ID: 954225120

View in Genome Browser
Species Human (GRCh38)
Location 3:49176273-49176295
Sequence CCGGAGCGCAGGAGTTCAAG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954225120 Original CRISPR CCGGAGCGCAGGAGTTCAAG TGG Exonic
901417348 1:9127093-9127115 CTTGAGCCCAGGAGTTCAACTGG - Intronic
904175197 1:28622802-28622824 CCTGAGGTCAGGAGTTCGAGAGG + Intronic
904285024 1:29448582-29448604 CTGGAGTGCAGGAGCTGAAGTGG - Intergenic
904373200 1:30063751-30063773 CCGGTGGGCAGGTCTTCAAGTGG + Intergenic
907388990 1:54144361-54144383 CTTGATCCCAGGAGTTCAAGGGG - Exonic
908225048 1:62047466-62047488 CACGAGGTCAGGAGTTCAAGTGG - Intronic
911624399 1:100104676-100104698 CCTGAGGTCAGGAGTTCAAGAGG - Intronic
912082876 1:105958943-105958965 CCTGAGGTCAGGAGTTCTAGAGG - Intergenic
913274514 1:117123845-117123867 CCTGAGGTCAGGAGTTCGAGAGG - Intergenic
914699141 1:150114677-150114699 CTTGAGCCCAGGAATTCAAGAGG + Intronic
914759337 1:150585907-150585929 CTTGAGCCCAGGAGTTTAAGAGG - Intergenic
914818298 1:151079681-151079703 CCTGAGGTCAGGAGTTCGAGGGG + Intronic
915638200 1:157200911-157200933 ACGCAGCGCAAGAGTTCAAAAGG - Intergenic
916854941 1:168739569-168739591 CTTGAGGTCAGGAGTTCAAGAGG + Intergenic
917347533 1:174043736-174043758 TTTGAGCCCAGGAGTTCAAGAGG - Intergenic
918336798 1:183523717-183523739 CCTGAGCCCAAGAGTTTAAGTGG - Intronic
919619657 1:199850459-199850481 CAGGAGCCCAGGAATGCAAGAGG - Intergenic
923332324 1:232936550-232936572 CTTGAGGTCAGGAGTTCAAGAGG + Intergenic
1062880939 10:977359-977381 CTTCAGCCCAGGAGTTCAAGAGG - Intergenic
1065583754 10:27197845-27197867 CCTGAGGTCAGGAGTTCAAATGG - Intronic
1065949794 10:30641489-30641511 CCTGAGGTCAGGAGTTCGAGAGG + Intergenic
1066402893 10:35092169-35092191 CTTGAGCTCAGGAGTTCCAGAGG - Intergenic
1068871558 10:61950450-61950472 CTTGAGGCCAGGAGTTCAAGAGG + Intronic
1069068112 10:63966525-63966547 CAGGAGCTCAGGAGTTCCATGGG + Intergenic
1069931351 10:71884022-71884044 CCTGAGGTCAGGAGTTCAGGTGG - Intergenic
1069945747 10:71984328-71984350 CCCGAGCACAGGAGCTCAAAAGG - Intronic
1071028329 10:81141581-81141603 CTTGAGCCCAGGAGTTCAAGAGG - Intergenic
1071346399 10:84698002-84698024 CACGAGGTCAGGAGTTCAAGAGG + Intergenic
1073122024 10:101127786-101127808 CCAGATCTGAGGAGTTCAAGAGG + Intronic
1073499492 10:103922948-103922970 CTGGAGGGCAGTAGTTAAAGGGG - Intergenic
1073579983 10:104656438-104656460 CCTGAGCCCAGGAGTTTGAGAGG + Intronic
1077661640 11:4073877-4073899 CAGAAGCTCAGGAGTCCAAGAGG + Intronic
1078235940 11:9484710-9484732 CTGGAGGTCAGGAGTTCAACTGG - Intronic
1083577585 11:63803382-63803404 CTTGAGCTCAGCAGTTCAAGTGG + Intergenic
1083944668 11:65917296-65917318 ACAGAGGGCAGAAGTTCAAGGGG + Exonic
1084120698 11:67067283-67067305 CTGGAGCAGAGGAATTCAAGGGG - Intronic
