ID: 954237073

View in Genome Browser
Species Human (GRCh38)
Location 3:49265104-49265126
Sequence CAGAAGTACCACTCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954237071_954237073 4 Left 954237071 3:49265077-49265099 CCACATTAAAACATCTTGTGGCT No data
Right 954237073 3:49265104-49265126 CAGAAGTACCACTCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954237073 Original CRISPR CAGAAGTACCACTCTGAGGC TGG Intergenic
No off target data available for this crispr