ID: 954233079

View in Genome Browser
Species Human (GRCh38)
Location 3:49233818-49233840
Sequence GAATGAGGGCAAGGAACACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1241
Summary {0: 13, 1: 498, 2: 338, 3: 138, 4: 254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954233070_954233079 12 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233079 3:49233818-49233840 GAATGAGGGCAAGGAACACTTGG 0: 13
1: 498
2: 338
3: 138
4: 254
954233073_954233079 4 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233079 3:49233818-49233840 GAATGAGGGCAAGGAACACTTGG 0: 13
1: 498
2: 338
3: 138
4: 254
954233074_954233079 3 Left 954233074 3:49233792-49233814 CCATGCTGAAGGTTGTGGGTTTA 0: 29
1: 66
2: 79
3: 119
4: 1717
Right 954233079 3:49233818-49233840 GAATGAGGGCAAGGAACACTTGG 0: 13
1: 498
2: 338
3: 138
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954233079 Original CRISPR GAATGAGGGCAAGGAACACT TGG Intronic