intronic
960809876 3:121617702-121617724 CAAAATAACTAAAAGAGGCCAGG + Intronic
960911618 3:122654854-122654876 CAAAAAAATTAGCTGGGGCATGG + Intergenic
961051223 3:123748773-123748795 AAAAATAAATACATAAGGCCGGG + Intronic
961263550 3:125621931-125621953 AGAAATAAAGAGGTGGGGCCTGG + Intergenic
962081518 3:132144461-132144483 ATAAATAAATAAATAGGGCCAGG + Intronic
962602043 3:136999389-136999411 TAAAATAATTAGCTGTGGCCAGG - Intronic
962793566 3:138832530-138832552 AAAAATACAAAGATTGGGCCGGG + Intronic
963108240 3:141664609-141664631 CAAAGTGAAGAGTTGGGGCCTGG - Intergenic
963212566 3:142709519-142709541 TAAAATTAATAAATGAGGCCGGG + Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963586074 3:147190588-147190610 AAAAATAGATAGATGAGACCAGG - Intergenic
963987699 3:151616260-151616282 CAAAATAAATATTTAGTGCCAGG - Intergenic
964181378 3:153891111-153891133 CAAAATAAGTAGATGAGGTCTGG - Intergenic
964197573 3:154082258-154082280 CAAAATAAAGGGATGGGCTCTGG + Intergenic
965028532 3:163333796-163333818 AAAAATAAATAAATTGGGCCGGG + Intergenic
965578036 3:170238065-170238087 AAAAAAAATTATATGGGGCCGGG + Intronic
965632909 3:170751692-170751714 GAAAACAAATACATGGGGCCAGG - Intronic
966838737 3:184070204-184070226 CTCAATAAAAAAATGGGGCCAGG - Intergenic
967039713 3:185679908-185679930 TGAAATAAAAGGATGGGGCCGGG - Intronic
967187926 3:186961269-186961291 CAAGATCAAGTGATGGGGCCGGG - Intronic
967310203 3:188098864-188098886 CTAAAGAAACAGATGAGGCCGGG + Intergenic
967914629 3:194569462-194569484 AAAAAAAAAAAAATGGGGCCGGG + Intergenic
968847775 4:3055935-3055957 CAAAGAAAATGGATGGGTCCAGG - Intergenic
969365452 4:6691479-6691501 AAAAGTAAATAAATGGGGCCAGG + Intergenic
969452937 4:7285326-7285348 CAACATGAGGAGATGGGGCCGGG - Intronic
969909529 4:10430717-10430739 TAAAATAGGTAGAAGGGGCCGGG - Intergenic
970166300 4:13241752-13241774 AAGAATAAATAAATGGAGCCAGG - Intergenic
970186729 4:13462977-13462999 CAAGATCAATAGATGGGGTCAGG - Intronic
970872282 4:20829554-20829576 CAAAAATAAGAGGTGGGGCCTGG + Intronic
971092016 4:23356800-23356822 AAAAACAAATAAATGTGGCCGGG + Intergenic
971295509 4:25386206-25386228 AAAAATAAATAAATAAGGCCAGG - Intronic
972223893 4:36989512-36989534 TAAAATAATTAGGTGGAGCCAGG + Intergenic
972441536 4:39098560-39098582 CAAAAAAAAAAGTTGTGGCCCGG - Intronic
972634697 4:40872788-40872810 AAAAAAAAAAAGATGGCGCCGGG + Intronic
972694366 4:41430558-41430580 TAAAATACAGAGATGGGGGCAGG - Intronic
973629906 4:52810741-52810763 AAAAAAAATTAGGTGGGGCCGGG + Intergenic
974092601 4:57327799-57327821 AAAAGTAAATGAATGGGGCCAGG + Intergenic
974514643 4:62893870-62893892 TAAAATAAAAAGATGAGGCAAGG - Intergenic
974571156 4:63650433-63650455 CAAAATAAGCAGATGGGTCTTGG + Intergenic
974736872 4:65946922-65946944 AAAAATAAAAAGATATGGCCGGG - Intergenic
976175494 4:82347657-82347679 AAAAATAAATAAACTGGGCCGGG + Intergenic
976182033 4:82408043-82408065 TTAAAAAAATAGATAGGGCCGGG + Intergenic
976196960 4:82542250-82542272 GTAAATAAATAGAATGGGCCAGG + Intronic
976210356 4:82662562-82662584 AAAAAAAAAAAGATGGGGCCGGG + Intronic
976556897 4:86460773-86460795 CAAAATAAAGAGATGGGCTCTGG - Intronic
976632006 4:87248246-87248268 CAAAACTACTAGAAGGGGCCAGG + Intergenic
977230775 4:94449880-94449902 CAATACAAATAGCTGGGACCTGG + Intergenic
977437573 4:97018851-97018873 AAAAATAAATGGATGGGGCTGGG - Intergenic
977443221 4:97097121-97097143 CAAAATAAAGGGATGGGCTCTGG + Intergenic
977602845 4:98952572-98952594 AAAAATATATAAATAGGGCCAGG - Intergenic
977784612 4:101018526-101018548 CAAAATAAATATAAGTAGCCAGG + Intergenic
978607041 4:110492014-110492036 CAAAAGAAAACGATTGGGCCAGG - Intronic
