ID: 954233076

View in Genome Browser
Species Human (GRCh38)
Location 3:49233804-49233826
Sequence TTGTGGGTTTACCAGAATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1076
Summary {0: 108, 1: 177, 2: 350, 3: 219, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954233073_954233076 -10 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233076 3:49233804-49233826 TTGTGGGTTTACCAGAATGAGGG 0: 108
1: 177
2: 350
3: 219
4: 222
954233070_954233076 -2 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233076 3:49233804-49233826 TTGTGGGTTTACCAGAATGAGGG 0: 108
1: 177
2: 350
3: 219
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954233076 Original CRISPR TTGTGGGTTTACCAGAATGA GGG Intronic