ID: 954233070

View in Genome Browser
Species Human (GRCh38)
Location 3:49233783-49233805
Sequence AACCTTCAGCATGGGCATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 980
Summary {0: 20, 1: 42, 2: 41, 3: 113, 4: 764}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954233070_954233077 3 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233077 3:49233809-49233831 GGTTTACCAGAATGAGGGCAAGG 0: 126
1: 200
2: 352
3: 220
4: 180
954233070_954233079 12 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233079 3:49233818-49233840 GAATGAGGGCAAGGAACACTTGG 0: 13
1: 498
2: 338
3: 138
4: 254
954233070_954233076 -2 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233076 3:49233804-49233826 TTGTGGGTTTACCAGAATGAGGG 0: 108
1: 177
2: 350
3: 219
4: 222
954233070_954233082 26 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233082 3:49233832-49233854 AACACTTGGCCCACCGAGGGCGG 0: 1
1: 6
2: 216
3: 230
4: 215
954233070_954233075 -3 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233075 3:49233803-49233825 GTTGTGGGTTTACCAGAATGAGG 0: 110
1: 166
2: 334
3: 221
4: 188
954233070_954233080 22 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233080 3:49233828-49233850 AAGGAACACTTGGCCCACCGAGG 0: 1
1: 7
2: 330
3: 330
4: 313
954233070_954233081 23 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233081 3:49233829-49233851 AGGAACACTTGGCCCACCGAGGG 0: 1
1: 7
2: 319
3: 319
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954233070 Original CRISPR AACCTTCAGCATGGGCATCA TGG (reversed) Intronic