978729889 4:112013354-112013376 CAGAAAAGATACATGGGGCCAGG + Intergenic
978776017 4:112507699-112507721 CAAAATAAATAAATAAGGGCCGG - Intergenic
978782643 4:112572893-112572915 CAAAATTAATAGATGTTGGCAGG + Intronic
978793428 4:112686048-112686070 AAAAATAAATAAATAAGGCCAGG + Intergenic
978925124 4:114233533-114233555 TAAAAAAGATAGAGGGGGCCAGG + Intergenic
979000249 4:115208525-115208547 ACAAAAAAATAGATGAGGCCAGG + Intergenic
979232159 4:118358273-118358295 TTAAAGAAATAGATGGGGCCGGG - Intergenic
979660834 4:123253185-123253207 CAAAAGAAATAGCTGGGGCTGGG + Intronic
980123221 4:128749179-128749201 GAAATTAATTTGATGGGGCCAGG + Intergenic
980569618 4:134597455-134597477 AAAGATAAATAGATGGGACTTGG + Intergenic
980710050 4:136553925-136553947 CAATATAGATAGATAGGTCCAGG - Intergenic
980853405 4:138410994-138411016 AAAAATAAAATGGTGGGGCCGGG - Intergenic
981467269 4:145087749-145087771 AACAATAAAGAGATGAGGCCAGG + Intronic
981728235 4:147870354-147870376 TAAAATACATATATGCGGCCGGG - Intronic
981786587 4:148486212-148486234 AAAAATATATAGATCAGGCCAGG - Intergenic
981851952 4:149241635-149241657 TTAAATAAACAGATGAGGCCGGG - Intergenic
983556970 4:169067834-169067856 CAAAAAAATTAGCCGGGGCCGGG + Intergenic
984015388 4:174419620-174419642 AAAAATATATATCTGGGGCCAGG - Intergenic
984606233 4:181788891-181788913 CAAAATTAAAAGATAGGGCTAGG - Intergenic
984741942 4:183173345-183173367 CAAAAGAAAAATATGTGGCCAGG - Intronic
984763011 4:183378495-183378517 CAAAATAAAGGGATGGGCTCTGG + Intergenic
984797107 4:183672166-183672188 AGAAATAAATAGATGTGACCTGG + Intronic
985040605 4:185888107-185888129 CAGAATAAATAAATTGGGACAGG - Intronic
985061677 4:186086152-186086174 CAAAATAAAAAGGCGGGGCGCGG - Exonic
985088945 4:186343834-186343856 AAACATAAACAGAAGGGGCCGGG - Intergenic
985710597 5:1426241-1426263 AAAGATAAATAGATCTGGCCAGG + Intronic
986391014 5:7288481-7288503 CAAAACAAAAAGATGGGTCACGG + Intergenic
987004813 5:13699416-13699438 AAAAATAAATACTTGGGGCCGGG + Intronic
987018531 5:13846132-13846154 TAAAATAAAAAGTTGGGGCCAGG - Intronic
987064044 5:14270311-14270333 GATTATAAATAGCTGGGGCCTGG - Intronic
987750531 5:22033040-22033062 AAAAAAAAAAAAATGGGGCCAGG + Intronic
987910060 5:24130969-24130991 CATAATAAAGGGATGGGGCTTGG - Intronic
987926015 5:24342869-24342891 CAAGATATAAAGATGGGGCCGGG + Intergenic
988261180 5:28887523-28887545 CATAATATTTTGATGGGGCCAGG + Intergenic
988415129 5:30937426-30937448 CAAAATAAATATATAGCACCTGG + Intergenic
988426483 5:31071504-31071526 AAAAAGGAATAAATGGGGCCAGG + Intergenic
988578620 5:32449660-32449682 AAAAATAAATAAATAGGGCTGGG + Intergenic
989155712 5:38343106-38343128 TAAAATGAAGGGATGGGGCCAGG + Intronic
989612585 5:43309533-43309555 CAAAATAGAAAGAGGGGCCCAGG - Intronic
990023266 5:51155114-51155136 GAAAATAAATAGATTAGGCCAGG + Intergenic
990180561 5:53156007-53156029 TAAAATAAACAAATTGGGCCAGG - Intergenic
990305184 5:54487433-54487455 CAAACTTAATACATGGGGCTGGG + Intergenic
990403968 5:55469190-55469212 CAAAATAAACAGTTAAGGCCGGG + Intronic
990439921 5:55834018-55834040 CAAAATGAAAATATGGGGCTTGG + Intergenic
990541327 5:56775854-56775876 AAAATTAAATAGGAGGGGCCGGG + Intergenic
990589861 5:57250838-57250860 GAAAATACATAAATGCGGCCAGG - Intronic
990731331 5:58812176-58812198 AAAAAGAAAGAGATGGGGGCTGG + Intronic
991181808 5:63760727-63760749 GAAAATAAATTGATGGGGCCAGG - Intergenic
991294986 5:65071208-65071230 GAAAATAAAGGGATGGGGCAGGG - Intergenic
991394236 5:66186966-66186988 CAAAATAACAACATGAGGCCAGG + Intergenic
991692835 5:69242137-69242159 CAAAATAAATAAGTGGTGCTGGG - Intronic
