ID: 954233073

View in Genome Browser
Species Human (GRCh38)
Location 3:49233791-49233813
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2257
Summary {0: 28, 1: 73, 2: 77, 3: 138, 4: 1941}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954233073_954233079 4 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233079 3:49233818-49233840 GAATGAGGGCAAGGAACACTTGG 0: 13
1: 498
2: 338
3: 138
4: 254
954233073_954233081 15 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233081 3:49233829-49233851 AGGAACACTTGGCCCACCGAGGG 0: 1
1: 7
2: 319
3: 319
4: 295
954233073_954233082 18 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233082 3:49233832-49233854 AACACTTGGCCCACCGAGGGCGG 0: 1
1: 6
2: 216
3: 230
4: 215
954233073_954233080 14 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233080 3:49233828-49233850 AAGGAACACTTGGCCCACCGAGG 0: 1
1: 7
2: 330
3: 330
4: 313
954233073_954233077 -5 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233077 3:49233809-49233831 GGTTTACCAGAATGAGGGCAAGG 0: 126
1: 200
2: 352
3: 220
4: 180
954233073_954233076 -10 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233076 3:49233804-49233826 TTGTGGGTTTACCAGAATGAGGG 0: 108
1: 177
2: 350
3: 219
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954233073 Original CRISPR AAACCCACAACCTTCAGCAT GGG (reversed) Intronic