ID: 954221107

View in Genome Browser
Species Human (GRCh38)
Location 3:49154474-49154496
Sequence TGGAATTATCACCATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954221107_954221111 -9 Left 954221107 3:49154474-49154496 CCTTCCCCATGGTGATAATTCCA No data
Right 954221111 3:49154488-49154510 ATAATTCCACTTCTGTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954221107 Original CRISPR TGGAATTATCACCATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr