ID: 954233078

View in Genome Browser
Species Human (GRCh38)
Location 3:49233815-49233837
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 6, 1: 256, 2: 168, 3: 57, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954233078_954233080 -10 Left 954233078 3:49233815-49233837 CCAGAATGAGGGCAAGGAACACT 0: 6
1: 256
2: 168
3: 57
4: 151
Right 954233080 3:49233828-49233850 AAGGAACACTTGGCCCACCGAGG 0: 1
1: 7
2: 330
3: 330
4: 313
954233078_954233082 -6 Left 954233078 3:49233815-49233837 CCAGAATGAGGGCAAGGAACACT 0: 6
1: 256
2: 168
3: 57
4: 151
Right 954233082 3:49233832-49233854 AACACTTGGCCCACCGAGGGCGG 0: 1
1: 6
2: 216
3: 230
4: 215
954233078_954233086 9 Left 954233078 3:49233815-49233837 CCAGAATGAGGGCAAGGAACACT 0: 6
1: 256
2: 168
3: 57
4: 151
Right 954233086 3:49233847-49233869 GAGGGCGGAAAACCACTTCCAGG 0: 1
1: 0
2: 1
3: 49
4: 326
954233078_954233081 -9 Left 954233078 3:49233815-49233837 CCAGAATGAGGGCAAGGAACACT 0: 6
1: 256
2: 168
3: 57
4: 151
Right 954233081 3:49233829-49233851 AGGAACACTTGGCCCACCGAGGG 0: 1
1: 7
2: 319
3: 319
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954233078 Original CRISPR AGTGTTCCTTGCCCTCATTC TGG (reversed) Intronic