991922542 5:71671167-71671189 CAAAAAATATAGATAGGGCCAGG - Intergenic
992415622 5:76550153-76550175 CAAAATACAATGATGGGGACAGG + Intronic
992965249 5:81992697-81992719 CAAAAAAAATAAAATGGGCCAGG - Intronic
992969157 5:82037540-82037562 CATAAAAAGTAAATGGGGCCGGG - Intronic
993728311 5:91393568-91393590 AAAAATACATATATTGGGCCAGG + Intergenic
994435297 5:99722211-99722233 CAAAATAAAAAGGTGGGGTATGG + Intergenic
994597012 5:101852415-101852437 CAAAAGACATAGATTGGGCCAGG + Intergenic
995094112 5:108214663-108214685 CAAAATTAATAAATCGGGCCAGG - Intronic
995122248 5:108548682-108548704 TAAAATGCATAGATGAGGCCAGG + Intergenic
995158838 5:108950973-108950995 AAAAATAAATTTATAGGGCCAGG + Intronic
995653458 5:114397681-114397703 AAAAAATAATAGATGTGGCCAGG - Intronic
997529938 5:134575903-134575925 ATAAATAAACAGATGTGGCCAGG + Intronic
997540982 5:134662124-134662146 TAAAATAAATAAATGTGGCCAGG - Intronic
997541348 5:134665530-134665552 AAAAATAAAAATAGGGGGCCAGG - Intronic
998150506 5:139754539-139754561 CAAAAAAAATAGCTGGGGCGTGG + Intergenic
998346803 5:141471352-141471374 CAAAATAAAAATAGGGGGCTTGG - Intronic
998359175 5:141570134-141570156 CCAAATAAAAAGATGGGGATGGG + Intronic
998490206 5:142540019-142540041 CAAAATAAAAAGATGGGGGTTGG + Intergenic
998491282 5:142549005-142549027 AAAAAAAAATAGAAGGGGCCAGG - Intergenic
998573767 5:143290855-143290877 TTAAATATAGAGATGGGGCCAGG - Intronic
998694195 5:144620470-144620492 CTAAAGAAATAGACGTGGCCGGG + Intergenic
999168196 5:149569613-149569635 CAAAATAAATAAATAAGGCCGGG - Intronic
999437527 5:151574830-151574852 CAAAACAACTGGATGTGGCCAGG + Intergenic
999618203 5:153447815-153447837 CAGATTAAAAAGAGGGGGCCGGG - Intergenic
1000100161 5:158008505-158008527 CAAAAGGAATAAATGGGCCCGGG - Intergenic
1000218713 5:159190388-159190410 AAAAAAAAATACCTGGGGCCAGG + Intronic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1000570602 5:162908801-162908823 AAAAATATATAGATGGGGGGTGG + Intergenic
1000839271 5:166196423-166196445 AATAATAAAGACATGGGGCCGGG + Intergenic
1000925160 5:167185118-167185140 AAAGATAGATAGATGAGGCCAGG - Intergenic
1000939780 5:167346762-167346784 AAAAAAAAATAGTTGGGGCTTGG - Intronic
1001328307 5:170745206-170745228 AAAAATGAAAAGGTGGGGCCGGG - Intergenic
1002255288 5:177953862-177953884 AAGAGTAAAAAGATGGGGCCGGG + Intergenic
1002482708 5:179513896-179513918 GAGAGTAAAAAGATGGGGCCGGG - Intergenic
1002610156 5:180412455-180412477 AAAAATAAAAACGTGGGGCCGGG + Intergenic
1002631365 5:180582151-180582173 TAAAAAATATAGACGGGGCCAGG + Intergenic
1003167214 6:3691039-3691061 AAGAATAAATCTATGGGGCCGGG + Intergenic
1003248594 6:4404988-4405010 AACAATAAATAGATGTAGCCAGG + Intergenic
1003252194 6:4439809-4439831 CAAAGTAACTAGAAGAGGCCAGG + Intergenic
1003888754 6:10544646-10544668 ATAAATAAATAAATGGGGCCGGG + Intronic
1003893191 6:10581563-10581585 AAAAATAAATAAATGAGGCCGGG - Intronic
1004537969 6:16521266-16521288 AAAAACGAATAAATGGGGCCGGG + Intronic
1005300554 6:24466046-24466068 CAAAAGAAACAGATGGAGGCTGG + Intronic
1005389854 6:25321951-25321973 AAAAACAAATAAATAGGGCCAGG - Intronic
1005607341 6:27488073-27488095 CAAACAAAACAGATTGGGCCTGG - Intergenic
1005679755 6:28194751-28194773 AAAAAAAAGTAAATGGGGCCAGG - Intergenic
1005919524 6:30387666-30387688 AAAAATAAATAAATGAGACCTGG + Intergenic
1006568367 6:34979188-34979210 AAAAATAACTAGTAGGGGCCGGG - Intronic
1007211922 6:40199515-40199537 CAAAAAAATTAGCTGGGGCGTGG - Intergenic
1007433281 6:41788744-41788766 AAAAAGAAATAAATGTGGCCGGG - Intronic
1007551800 6:42735607-42735629 CAAAACAAAAAGATCTGGCCAGG + Intergenic
