ID: 954226836

View in Genome Browser
Species Human (GRCh38)
Location 3:49187388-49187410
Sequence AGGGCTAAGGGCCCCTGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954226836 Original CRISPR AGGGCTAAGGGCCCCTGTGG AGG Intronic
900411151 1:2513305-2513327 AGGGCTGTGGGTACCTGTGGGGG - Intronic
900436071 1:2631911-2631933 AGGCCCCTGGGCCCCTGTGGTGG - Intronic
900510060 1:3054595-3054617 GGGGCTACGGGCCTCTTTGGGGG - Intergenic
901944444 1:12690304-12690326 AGAACAAAGGGCCACTGTGGAGG + Intergenic
902940898 1:19799738-19799760 AGGGCAAAGGGCCCCGGGGCTGG + Intronic
903229150 1:21911434-21911456 AGGGCCAAGGGCCCCAGAGCAGG + Intronic
903995158 1:27300875-27300897 AGGGCTTGGGGAGCCTGTGGTGG + Intronic
904566143 1:31429460-31429482 AGGGCTATGAGACCCAGTGGTGG + Exonic
904920759 1:34006233-34006255 AGGACTAAGGGACCCTGATGAGG - Intronic
904990934 1:34591979-34592001 AGTGATAAGGCCCCTTGTGGAGG - Intergenic
905145205 1:35882969-35882991 AGGGCTGAAGGCTGCTGTGGCGG + Intronic
906016704 1:42588278-42588300 AGTGCTAATGGCCCTTGTAGGGG + Intronic
915626526 1:157117466-157117488 AGAGCTAAGGGCCAGTGAGGGGG - Intergenic
919813580 1:201424059-201424081 AGGGCTAAGACCTCCAGTGGCGG - Intronic
922705794 1:227789402-227789424 AGGGCAAAGGGCAACTGGGGCGG - Intergenic
922885829 1:229019815-229019837 AGGGGTCAGGTCCCCAGTGGTGG - Intergenic
922913806 1:229239402-229239424 AGGGCAAAGGGCCAGTGTGATGG + Intergenic
923020027 1:230155964-230155986 AGTGCTAAGGGCCTGTGTGGTGG + Intronic
923064747 1:230507556-230507578 AGGGCTTAGGGCCACAGTTGGGG + Intergenic
923591890 1:235327502-235327524 AGGGCCGAGGGCCCCGGAGGCGG + Intronic
924359213 1:243218361-243218383 AGGGGCAAGGGCCCCAGTGGAGG + Intronic
1063941310 10:11132788-11132810 AGGCCTAAGGGTCCATTTGGTGG - Intronic
1066256105 10:33680187-33680209 AGTGCTAGGGCCCCCTGTGATGG - Intergenic
1069765869 10:70858890-70858912 AGTGCTAAGGGACCCTGAAGAGG - Intronic
1069895035 10:71675206-71675228 AGGGCCAAGGACCACTGCGGAGG - Intronic
1071018634 10:81027311-81027333 TGGGCAAAGAGCCCCTGTGATGG + Intergenic
1073453811 10:103624700-103624722 AGGGCTCAGGGCACCTATGATGG + Intronic
1073491210 10:103854825-103854847 AGCGCCCAGGGCCCCTGGGGAGG + Intronic
1075263190 10:120980151-120980173 GGGGCTGAGGGGCCCTATGGGGG + Intergenic
1077269349 11:1667765-1667787 AGGCCTGCTGGCCCCTGTGGTGG + Intergenic
1082532356 11:54132167-54132189 AGGGCTTTGGGGCCTTGTGGTGG + Intergenic
1082908086 11:58334690-58334712 AGGGCTAAGCACCCTTGTTGGGG + Intergenic
1084273426 11:68040543-68040565 AGGGCCCAGGGCCCCTCTGTGGG - Intronic
1084308311 11:68300665-68300687 AGGGCGAGGTCCCCCTGTGGTGG - Intergenic
1085817947 11:79760979-79761001 AGGGCAATGGTGCCCTGTGGAGG - Intergenic
1091467175 12:694830-694852 AGGGGTAAGACCTCCTGTGGGGG - Intergenic
1091659780 12:2374666-2374688 ATGGCTAAGGGGCCCTGAGCTGG - Intronic
1092150790 12:6246953-6246975 AGGGATAAGGGACCCCGGGGTGG + Intergenic
1093005138 12:14043401-14043423 AGGGTCAAGGGCCTCTGTGCTGG - Intergenic
