ID: 954233074

View in Genome Browser
Species Human (GRCh38)
Location 3:49233792-49233814
Sequence TAAACCCACAACCTTCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2010
Summary {0: 29, 1: 66, 2: 79, 3: 119, 4: 1717}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954233074_954233082 17 Left 954233074 3:49233792-49233814 CCATGCTGAAGGTTGTGGGTTTA 0: 29
1: 66
2: 79
3: 119
4: 1717
Right 954233082 3:49233832-49233854 AACACTTGGCCCACCGAGGGCGG 0: 1
1: 6
2: 216
3: 230
4: 215
954233074_954233077 -6 Left 954233074 3:49233792-49233814 CCATGCTGAAGGTTGTGGGTTTA 0: 29
1: 66
2: 79
3: 119
4: 1717
Right 954233077 3:49233809-49233831 GGTTTACCAGAATGAGGGCAAGG 0: 126
1: 200
2: 352
3: 220
4: 180
954233074_954233079 3 Left 954233074 3:49233792-49233814 CCATGCTGAAGGTTGTGGGTTTA 0: 29
1: 66
2: 79
3: 119
4: 1717
Right 954233079 3:49233818-49233840 GAATGAGGGCAAGGAACACTTGG 0: 13
1: 498
2: 338
3: 138
4: 254
954233074_954233081 14 Left 954233074 3:49233792-49233814 CCATGCTGAAGGTTGTGGGTTTA 0: 29
1: 66
2: 79
3: 119
4: 1717
Right 954233081 3:49233829-49233851 AGGAACACTTGGCCCACCGAGGG 0: 1
1: 7
2: 319
3: 319
4: 295
954233074_954233080 13 Left 954233074 3:49233792-49233814 CCATGCTGAAGGTTGTGGGTTTA 0: 29
1: 66
2: 79
3: 119
4: 1717
Right 954233080 3:49233828-49233850 AAGGAACACTTGGCCCACCGAGG 0: 1
1: 7
2: 330
3: 330
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954233074 Original CRISPR TAAACCCACAACCTTCAGCA TGG (reversed) Intronic