1007681049 6:43633699-43633721 CAAAATAGACAAGTGGGGCCAGG - Intronic
1007843921 6:44738634-44738656 CAGGGTAAAAAGATGGGGCCTGG + Intergenic
1008016884 6:46530577-46530599 AAACATAAATAGAAGGGGTCTGG + Intergenic
1008043158 6:46823314-46823336 CAAAGTAACTGGATGAGGCCAGG + Intronic
1008971527 6:57374585-57374607 AAAAATAAATAAATAAGGCCGGG - Intronic
1009351158 6:62680622-62680644 AAAAATATTGAGATGGGGCCGGG + Intergenic
1010424248 6:75708597-75708619 AAAAATAAATAAGTGAGGCCAGG + Intronic
1011351675 6:86431048-86431070 CCAGAGAAATACATGGGGCCAGG + Intergenic
1011730532 6:90258069-90258091 AAAATTAAATAAATGGGGGCTGG - Intronic
1012269737 6:97194054-97194076 AAAAATAAACAAATGAGGCCAGG - Intronic
1012468976 6:99548516-99548538 AAAAATCAATAGAAGGGGCTGGG + Intronic
1012502857 6:99909069-99909091 TAAAAATAAAAGATGGGGCCAGG + Intergenic
1012849502 6:104429868-104429890 GAAAAGAGAGAGATGGGGCCAGG + Intergenic
1012854080 6:104480561-104480583 AAGAAGAAATAGATGGGGTCGGG + Intergenic
1013553926 6:111237123-111237145 CAAAATAAATAAATAAGACCAGG - Intergenic
1013787866 6:113802491-113802513 CAAAATAAAAATATGGGTCCGGG + Intergenic
1014718195 6:124890143-124890165 TAAAATAAATAGCTGGGGCATGG - Intergenic
1014863888 6:126505117-126505139 CAAAATAAAGGGATGGGCTCTGG - Intergenic
1015515507 6:134079085-134079107 TAAAATAAATATAAGGGGCTGGG + Intergenic
1015552062 6:134421931-134421953 CTAATTAAATAGAAGGGCCCAGG + Intergenic
1015561597 6:134522062-134522084 TTAAAGAAATAAATGGGGCCAGG + Intergenic
1015682591 6:135824784-135824806 AAAAATAAGTGAATGGGGCCAGG + Intergenic
1015704777 6:136076173-136076195 CAAAATAAACTGATGCAGCCGGG + Intronic
1015885734 6:137916140-137916162 TAAAATAAATAGAAGGAGGCAGG + Intergenic
1016971069 6:149764743-149764765 AAAAATTAAAAAATGGGGCCAGG + Intronic
1017159976 6:151355594-151355616 AAAAAAACAAAGATGGGGCCGGG - Intronic
1017354726 6:153490316-153490338 TAAGATAAAGAGACGGGGCCGGG + Intergenic
1017417836 6:154240940-154240962 TGAAATAGATAGTTGGGGCCAGG + Intronic
1017548365 6:155476652-155476674 CAAAATTAAAAGATGAGGCCAGG + Intergenic
1017687915 6:156931665-156931687 AAAAATAAATAAATTAGGCCGGG + Intronic
1017918037 6:158847741-158847763 CAAGAAAATGAGATGGGGCCAGG - Intergenic
1017999369 6:159565231-159565253 AAATATAAATAGTTTGGGCCAGG - Intergenic
1018323361 6:162636959-162636981 AAAAAAAAAAAGATGTGGCCAGG + Intronic
1018591769 6:165433718-165433740 CAAAAGAAGTACAGGGGGCCGGG + Intronic
1019511638 7:1420529-1420551 CAAGAGAAATAGATGGGGCCGGG - Intergenic
1019813967 7:3185752-3185774 CAAAATAAAAAGTTAAGGCCAGG + Intergenic
1019927722 7:4204450-4204472 CAAAATAAATAGTTGGTGTCAGG + Intronic
1019939156 7:4275634-4275656 TAAAAGAATGAGATGGGGCCGGG + Intergenic
1020133687 7:5574291-5574313 CAAAAGAAGCAGATGTGGCCAGG - Intergenic
1020205841 7:6114983-6115005 AAAAATATATATATAGGGCCGGG - Intronic
1020208382 7:6137972-6137994 AAAAATAAATATATGTGGTCGGG - Intronic
1020561470 7:9732735-9732757 ATTAATAAATAGAGGGGGCCGGG - Intergenic
1021171160 7:17399284-17399306 CAAAATTTATATGTGGGGCCAGG - Intergenic
1021504274 7:21364027-21364049 TTAAATAAATAAATGGGGCCAGG - Intergenic
1021589081 7:22241388-22241410 CTAAATAAATAGAGGGGGCAGGG + Intronic
1021730415 7:23590087-23590109 CTCAATAAATACATTGGGCCGGG - Intergenic
1021858803 7:24884986-24885008 TGAAAGAAATAAATGGGGCCAGG + Intronic
1022676540 7:32505167-32505189 TAAAATAAAAAGATCAGGCCGGG - Intronic
1022742346 7:33134889-33134911 CAAAATAAATAAATAAAGCCAGG - Intronic
1023625644 7:42112875-42112897 ATAAATAAATAAATAGGGCCGGG + Intronic
1023810958 7:43911398-43911420 TCAAATAAATAAATAGGGCCAGG + Intronic