1094348699 12:29499197-29499219 AGGGCTTTGGGTCCATGTGGGGG - Intergenic
1096232480 12:49904053-49904075 AGGGCTAAGGGCGGCGGTGGGGG - Intronic
1100006335 12:89899887-89899909 AGCACACAGGGCCCCTGTGGAGG - Intergenic
1100735482 12:97524981-97525003 AGGGCTAAGGGCCTCTAATGGGG - Intergenic
1104748019 12:131221939-131221961 AGGGGTCAGGGCCCATGGGGAGG + Intergenic
1104896875 12:132168998-132169020 GGGGATAGGAGCCCCTGTGGTGG + Intergenic
1104955450 12:132463002-132463024 AGGGCTGAGCGCCCTTGTGCTGG - Intergenic
1105324251 13:19355758-19355780 ACGGCTGAGGGCAGCTGTGGTGG - Intergenic
1105869013 13:24487646-24487668 ACGGCTGAGGGCAGCTGTGGTGG + Intronic
1113102653 13:106736913-106736935 AGGACTCAGGGCTCCTGGGGAGG - Intergenic
1113485355 13:110648904-110648926 AGGGCAAAGTGCCCCTGGGAAGG + Intronic
1113634476 13:111910229-111910251 GGGGCTCATGGCCTCTGTGGAGG - Intergenic
1113694704 13:112336106-112336128 AGGTGTCAGGGCACCTGTGGAGG + Intergenic
1114552138 14:23538800-23538822 AGGGCTGGGGGCCTCTGTGAAGG + Intronic
1119198038 14:72732012-72732034 AGGGCCCAGGGCTCCTGAGGAGG + Intronic
1122279157 14:100610962-100610984 AGGGCTCATGGCCTCTGAGGGGG - Intergenic
1122637257 14:103135986-103136008 AGGGCTCAGGGCCCCATTGCAGG - Exonic
1122776414 14:104118815-104118837 AGGGCTGAGGGCCCATGCAGAGG - Intergenic
1123061520 14:105596866-105596888 AGGGCTTCGGGCCCCTGGAGTGG - Intergenic
1123085969 14:105717777-105717799 AGGGCTTCGGGCCCCTGGAGTGG - Intergenic
1123474987 15:20582886-20582908 AGGCCTGAGGGCCCCCCTGGTGG + Intergenic
1123577711 15:21689884-21689906 AGGGCTAAAGTCTCCTATGGAGG - Intergenic
1123614335 15:22132365-22132387 AGGGCTAAAGTCTCCTATGGAGG - Intergenic
1123643024 15:22417471-22417493 AGGCCTGAGGGCCCCCCTGGTGG - Intergenic
1128323383 15:66707523-66707545 AGGGCTAGGGGCCGCTGAGCCGG - Intronic
1129676932 15:77636781-77636803 AGGGCTGTGGGTCTCTGTGGTGG - Intronic
1130895756 15:88169394-88169416 AGAGGTTAGGGCCCTTGTGGAGG + Intronic
1202986580 15_KI270727v1_random:424129-424151 AGGGCTAAAGTCTCCTATGGAGG - Intergenic
1132807207 16:1780350-1780372 AGGGGTGGGGGTCCCTGTGGGGG - Intronic
1134629234 16:15745085-15745107 AGGGCTGGGGGCCCCTGGGAAGG + Intronic
1136707329 16:32201144-32201166 AGCGCTCAGGGCCTCTATGGAGG + Intergenic
1136760584 16:32728273-32728295 AGCGCTCAGGGCCTCTATGGAGG - Intergenic
1136807519 16:33142113-33142135 AGCGCTCAGGGCCTCTATGGAGG + Intergenic
1137063142 16:35810416-35810438 ATGGCTGAGAGCCACTGTGGGGG + Intergenic
1139549091 16:67663611-67663633 AGGGTGAAGGACACCTGTGGAGG - Intronic
1139583487 16:67886471-67886493 AAGATTGAGGGCCCCTGTGGTGG - Intronic
1140188511 16:72795195-72795217 TGGGGTAAGGGGCACTGTGGAGG + Exonic
1141160307 16:81625283-81625305 AGTCCTGAGGGCCCCTGGGGAGG + Intronic
1142010641 16:87712031-87712053 CGGGCGAAGGGTCCCTGTGCAGG - Intronic
1203062737 16_KI270728v1_random:988588-988610 AGCGCTCAGGGCCTCTATGGAGG - Intergenic
1142564424 17:830526-830548 AGGCCCAAGAGCCCGTGTGGAGG + Intronic