1084424434 11:69076877-69076899 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424493 11:69077068-69077090 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424503 11:69077101-69077123 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1089814019 11:121156558-121156580 CCGGAGGTCAGGAGTTTGAGAGG - Intronic
1091079480 11:132653401-132653423 CCGCAGAGCAGGAGCTAAAGCGG - Intronic
1092570841 12:9719652-9719674 CTTGAGCCCAGGAGTTCAAGTGG + Intronic
1092790702 12:12068482-12068504 CTTGAGCCTAGGAGTTCAAGGGG - Intronic
1093121674 12:15278225-15278247 CCTGAGGGCTGAAGTTCAAGGGG - Intronic
1093762858 12:22929686-22929708 CAGGAGCCCAGGAGCGCAAGAGG - Intergenic
1094125245 12:27016468-27016490 CTTGAGCCCAGGAGTTCAAGAGG + Intergenic
1094388870 12:29926876-29926898 CCTGGGTCCAGGAGTTCAAGAGG - Intergenic
1094613156 12:32012874-32012896 CTTGAACTCAGGAGTTCAAGTGG + Intergenic
1096784580 12:54009742-54009764 CTGGAGCGCGGGAGACCAAGGGG - Intronic
1097209352 12:57354084-57354106 CCTGAGGTCAGGAGTTCAAGAGG - Intronic
1097815586 12:64069951-64069973 CTTGAGCCCAGGAGTTCAACCGG - Intronic
1102035148 12:109766717-109766739 GCAGAGCACAGGAGTTCCAGTGG - Intronic
1102672875 12:114634733-114634755 CTTGAGTCCAGGAGTTCAAGAGG + Intergenic
1104130769 12:125891734-125891756 CCTGAGGTCGGGAGTTCAAGAGG + Intergenic
1108758483 13:53532797-53532819 CAGGAGCCAAGGAGTGCAAGTGG + Intergenic
1117360139 14:54964746-54964768 CTTGAGCCCAGGAGTTCAAGGGG - Intronic
1118009943 14:61600696-61600718 CTGGAGCCCAGGAGTTCTCGAGG + Intronic
1118287438 14:64489028-64489050 TCTGAGGTCAGGAGTTCAAGAGG + Intronic
1119131115 14:72174065-72174087 CAGGAGTGCAGGAGCACAAGGGG - Intronic
1119258180 14:73218002-73218024 CTTGAGGTCAGGAGTTCAAGAGG - Intronic
1119284746 14:73443860-73443882 CTTGAGCTCAGGAGTTCGAGAGG - Intronic
1124502216 15:30238740-30238762 CCTGAGGTCAGGAGTTCAAGAGG - Intergenic
1124741347 15:32299912-32299934 CCTGAGGTCAGGAGTTCAAGAGG + Intergenic
1125499563 15:40230960-40230982 CTGGAGCTCAGAAGTTCATGCGG + Intergenic
1125570027 15:40709588-40709610 CTTGAGATCAGGAGTTCAAGAGG - Intronic
1128201638 15:65813867-65813889 CTTGAGCCCAGGAGCTCAAGAGG + Intronic
1129062210 15:72869132-72869154 CCAGAGAGCAGGAGGTCAAGGGG - Intergenic
1130846666 15:87753999-87754021 CCTGAGGTCAGGAGTTCAAGTGG - Intergenic
1130976745 15:88782362-88782384 GAGGAGTGCAGGAGTTCAGGGGG + Intergenic
1132080899 15:98864600-98864622 CTTGAGGCCAGGAGTTCAAGAGG - Intronic
1133962689 16:10508370-10508392 CTTGAGGTCAGGAGTTCAAGAGG - Intergenic
1133979704 16:10624055-10624077 CTTGAGGCCAGGAGTTCAAGAGG + Intergenic
1134171924 16:11976143-11976165 CCTGAGGTCAGGAGTTCGAGAGG - Intronic
1135347540 16:21701851-21701873 CCTGAGGTCAGCAGTTCAAGAGG - Intronic
1137299418 16:47133357-47133379 CTTGAGCCCAGGAGTTCCAGAGG + Intronic
1139165469 16:64560233-64560255 CCTGAGATCAGGAGTTCGAGAGG - Intergenic