1023941840 7:44773360-44773382 TAAAATAAAGAGTTGGGGCCGGG - Intergenic
1024008857 7:45251070-45251092 TAAAATAATTAGCTGAGGCCAGG + Intergenic
1024387198 7:48766202-48766224 CAAAAGATATAGTTGGGCCCTGG + Intergenic
1024747474 7:52424986-52425008 TAAAATAAATATTTGGGACCAGG - Intergenic
1024986048 7:55194086-55194108 CAAAATAAATGGCTTGGGGCAGG - Intronic
1025069991 7:55889394-55889416 TAAAAGAAATAGATCAGGCCGGG - Intronic
1025097875 7:56111289-56111311 TAAAATAAATACTTAGGGCCAGG - Intergenic
1025195387 7:56928371-56928393 GAAAAAAAAAAAATGGGGCCAGG + Intergenic
1025244257 7:57304281-57304303 AAAAATAAATATACTGGGCCTGG - Intergenic
1025264915 7:57448950-57448972 AAAAAGAAAAAGGTGGGGCCGGG - Intergenic
1025617947 7:63140548-63140570 CAAAAACAGTAGATGGGGCTTGG - Intergenic
1025619807 7:63158417-63158439 CAATAAAAATAAATAGGGCCAGG + Intergenic
1025633971 7:63305236-63305258 AAAAAAAAAAAGGTGGGGCCGGG + Intergenic
1025648726 7:63442931-63442953 AAAAAAAAAAAGGTGGGGCCGGG - Intergenic
1025676565 7:63648571-63648593 AAAAAAAAAAAAATGGGGCCAGG - Intergenic
1026037864 7:66842590-66842612 TAAAATAAATACTTAGGGCCAGG - Intergenic
1026062495 7:67038606-67038628 CAAAATACAAACATGTGGCCAGG + Intronic
1026080993 7:67220496-67220518 AAAAATCAATAAATGAGGCCAGG - Intronic
1026187669 7:68095120-68095142 CAACAAAAATAAATAGGGCCAGG + Intergenic
1026240016 7:68565536-68565558 AAAAATAAATGGAGTGGGCCAGG + Intergenic
1026243693 7:68599288-68599310 CTACATAAGTAGATGGAGCCTGG - Intergenic
1026251217 7:68672533-68672555 AAAAATAAATAGAATAGGCCAGG - Intergenic
1026254738 7:68700993-68701015 AAAAAAAAAAAAATGGGGCCAGG - Intergenic
1026537520 7:71252229-71252251 AAAAAAAAAAAGATGAGGCCGGG + Intronic
1026958189 7:74391522-74391544 AAAAATCAGAAGATGGGGCCAGG + Intronic
1026961269 7:74409275-74409297 AAAAAAAAATAGAATGGGCCGGG + Intergenic
1027153449 7:75749662-75749684 AAAAATAAAAAAATAGGGCCAGG - Intergenic
1027155318 7:75763278-75763300 CAAAAAAAATTTTTGGGGCCGGG - Intergenic
1027213641 7:76169637-76169659 TAAAATAAATACTTAGGGCCAGG + Intergenic
1027558509 7:79696643-79696665 AAAAATAAAAAGCTGGGGCCGGG - Intergenic
1028120960 7:87056412-87056434 CAAAGGAAATAAATGAGGCCTGG - Intronic
1029425590 7:100492238-100492260 CAAAAAAAAAAAAAGGGGCCAGG + Intronic
1029461291 7:100695042-100695064 AAAAATAAATAAATAGGGGCCGG - Intergenic
1029665154 7:101990348-101990370 CAAACAAAAGAGATGGGGTCTGG - Intronic
1029691214 7:102183307-102183329 AAAAATTAAGAGATGGGGCCGGG - Intronic
1029786945 7:102801627-102801649 AAAAAGACATAGAAGGGGCCAGG + Intronic
1030000142 7:105051020-105051042 AGAAAGAAATAGATGAGGCCTGG - Intronic
1030255211 7:107503012-107503034 AAAAATAAATAAATGGGACCTGG - Intronic
1032048673 7:128632088-128632110 CAAAAAATGTAGTTGGGGCCAGG + Intergenic
1032180039 7:129667548-129667570 AAAAATAAATAAATGGGGGTGGG - Intronic
1032326984 7:130938180-130938202 CAAAATAAAAAGACAGGGCACGG - Intergenic
1032567378 7:132960680-132960702 AAAAATTAACAAATGGGGCCAGG + Intronic
1032725704 7:134588456-134588478 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1032805754 7:135352664-135352686 CAGAATAATTCGATGTGGCCTGG - Intergenic
1032852454 7:135806681-135806703 AAAAATAAATATAGGAGGCCAGG + Intergenic
1033368105 7:140686573-140686595 AAAAATAAATAAATAAGGCCGGG - Intronic
1033925349 7:146452200-146452222 CAAAATATATAGAAGAGGCCGGG - Intronic
1033972586 7:147060566-147060588 CAAAAAAAATATCTGGGGCCGGG + Intronic
1034079535 7:148263441-148263463 CAAAATATATAAAAGTGGCCGGG + Intronic
1034094286 7:148392365-148392387 TAAAATAACTAGCTGTGGCCAGG - Intronic