1142811325 17:2396886-2396908 TCGGCTAAGGCCCCCTGGGGAGG + Intronic
1143627946 17:8121781-8121803 AGGGCCAAGGGCCGGTGCGGCGG + Exonic
1144642667 17:16946209-16946231 AGGGCTAAGGTCCCATGGGCAGG - Intronic
1144646012 17:16974045-16974067 AGGGCTAAAGTCCCCTTTGACGG - Intergenic
1144942657 17:18952313-18952335 ATGGGTAAGGGGACCTGTGGTGG + Exonic
1145787428 17:27603292-27603314 AGGGCTCGGGGCCTCTGTGCTGG + Intronic
1145794324 17:27646640-27646662 GGGGTGAAGGGCCGCTGTGGGGG + Intronic
1146259379 17:31411746-31411768 AGGGCCAAGGGCCACAGGGGAGG - Intronic
1146520483 17:33521971-33521993 AGGGCTAGGGGGCCCTCTGCTGG + Intronic
1147161536 17:38571983-38572005 AGGGGCTAGGGCCCCTGGGGAGG + Intronic
1149451318 17:56752074-56752096 AGGGCTAAGGGACCCAATGTGGG + Intergenic
1150278190 17:63913283-63913305 GAGGCAAAGGGCCCCTGTGTTGG - Intronic
1152736265 17:81998842-81998864 AGGGCCCAGTGCCCCAGTGGTGG - Intronic
1152813368 17:82392719-82392741 AATGCTCAGGGGCCCTGTGGCGG + Intronic
1154196544 18:12271443-12271465 AGGGCGCAGGGCCGCCGTGGGGG - Intronic
1157601174 18:48894040-48894062 AGAGCAAAGGGCCCCAGAGGAGG + Intergenic
1157630823 18:49093426-49093448 AGGGCTAAGAACACCTGGGGAGG + Intronic
1160311937 18:77801266-77801288 AGGGTTAAGGGTCCCTCTGATGG + Intergenic
1160458381 18:79019014-79019036 AGGGCTATGGGAGCCAGTGGCGG + Intergenic
1162263079 19:9548074-9548096 AGGCCTGAGCCCCCCTGTGGTGG + Intergenic
1164564609 19:29316884-29316906 AAGGCTGAAGGCCCCAGTGGTGG + Intergenic
1166111774 19:40627148-40627170 CGGGCGAAGGGCCCAGGTGGCGG - Exonic
1166298013 19:41898019-41898041 GGGGCTAAGGGCCGGGGTGGGGG + Intronic
1167360602 19:49028497-49028519 AGGCTTCGGGGCCCCTGTGGAGG + Intronic
1167419477 19:49394665-49394687 TGGGCTAAGGCCCCCTCTTGGGG + Intronic
1167793168 19:51692906-51692928 GGGGCTAAGGGTCCCTGAGTGGG - Intergenic
925174463 2:1772385-1772407 AGGGCTAATGGCCACTCTGAGGG - Intergenic
925911531 2:8576678-8576700 AGGTCTGAGGGCCTCTCTGGGGG - Intergenic
926798689 2:16640264-16640286 AGGGGGAAGAGCCTCTGTGGGGG - Intronic
926918826 2:17918991-17919013 AGGGCTAGGGGCCCCTCTTGTGG + Intronic
933058098 2:77699113-77699135 AGGGCTGATGTCCCTTGTGGTGG + Intergenic
934516940 2:94994112-94994134 AGGGCTGAGGGTCCCTGGGGTGG + Intergenic
936521178 2:113212940-113212962 GGGGCTAAGGCCCACGGTGGAGG - Intergenic
937054911 2:118926541-118926563 AGGGCTAAGGGCTTTGGTGGAGG - Intergenic
938943587 2:136190800-136190822 AGGGGTGAGGGGACCTGTGGGGG + Intergenic
940565090 2:155350998-155351020 AGGGCTAAGGGACCCACTTGAGG + Intergenic
942577653 2:177381584-177381606 AGAGCTAAGGGCCACTTGGGAGG + Intronic
943771392 2:191721510-191721532 CTGGCTAAGGGCTGCTGTGGTGG + Intergenic
944942242 2:204641374-204641396 GGGGCTAAGGGCTCCCGTGAAGG + Intronic
946406295 2:219493690-219493712 AGGGCTAAATGCCCCTGTCCCGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947989118 2:234473223-234473245 AGGGGTAAGGGGCTCTGGGGGGG - Intergenic
948197464 2:236106406-236106428 AGGGCTCAGGACCCCTGGGCGGG + Intronic