1140707784 16:77646973-77646995 CTTGAGCTCAGGAGGTCAAGTGG - Intergenic
1141751822 16:85963312-85963334 CTTGAGCCCAGGAGGTCAAGGGG + Intergenic
1142203242 16:88770953-88770975 CCTGAGCGCAGGGGATTAAGAGG + Intronic
1142632212 17:1232409-1232431 CTTGAGCCCAGGAGTTCAAGAGG - Intergenic
1143099818 17:4498917-4498939 CCGGAGCGCAGGAGCCGACGGGG + Exonic
1144630944 17:16872161-16872183 CAGGATCTCAGGAGCTCAAGAGG - Intergenic
1144691552 17:17269106-17269128 CCAGAGGTCAGGAGTTCTAGAGG + Intronic
1148059876 17:44829525-44829547 CCGGGAGGCAGGAGTTCCAGCGG + Intronic
1148464884 17:47858989-47859011 CCTGAGGCCAGGAGTTCTAGAGG - Intergenic
1149260382 17:54874053-54874075 CTTGAGCCCAGGAGTTCAAGGGG - Intergenic
1150066883 17:62117659-62117681 CCTGAGGTCAGGAGTTCAGGAGG + Intergenic
1150286382 17:63956566-63956588 CTGGAGCAGAGGAGGTCAAGAGG + Intronic
1150702719 17:67461703-67461725 CTTGAGAGCAGGAGTTCAAGAGG + Intronic
1151433551 17:74080713-74080735 CCTGAGCGCAGGAGTCCAAAAGG + Intergenic
1152094551 17:78265658-78265680 CCTGAGGTCAGGAGTTCGAGAGG - Intergenic
1154121025 18:11652820-11652842 GCTGAGGTCAGGAGTTCAAGGGG - Intergenic
1155168724 18:23251234-23251256 CCTGAAGTCAGGAGTTCAAGAGG + Intronic
1155289911 18:24330638-24330660 CCTGAGGTCAGGAGTTCAAGTGG - Intronic
1156552989 18:38037919-38037941 CCTGAGCTCAGGAGTTCAAGAGG - Intergenic
1157366662 18:47071214-47071236 CTTGAGCCCAAGAGTTCAAGAGG - Intronic
1157651119 18:49332401-49332423 CTGGAGTTCAAGAGTTCAAGTGG - Intronic
1158060010 18:53328783-53328805 CCTGAGGTCAGGAGTTCAAGAGG - Intronic
1158612914 18:58959466-58959488 CTTGAGCCCAGGAGTTCAACTGG - Intronic
1159852567 18:73543131-73543153 CCTGAGCCCAGGAGTTCAGGGGG - Intergenic
1161236356 19:3200163-3200185 CCTGAGGTCAGGAGTTCAAGAGG - Intronic
1161690266 19:5728471-5728493 CTTGAGCACAGGAGTTCGAGGGG + Intronic
1162411931 19:10511389-10511411 CTTGAGCACAGGAGTTCAGGAGG + Intergenic
1162414081 19:10523969-10523991 CCTGAGGTCAGGAGTTCGAGAGG - Intergenic
1162919888 19:13894627-13894649 CTTGAGCCCAGGAGTTCAAGAGG - Intronic
1163549806 19:17959758-17959780 CCCGAGTGAAAGAGTTCAAGAGG + Intronic
1163791221 19:19307131-19307153 CTTGAGCCCAGGAGTTCAGGAGG - Intronic
1165504453 19:36216422-36216444 CCTGAGATCAGGAGTTCGAGAGG + Intronic
1165800855 19:38548796-38548818 TTGGAGCCCAAGAGTTCAAGAGG - Intronic
1167516219 19:49924574-49924596 CCCCAGCTCAGGAGTTGAAGGGG + Intronic
925991627 2:9259500-9259522 CCAGGGAGCAGGAGTACAAGAGG - Intronic
928016498 2:27663002-27663024 CTTGAGCCCAGGAGTTCCAGAGG - Intronic
930649451 2:53950196-53950218 CTGGAGCCCAGGAAGTCAAGGGG + Intronic
933803230 2:85979683-85979705 CCTGAGCTCGGGTGTTCAAGTGG + Intergenic
934496397 2:94804619-94804641 CAGGAGCACAGGAGCTGAAGCGG - Intergenic
935396934 2:102619464-102619486 CCGCAGGGCAGGAGGACAAGGGG - Intergenic
936973153 2:118193859-118193881 CCTGAGGTCAGGAGTTCAAGAGG - Intergenic