1034185807 7:149176035-149176057 AGAAATAAATATTTGGGGCCGGG + Intronic
1034444105 7:151103446-151103468 CAAAATAAAAAGCTGGGGGTGGG - Intronic
1034581240 7:152044262-152044284 CAAAATAAAAGGATGGGCTCTGG + Intronic
1034655366 7:152724887-152724909 AAAAATAAATAAATATGGCCAGG - Intergenic
1034761132 7:153672935-153672957 CAAAAAAATTAGCTGGGGCATGG - Intergenic
1035052751 7:156011191-156011213 AAAAACAAATTGATAGGGCCGGG - Intergenic
1035174092 7:157038205-157038227 TAAAATAAAAAGATGTGGCCAGG + Intergenic
1035203600 7:157281024-157281046 AAAAATAAAAAAATTGGGCCAGG + Intergenic
1036009549 8:4706710-4706732 CAAAAGACAGAGATGTGGCCGGG + Intronic
1036929773 8:12944384-12944406 AAAAATATATAGAAGAGGCCAGG + Intergenic
1037247661 8:16855073-16855095 AAAAATAGATATTTGGGGCCAGG + Intergenic
1037396339 8:18447784-18447806 CTAAAAAAGTAGATAGGGCCAGG - Intergenic
1037695842 8:21223298-21223320 AAAAAAAAATAGATGTGACCAGG + Intergenic
1037995214 8:23347365-23347387 ATAAATAAATAGGTGGGGCACGG + Intronic
1038803484 8:30770185-30770207 AAAAATAATTACATCGGGCCAGG + Intergenic
1039216120 8:35273415-35273437 CAAAATGAAAAGTTGGGGCAAGG - Intronic
1039424042 8:37471010-37471032 CAAGACAAATAGGTGGGCCCTGG - Intergenic
1039551125 8:38443756-38443778 CAAAAGAATTAGATGGCGCTGGG + Intronic
1039633212 8:39134858-39134880 AAAAAGATAAAGATGGGGCCTGG + Intronic
1040955945 8:52980079-52980101 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1040957663 8:52995960-52995982 CAAAAGAAAGAGAAAGGGCCTGG - Intergenic
1041038370 8:53819234-53819256 AAAAATATATACATTGGGCCAGG + Intronic
1041210937 8:55550136-55550158 CAAAATACAGAGATAGGTCCTGG - Intergenic
1041239482 8:55837206-55837228 CTAAATAAATAAATATGGCCTGG + Intergenic
1041261300 8:56022624-56022646 AAAAATAAATAGCTGGGGGCCGG - Intergenic
1041908420 8:63059847-63059869 AAAAATAAATAAATAGGCCCCGG - Exonic
1042041181 8:64591890-64591912 AAAAATGAAAAGATGGGGGCGGG + Intronic
1042412960 8:68485416-68485438 AAAAATTAAGAGATCGGGCCAGG + Intronic
1042540463 8:69902689-69902711 AAAAATAAACAAATGGGGCTGGG - Intergenic
1042555360 8:70029782-70029804 CAAAATAAGGAAATAGGGCCAGG - Intergenic
1042999868 8:74744798-74744820 GAAAATAAAACAATGGGGCCAGG + Intronic
1043068856 8:75612778-75612800 CTATATAAATAGATGGGGTTGGG - Intergenic
1043425392 8:80143040-80143062 GGAATTAAATAGATGGGGTCTGG + Intronic
1043470045 8:80553289-80553311 TAAAACACATAGATGAGGCCGGG + Intergenic
1043538461 8:81232271-81232293 CCAAATAAATACCTGGGGCTGGG - Intergenic
1044389987 8:91638734-91638756 CATAAAAATTAGATGGGGCTGGG - Intergenic
1044641775 8:94390202-94390224 AAAAATAAATAAAAAGGGCCAGG + Intronic
1044704969 8:94999710-94999732 AAAAATAAATAGAATGGGCCCGG - Intronic
1044738049 8:95299248-95299270 CAAAGTAAATAGATCAGGCAGGG - Intergenic
1044980401 8:97710702-97710724 AAAAAAAAATAGATAAGGCCGGG + Intronic
1045713519 8:105014565-105014587 AAAAATATAAAGTTGGGGCCGGG - Intronic
1046522404 8:115342175-115342197 GAAGATAAAGATATGGGGCCGGG - Intergenic
1047279876 8:123435870-123435892 TAAAAAAAATATGTGGGGCCAGG + Intronic
1048134325 8:131732764-131732786 CAAAGTATAAAGAAGGGGCCAGG + Intergenic
1048334485 8:133492423-133492445 CAAAGTGAAGAAATGGGGCCAGG + Intronic
1048667911 8:136684857-136684879 TCAAATAAAGAAATGGGGCCGGG - Intergenic
1049972681 9:835303-835325 AAAAATAAATAAATAAGGCCGGG - Intergenic
1050624288 9:7486868-7486890 CAAAATAAAAACGGGGGGCCAGG + Intergenic
1051011467 9:12419370-12419392 CACAAGAAAAAGAAGGGGCCAGG - Intergenic
1051038817 9:12781264-12781286 AAAAATAACTAAAAGGGGCCGGG - Intronic
1051275651 9:15395444-15395466 TAAAAAAATTAGCTGGGGCCAGG + Intergenic