948611284 2:239168748-239168770 AGGGCCGCAGGCCCCTGTGGTGG - Intronic
948888538 2:240896018-240896040 AGGGCCAGTGGCCCCTGAGGAGG + Exonic
949027475 2:241773379-241773401 AGGGCTGGGGGCCCTTGGGGTGG + Intergenic
1169195279 20:3679448-3679470 GAGGTTCAGGGCCCCTGTGGAGG + Intronic
1171255862 20:23688706-23688728 AGGGCTCAGGACCCCTCGGGTGG + Intronic
1172062542 20:32196429-32196451 TGAGCTGAGGGCCTCTGTGGGGG + Exonic
1172999581 20:39095985-39096007 GGGTCCCAGGGCCCCTGTGGAGG + Intergenic
1174157086 20:48522658-48522680 AGGAAGAGGGGCCCCTGTGGAGG - Intergenic
1175324650 20:58114810-58114832 AGGGCTAAGGGCTGCACTGGAGG - Intergenic
1175997868 20:62819428-62819450 AGGCCAAAGGACCCCTGTTGGGG - Intronic
1176032183 20:63017905-63017927 AGGGCTAAGGGCCACAGAGAGGG - Intergenic
1176132755 20:63503172-63503194 AGGGCACAGCGCCCCTGTGCTGG - Intergenic
1179243404 21:39610940-39610962 AGGGCTAAGGGCCTCTGCATGGG - Intronic
1181315761 22:21970116-21970138 AGGCCTAGGGGCCCCGGAGGGGG + Intronic
1184795785 22:46731651-46731673 AGGGCAGAGGGCACCTGGGGAGG + Intronic
1185294148 22:50045185-50045207 AGGCGGGAGGGCCCCTGTGGAGG + Intronic
949408670 3:3741039-3741061 AGGGCTAATGGCCCCTGGGCTGG - Intronic
950419997 3:12892871-12892893 AGGGTGGAGGGTCCCTGTGGAGG - Intergenic
950568513 3:13785997-13786019 GGGGCTGAAGGCCCCTTTGGGGG - Intergenic
950684046 3:14603723-14603745 AGAGCTGAGGGCTCCTCTGGAGG - Intergenic
950718021 3:14863335-14863357 AGGGCTGAGAGCCCCTGCTGTGG + Intronic
952901688 3:38115460-38115482 AGGGCCAGGCTCCCCTGTGGAGG + Intronic
954124950 3:48522639-48522661 AGGACCAAGGGGCCTTGTGGGGG + Intronic
954226836 3:49187388-49187410 AGGGCTAAGGGCCCCTGTGGAGG + Intronic
956077154 3:65517605-65517627 AGGGCGAAGGGCCTCTGCTGGGG - Intronic
961109164 3:124269000-124269022 GGTGCTGAAGGCCCCTGTGGAGG + Exonic
962069127 3:132014423-132014445 AGGGCTAGGGTCGCCTGAGGAGG + Intronic
962388152 3:134949490-134949512 AGGAGTAAAGCCCCCTGTGGAGG - Intronic
962774927 3:138650082-138650104 AGGGCCAAGGGGCTCTCTGGTGG + Intergenic
963758202 3:149258566-149258588 AGGGCTAAGGGGCTCTCTTGTGG - Intergenic
964004484 3:151811656-151811678 AGGGCGGAGGGCCCCTTGGGAGG - Intergenic
969061471 4:4438664-4438686 AGTGTTAAGTGCCCCAGTGGAGG - Intronic
971062960 4:22993042-22993064 AGGGCTAGGGGTCCATGGGGAGG + Intergenic
974568998 4:63619428-63619450 AGGGATAAGGGAGCATGTGGAGG - Intergenic
979297966 4:119054342-119054364 AGGGCAAAGGGCCGGTGTGATGG + Intronic
986993601 5:13580640-13580662 AGGGCTAAGGGACTCTGTCTTGG - Intergenic
992642669 5:78781650-78781672 AGGGCTTAGGGGCCTTGAGGAGG + Intronic
993554854 5:89323283-89323305 AGGGTTAAGGGCTCCTGTCCTGG + Intergenic
997336894 5:133114936-133114958 AGGGCAAAGGGTCCCTGGCGGGG + Intergenic
1001809566 5:174617731-174617753 TGGGCTAGGGGCCCCCGAGGGGG - Intergenic
1002187403 5:177460739-177460761 AAGGCCAAAAGCCCCTGTGGGGG - Intronic
1003565621 6:7219858-7219880 AGGGCTGGGGGTCCCAGTGGAGG - Intronic