938831608 2:135055459-135055481 CTTGAGCTCAGGAGTTCAAGAGG + Intronic
940916030 2:159257080-159257102 CCTGAGCCCAGGAGGTCATGAGG - Intronic
944765989 2:202864800-202864822 CCTGAGATCAGGAGTTCCAGAGG + Intronic
946227317 2:218270833-218270855 CTGGAGCGCGGGAGTCCAACAGG - Intronic
1173213751 20:41059522-41059544 CTTGAGCCCAGGAGTTCGAGAGG + Intronic
1173515868 20:43665426-43665448 CTTGAGCCCAGGAGTTCGAGGGG - Intergenic
1179532875 21:42032142-42032164 CCCAAGGGCAGGAGTTTAAGAGG + Intergenic
1180001674 21:44998056-44998078 CTGGGGCGCAGGAGGTCCAGAGG - Intergenic
1182016708 22:27046383-27046405 CCATAGGCCAGGAGTTCAAGAGG + Intergenic
1184261297 22:43318300-43318322 CCTGAGCCCAGGAGTTCCAGAGG + Intronic
1184611027 22:45603184-45603206 CTGGAGAGCATGAGTGCAAGAGG + Intergenic
1184858592 22:47160509-47160531 CCGGAGCCCAGGTGTCCACGTGG - Intronic
951147076 3:19240394-19240416 CCTGAGGTCGGGAGTTCAAGAGG + Intronic
951550310 3:23870586-23870608 AGTGAGCTCAGGAGTTCAAGTGG + Intronic
954225120 3:49176273-49176295 CCGGAGCGCAGGAGTTCAAGTGG + Exonic
955821331 3:62899066-62899088 CTTGAGCCCAGGAGTTCAAAGGG + Intergenic
957482194 3:80812910-80812932 CTTGAGGCCAGGAGTTCAAGAGG + Intergenic
961038064 3:123656846-123656868 CAGGAGCATAGGAGTTCAAGCGG - Intronic
963560191 3:146855131-146855153 CCTGAGGTCAGGAGTTCAAGAGG + Intergenic
964362148 3:155909731-155909753 CTTGAGCCCAGGAGTTCAACAGG + Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
966110731 3:176398275-176398297 CTTGAGCCCAGGAGTTTAAGAGG + Intergenic
968644758 4:1734860-1734882 CTTGAGCCCAGGAGTTCAACAGG - Intronic
969203422 4:5623554-5623576 CTTGAGGTCAGGAGTTCAAGAGG - Intronic
979896317 4:126162331-126162353 CAGGAAGGCAGGAGATCAAGTGG + Intergenic
980914544 4:139021973-139021995 CCTGAGGTCAGGAGTTCGAGAGG - Intronic
985864892 5:2506967-2506989 CCGGAGAGCAGGTGTTCCTGGGG - Intergenic
985992420 5:3574676-3574698 CTGGAGCTCAGGATGTCAAGGGG + Intergenic
988592269 5:32558927-32558949 CTTGAGGCCAGGAGTTCAAGAGG + Intronic
990975398 5:61556177-61556199 CTAGAGCCTAGGAGTTCAAGGGG + Intergenic
990977566 5:61572926-61572948 CTGGAGCGCAGGAGTGGCAGGGG + Intergenic
992670005 5:79050038-79050060 CCTGAGGTCAGGAGTTCGAGAGG + Intronic
995079244 5:108028581-108028603 CCAGAGCACAGGGGTTAAAGAGG - Intronic
995786722 5:115838870-115838892 CTTGAGGTCAGGAGTTCAAGAGG + Intronic
997287370 5:132690307-132690329 CTTGAACCCAGGAGTTCAAGGGG + Intergenic
998039047 5:138939633-138939655 CCTGAGGTCAGGAGTTCCAGAGG - Intergenic
998555067 5:143115114-143115136 CCTGAGGTCAGGAGTTCGAGAGG + Intronic
1000318567 5:160116271-160116293 CTTGAGCGCAGGAGTTCCAGAGG - Intronic
1004947222 6:20629492-20629514 GCAGAGCACAGGAATTCAAGAGG - Intronic
1005596373 6:27382113-27382135 CCTGAGATCAGGAGTTCGAGAGG + Intronic
1006959138 6:37909494-37909516 CCTGAGGTAAGGAGTTCAAGAGG - Intronic
