ID: 954233086

View in Genome Browser
Species Human (GRCh38)
Location 3:49233847-49233869
Sequence GAGGGCGGAAAACCACTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954233078_954233086 9 Left 954233078 3:49233815-49233837 CCAGAATGAGGGCAAGGAACACT 0: 6
1: 256
2: 168
3: 57
4: 151
Right 954233086 3:49233847-49233869 GAGGGCGGAAAACCACTTCCAGG 0: 1
1: 0
2: 1
3: 49
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954233086 Original CRISPR GAGGGCGGAAAACCACTTCC AGG Intronic