1052426745 9:28314687-28314709 AAAGATAAATATATGAGGCCGGG + Intronic
1053257538 9:36630947-36630969 AAAAAAAAAGAGCTGGGGCCAGG - Intronic
1053402197 9:37835281-37835303 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1053435783 9:38073225-38073247 TAAAAGAAGTAGATGAGGCCGGG - Intergenic
1053837559 9:42157129-42157151 TTAAATAAAAAGATAGGGCCGGG - Intergenic
1053883469 9:42619028-42619050 TAAAATAAAAAGATAGGGCCGGG + Intergenic
1053889200 9:42675271-42675293 TAAAATAAAAAGATAGGGCCGGG - Intergenic
1054222489 9:62426495-62426517 TAAAATAAAAAGATAGGGCCGGG + Intergenic
1054228221 9:62482677-62482699 TAAAATAAAAAGATAGGGCCGGG - Intergenic
1054777850 9:69138916-69138938 CAAAAAAAATAAAGGGGGCTGGG + Intronic
1054822345 9:69535739-69535761 AAAATTCAATAGAGGGGGCCTGG - Intronic
1054862362 9:69967083-69967105 AAAAATAAATAAATAAGGCCGGG - Intergenic
1055002720 9:71470958-71470980 GAAAATACTTAGAGGGGGCCAGG - Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1055160206 9:73117462-73117484 CAAAATAACTACATGGAGACTGG + Intergenic
1055472608 9:76628239-76628261 CAAAATAAATACTTGGAGCTGGG - Intronic
1055652900 9:78424306-78424328 CAAAATAACTAGAAGAGGCTGGG - Intergenic
1055875163 9:80933373-80933395 CATAATAAAAAGCTGGGCCCTGG - Intergenic
1055949304 9:81715712-81715734 AAAAATAAATAAGTAGGGCCAGG - Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056149855 9:83775000-83775022 AAAAAAAAAAAGAAGGGGCCGGG - Intronic
1057237729 9:93378540-93378562 CAAAATAATTACATCAGGCCAGG + Intergenic
1057602305 9:96469469-96469491 CAAAATATAGACATGGGCCCTGG + Intronic
1057814171 9:98281843-98281865 AAAAAAAAATAGAGAGGGCCAGG - Intergenic
1058030837 9:100195781-100195803 TAAAATCAATTGATGTGGCCAGG - Intronic
1058077313 9:100664010-100664032 TAAAATAAATAAAGAGGGCCAGG - Intergenic
1058219793 9:102284315-102284337 AAAGATAAATAGATTGGCCCAGG - Intergenic
1058396021 9:104555485-104555507 CAAAATAGACAAATGGGGCTAGG + Intergenic
1058520464 9:105810471-105810493 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1058546242 9:106063027-106063049 GAAAATAAATATCTGGGGGCCGG + Intergenic
1058697729 9:107573987-107574009 AAAAATAATTAGCTGGGGCCAGG - Intergenic
1059303500 9:113334852-113334874 AAAAATAAATAAATGAGGCCAGG - Intronic
1059782225 9:117541969-117541991 GAAAATAAATAAAGGGGACCAGG - Intergenic
1060330052 9:122659869-122659891 CAAAAAAAGTGGTTGGGGCCGGG - Intergenic
1060335659 9:122719315-122719337 AAAAATAAAAACATGGGCCCAGG + Intergenic
1060364884 9:123001141-123001163 AAAAATAAAAAAATAGGGCCAGG - Intronic
1060507734 9:124210551-124210573 AAAAATAAATAAAATGGGCCAGG - Intergenic
1061006801 9:127932859-127932881 AAAAATACAAAAATGGGGCCGGG - Intergenic
1061145511 9:128795753-128795775 AAAAAAAATTAGTTGGGGCCAGG - Intronic
1061317491 9:129805433-129805455 AAAAAAAAAAAGATGGAGCCTGG + Intronic
1061320489 9:129825182-129825204 AAAAATAAAAAGCTGAGGCCAGG - Intergenic
1061852238 9:133423069-133423091 AAAAAGAGATGGATGGGGCCGGG - Intronic
1061997714 9:134195196-134195218 AAAAAAAAAAAAATGGGGCCGGG - Intergenic
1062061599 9:134499625-134499647 AAAAATAAATACATACGGCCGGG - Intergenic
1062551292 9:137087850-137087872 CAAAATAAATAGAGCTGGCCGGG + Intronic
1185592850 X:1289120-1289142 CTAAATACATAGATGTGGCCTGG - Intronic
1185714486 X:2330225-2330247 AAAAAAAAGTAGAAGGGGCCAGG + Intronic
1185778419 X:2824649-2824671 CAAAATCAAAAGATGGGGTGAGG + Intergenic
1185793056 X:2942257-2942279 ACAAATAAATAAATGGGTCCAGG - Intronic
1185827253 X:3263983-3264005 CAGCATATAGAGATGGGGCCAGG - Intergenic
1186220208 X:7342106-7342128 CAATAAAAATTGTTGGGGCCAGG - Intronic