1004022527 6:11788239-11788261 AGGGCAGAGGGCCCCTTGGGAGG - Intronic
1004619757 6:17322310-17322332 AGGGCAAAGAGCCCCTTGGGAGG + Intergenic
1006305294 6:33214983-33215005 ATGGCAAAGGGCCCGTGTAGGGG + Intergenic
1006811733 6:36824561-36824583 AGGGGCAGAGGCCCCTGTGGGGG - Intronic
1007227405 6:40324827-40324849 ATGGCCAAGGGCCGATGTGGAGG + Intergenic
1014154466 6:118094678-118094700 AGGACTGAGGCCCCATGTGGTGG + Intronic
1016962712 6:149688838-149688860 AGGGATAAGGGCTCCTCTGAGGG + Intronic
1017488377 6:154923199-154923221 AAAGCAAAGGGGCCCTGTGGTGG + Intronic
1017492787 6:154958900-154958922 AGGACCAATGACCCCTGTGGAGG - Intronic
1017507781 6:155084191-155084213 AGGGATAGGGGCCACTCTGGTGG + Intronic
1019265651 7:116191-116213 ATGGGAAAGAGCCCCTGTGGAGG - Intergenic
1019474220 7:1236311-1236333 CGGGCCAGGGGCCGCTGTGGCGG + Exonic
1020513051 7:9083761-9083783 AGGGCTGATGTCCCCCGTGGAGG + Intergenic
1021936901 7:25640055-25640077 AGGGATATGGTGCCCTGTGGCGG - Intergenic
1023907615 7:44533545-44533567 GGGGGTCAGGGCCCCTGTGAGGG + Exonic
1024006471 7:45228111-45228133 AGGGGTGAGGTCCCCTGTGGAGG + Intergenic
1026979140 7:74516477-74516499 GGGCCTCAGGGCCCCAGTGGTGG + Intronic
1033230447 7:139593564-139593586 AGGTCTAAAAGCCCCTTTGGTGG + Intronic
1033312742 7:140273620-140273642 AGGGCTGTGGGCCCCCCTGGGGG + Intergenic
1036767570 8:11558455-11558477 AAGGCTGAGGGCCCCTGGGATGG - Intronic
1045448732 8:102296555-102296577 AGGTCTCAGGTCCCCTGTAGTGG - Intronic
1049210036 8:141381760-141381782 AGGCCTCAGGTCCCCTGTGGTGG + Intergenic
1049210548 8:141384604-141384626 TGGGATAAAGGCCCCCGTGGAGG + Intergenic
1049332616 8:142063300-142063322 AGGGCTGAGGGCACCTTGGGCGG + Intergenic
1049616337 8:143577301-143577323 CGGGCTCAGGGCCCCGATGGGGG - Exonic
1052872595 9:33523472-33523494 AGGCCTGAGGGCCCCCCTGGTGG - Intergenic
1053135206 9:35646543-35646565 AGGGCTGAGGGCCTCGGTGACGG + Intronic
1055185122 9:73442088-73442110 AGGGGTATGAGTCCCTGTGGAGG + Intergenic
1056692957 9:88823720-88823742 TGGGCCAAGGGTCCCTCTGGAGG + Intergenic
1056811045 9:89764166-89764188 AGGGAGAAGGACCACTGTGGAGG + Intergenic
1061856641 9:133445219-133445241 AGGGCTCAGGGCCCCTGGGAAGG + Intronic
1062482571 9:136759362-136759384 AGGGGTGAGGGGCCCTGGGGAGG - Intergenic
1062591601 9:137277096-137277118 GCGGCTCAGGGTCCCTGTGGGGG - Intergenic
1062714805 9:138003729-138003751 AGATCTAAGGGCCCCTGGGCAGG + Intronic
1187533475 X:20116697-20116719 AGGGCTTCGGGTTCCTGTGGGGG - Intronic
1190402000 X:50046515-50046537 AGGTCTGAGGCCCCCTGGGGTGG + Intronic
1191104571 X:56764478-56764500 AGGGCTCAGAACCCCGGTGGGGG + Intergenic
1192546947 X:72022131-72022153 AGGGCTCAGGGCAGCTTTGGTGG - Intergenic
1195853195 X:109305353-109305375 AGGGCAAAGGGCCAGTGTGATGG + Intergenic
1197883907 X:131197811-131197833 ATGGCTATGGTCCCCTTTGGAGG - Intergenic
1200088517 X:153623616-153623638 AGAGCTGAGGGCCCTTCTGGGGG - Intergenic
1200163541 X:154020864-154020886 AGGACCAAGTGCCCCCGTGGAGG - Intergenic