ID: 954233080

View in Genome Browser
Species Human (GRCh38)
Location 3:49233828-49233850
Sequence AAGGAACACTTGGCCCACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 981
Summary {0: 1, 1: 7, 2: 330, 3: 330, 4: 313}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954233074_954233080 13 Left 954233074 3:49233792-49233814 CCATGCTGAAGGTTGTGGGTTTA 0: 29
1: 66
2: 79
3: 119
4: 1717
Right 954233080 3:49233828-49233850 AAGGAACACTTGGCCCACCGAGG 0: 1
1: 7
2: 330
3: 330
4: 313
954233070_954233080 22 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233080 3:49233828-49233850 AAGGAACACTTGGCCCACCGAGG 0: 1
1: 7
2: 330
3: 330
4: 313
954233078_954233080 -10 Left 954233078 3:49233815-49233837 CCAGAATGAGGGCAAGGAACACT 0: 6
1: 256
2: 168
3: 57
4: 151
Right 954233080 3:49233828-49233850 AAGGAACACTTGGCCCACCGAGG 0: 1
1: 7
2: 330
3: 330
4: 313
954233073_954233080 14 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233080 3:49233828-49233850 AAGGAACACTTGGCCCACCGAGG 0: 1
1: 7
2: 330
3: 330
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954233080 Original CRISPR AAGGAACACTTGGCCCACCG AGG Intronic