1186488946 X:9956377-9956399 AAAAATAAATAAATAGGGCCGGG - Intergenic
1186576514 X:10771802-10771824 AAAAATAGATAAATGTGGCCGGG - Intronic
1186714005 X:12231209-12231231 CAAAATATTTATTTGGGGCCTGG - Intronic
1186746073 X:12570597-12570619 GAAAATAAATACATGTGGCCAGG - Intronic
1187497962 X:19812677-19812699 AAAAAAAAATAGCTGGGGCTGGG + Intronic
1187681052 X:21768314-21768336 AAAAATAACTAGATCTGGCCAGG + Intergenic
1188814275 X:34692006-34692028 CAAAAGAAAAAGACTGGGCCGGG - Intergenic
1188829286 X:34876630-34876652 ATAAATAAATAGATTTGGCCAGG + Intergenic
1189433563 X:40970935-40970957 AAAAAAAATTAGCTGGGGCCGGG - Intergenic
1189507183 X:41623705-41623727 CAAAAAAAAGAAAAGGGGCCAGG - Intronic
1189803684 X:44714927-44714949 CAAAAAGAATATATGGGGCACGG - Intergenic
1190271307 X:48865950-48865972 CAAAATACAAAGATGGGGCCGGG + Intergenic
1190408432 X:50110902-50110924 TAAAATAAACATATTGGGCCAGG + Intergenic
1190759103 X:53424896-53424918 AAAAAAAATTAAATGGGGCCAGG + Intronic
1190829185 X:54044816-54044838 CAAAATTAATAGGTGGCGGCGGG + Intronic
1190835403 X:54095949-54095971 TAAAATTAAAAGATGTGGCCTGG - Intronic
1190859042 X:54326383-54326405 AAAAATATATTAATGGGGCCTGG - Intronic
1191142500 X:57131378-57131400 CAAAAGAAATAGACCCGGCCGGG - Intergenic
1191832157 X:65427622-65427644 CAAAATAGAGGGATGGGGCTGGG - Intronic
1192063981 X:67861640-67861662 CAAAATAGATAGACCAGGCCAGG - Intergenic
1192466281 X:71358769-71358791 AAAAATAAAAAGGAGGGGCCAGG - Intergenic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192704990 X:73519803-73519825 CTTAATAAATGAATGGGGCCAGG - Intergenic
1193111526 X:77735115-77735137 ATAAATAAATAAATGGTGCCGGG + Intronic
1193115589 X:77772334-77772356 CAAAATAGAAAAATGAGGCCAGG + Intronic
1193378345 X:80788265-80788287 CAATTTAAAAAGATGGGGGCAGG + Intronic
1193396367 X:80988494-80988516 CAAAATAAAGGGATGGGATCTGG + Intergenic
1193410983 X:81162619-81162641 CAACATAAAATTATGGGGCCAGG - Intronic
1194449448 X:94026508-94026530 AAAAATAAATAGTTTAGGCCAGG - Intergenic
1195385968 X:104313845-104313867 AAAAAAAAATAGCTGGGGCGTGG - Intergenic
1195640739 X:107172026-107172048 AGAAATAAAAAGATGAGGCCAGG + Intronic
1195700774 X:107703996-107704018 AAAAATAAATTTCTGGGGCCAGG - Intergenic
1196780432 X:119378675-119378697 CAAAATACCTAGAAGAGGCCGGG + Intergenic
1196831336 X:119777934-119777956 AAAAATATATAAATGTGGCCGGG + Intergenic
1196860319 X:120020997-120021019 CAAAATAAATAAATAAGGCCGGG - Intergenic
1196883415 X:120221089-120221111 ATAAATAAATAAATAGGGCCAGG + Intergenic
1197186623 X:123594215-123594237 CAAAGTGCTTAGATGGGGCCTGG - Intergenic
1197692177 X:129514030-129514052 TAAAATACAAATATGGGGCCAGG + Intronic
1197945512 X:131834767-131834789 CAAAATAAATAAAAGAGGCCGGG + Intergenic
1198011926 X:132565411-132565433 GAAAAGAAATAGGTGGGGTCTGG + Intergenic
1198167856 X:134074792-134074814 GAATATAAATAGATGGGTCATGG + Intergenic
1198176827 X:134164647-134164669 CAAAAAAAAAAGAGGGTGCCTGG + Intergenic
1198371831 X:135997059-135997081 AAAAATAAATGAATGAGGCCAGG - Intronic
1198552073 X:137755796-137755818 TAAAATAGGTAGATGTGGCCAGG - Intergenic
1199566990 X:149225682-149225704 TAAAATAAATGTGTGGGGCCAGG + Intergenic
1200333115 X:155319243-155319265 CAAAAGAAATAACTGGGGGCTGG + Intronic
1200439909 Y:3199761-3199783 GAAAATAAATAGACCGGGCGCGG - Intergenic
1201773578 Y:17641802-17641824 AAAAAAAAAAAGATGAGGCCAGG - Intergenic
1201827977 Y:18264184-18264206 AAAAAAAAAAAGATGAGGCCAGG + Intergenic
1201894772 Y:18981699-18981721 AAAAACAAATAGATTTGGCCAGG - Intergenic
1202579589 Y:26365858-26365880 CAGTAGAGATAGATGGGGCCTGG + Intergenic