ID: 954233082

View in Genome Browser
Species Human (GRCh38)
Location 3:49233832-49233854
Sequence AACACTTGGCCCACCGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 668
Summary {0: 1, 1: 6, 2: 216, 3: 230, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954233073_954233082 18 Left 954233073 3:49233791-49233813 CCCATGCTGAAGGTTGTGGGTTT 0: 28
1: 73
2: 77
3: 138
4: 1941
Right 954233082 3:49233832-49233854 AACACTTGGCCCACCGAGGGCGG 0: 1
1: 6
2: 216
3: 230
4: 215
954233078_954233082 -6 Left 954233078 3:49233815-49233837 CCAGAATGAGGGCAAGGAACACT 0: 6
1: 256
2: 168
3: 57
4: 151
Right 954233082 3:49233832-49233854 AACACTTGGCCCACCGAGGGCGG 0: 1
1: 6
2: 216
3: 230
4: 215
954233074_954233082 17 Left 954233074 3:49233792-49233814 CCATGCTGAAGGTTGTGGGTTTA 0: 29
1: 66
2: 79
3: 119
4: 1717
Right 954233082 3:49233832-49233854 AACACTTGGCCCACCGAGGGCGG 0: 1
1: 6
2: 216
3: 230
4: 215
954233070_954233082 26 Left 954233070 3:49233783-49233805 CCATGATGCCCATGCTGAAGGTT 0: 20
1: 42
2: 41
3: 113
4: 764
Right 954233082 3:49233832-49233854 AACACTTGGCCCACCGAGGGCGG 0: 1
1: 6
2: 216
3: 230
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954233082 Original CRISPR AACACTTGGCCCACCGAGGG CGG Intronic