1015758857 6:136635797-136635819 CTTGAGCCCAGGAGGTCAAGAGG + Intronic
1018322322 6:162624735-162624757 CTTGAGGCCAGGAGTTCAAGAGG - Intronic
1019796335 7:3051819-3051841 CTTGAGGCCAGGAGTTCAAGAGG + Intergenic
1023196830 7:37649982-37650004 CCTGAGTCCAGGAGTTCAAGAGG - Intergenic
1023973712 7:45011411-45011433 CCTGAGGTCAGGAGTTCGAGAGG - Intronic
1025630587 7:63269006-63269028 CCTGAGGTCAGGAGTTCGAGAGG + Intergenic
1026158310 7:67846929-67846951 TTTGAGCCCAGGAGTTCAAGAGG - Intergenic
1026589491 7:71682782-71682804 CCTGAGATCAGGAGTTCCAGAGG - Intronic
1029469330 7:100744247-100744269 CAGGAGTGCAGGAGTCCAAGTGG - Intronic
1029648872 7:101876828-101876850 CTTGAGGTCAGGAGTTCAAGAGG - Intronic
1031940604 7:127785000-127785022 CAGGAGCTGAGGAGGTCAAGAGG - Intronic
1034765753 7:153719776-153719798 CCTGAGGTCAGGAGTTCGAGAGG + Intergenic
1035287988 7:157818530-157818552 CCTGAGCCAAGGAGTTCAGGTGG + Intronic
1035536276 8:393637-393659 CTGGAGTGCAGGAGCTCAAAGGG - Intergenic
1035749642 8:1987539-1987561 CCGGAGCGCAGGGGTGCTTGGGG - Intronic
1037441167 8:18917709-18917731 CCTGAGAGCAGGAATGCAAGGGG - Intronic
1038801771 8:30755672-30755694 CTTGAGCCCAGGAGGTCAAGAGG + Intronic
1041250074 8:55925202-55925224 CCTGAGCCCAGGAGTTTGAGGGG - Intronic
1041915409 8:63133950-63133972 CTCGAGGCCAGGAGTTCAAGAGG - Intergenic
1042539191 8:69890828-69890850 CCTGAGGTCAGGAGTTCAGGGGG + Intergenic
1046225024 8:111267193-111267215 CTTGAGTCCAGGAGTTCAAGAGG + Intergenic
1046324898 8:112629281-112629303 CCTGAGCCCAGGAGTTCAAGGGG - Intronic
1046626086 8:116578279-116578301 CTAGAGCCCAGGAGTTCCAGAGG + Intergenic
1049393795 8:142387075-142387097 CCGAAACCCAGAAGTTCAAGAGG + Intronic
1050323850 9:4480937-4480959 CCGGACCTCGGGGGTTCAAGTGG + Intergenic
1053660746 9:40275828-40275850 CAGGAGCACAGGAGCTGAAGCGG + Intronic
1053911124 9:42905173-42905195 CAGGAGCACAGGAGCTGAAGTGG + Intergenic
1054372870 9:64422044-64422066 CAGGAGCACAGGAGCTGAAGCGG + Intergenic
1054523864 9:66100456-66100478 CAGGAGCACAGGAGCTGAAGCGG - Intergenic
1054680498 9:67911821-67911843 CAGGAGCACAGGAGCTGAAGCGG + Intergenic
1057190420 9:93084142-93084164 CTGGGGAGCAGGAGGTCAAGGGG - Intronic
1057583250 9:96306334-96306356 CCTGAGGTCAGGAGTTCTAGAGG + Intergenic
1061000345 9:127899198-127899220 CCGGAGTGCAGGAGTTGGGGAGG - Intronic
1062235780 9:135506918-135506940 CCGGAGAGCAGAAGGTCAGGTGG + Intergenic
1185663902 X:1749240-1749262 CTTGAGCCCAGGAGTTCAAGGGG - Intergenic
1186545683 X:10446768-10446790 CCAGAGCCCAGGAGTTCAGAAGG - Exonic
1195526498 X:105896621-105896643 CTTGAGACCAGGAGTTCAAGAGG + Intronic
1196424622 X:115557875-115557897 CCTGAGGTCAGGAGTTCGAGAGG + Intergenic
1200169002 X:154058456-154058478 GCGGAGGTCAGGAGTCCAAGAGG - Intronic
1201918078 Y:19204137-19204159 CCTGAGGCCAGGAGTTTAAGAGG + Intergenic