ID: 954239861

View in Genome Browser
Species Human (GRCh38)
Location 3:49285078-49285100
Sequence TTTTGGGGCTGGGGGTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 463
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 417}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954239861_954239872 23 Left 954239861 3:49285078-49285100 CCTTCTGACCCCCAGCCCCAAAA 0: 1
1: 0
2: 1
3: 44
4: 417
Right 954239872 3:49285124-49285146 GTGATACAGATAAGCTACGAAGG 0: 1
1: 0
2: 0
3: 2
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954239861 Original CRISPR TTTTGGGGCTGGGGGTCAGA AGG (reversed) Intronic
900464250 1:2816738-2816760 TTTTGGGGGTGGGGAAGAGATGG + Intergenic
901087922 1:6622899-6622921 TTCTGGGGCTGGGAGGGAGAGGG + Exonic
901642151 1:10698041-10698063 TGTTGGGGCAGGGGGTCAACAGG + Intronic
901796767 1:11684071-11684093 TTTAGGGGTTTGGGGTCAGATGG - Intronic
902054701 1:13590652-13590674 TGTGGAGGCTGGGGGTTAGAAGG + Intronic
902186652 1:14730556-14730578 TTTTCTGGCTGGGTGACAGAAGG - Intronic
902194469 1:14788195-14788217 GTTTGGGGCTGGGGGTAGGATGG - Intronic
902255285 1:15185042-15185064 TTTGGGGTGTGGGGGTCAGATGG - Intronic
902643354 1:17780743-17780765 TTTTGGGGGTGGGGGTGGGGAGG + Intronic
902980226 1:20117378-20117400 TCTAGGGGCTGGAGGTAAGAAGG - Intronic
902997446 1:20237832-20237854 TTGTGGAGCAGGGGGTCAGTGGG - Intergenic
903238087 1:21963745-21963767 TTTGGGGGCAGGGGCTCAGTCGG - Intergenic
903329123 1:22588259-22588281 ACGTGGGGCTGGGGGTCTGAGGG - Intronic
903669430 1:25026765-25026787 TTTTGGTGCTGGGGTTCAGGAGG + Intergenic
903810916 1:26034731-26034753 GCTTGGGGATGGGGGTCAAAGGG + Intronic
904311562 1:29632733-29632755 CTTGGGGGCTGGGGGACTGAGGG - Intergenic
905245748 1:36612106-36612128 TCTTGGGGATGGGGCTCATAAGG + Intergenic
905304676 1:37009396-37009418 ATCTGGGGCTGGGGGTGTGAGGG - Intronic
907121596 1:52012798-52012820 CATTGGGGATGGGGGTGAGAAGG - Intergenic
907291182 1:53413944-53413966 TTCTGGGGCTGTGGGTTAGGGGG - Intergenic
909974526 1:82029747-82029769 TTCTGGGGCTGGGTGGCAGGGGG - Intergenic
910979847 1:92949155-92949177 TTTTGGGGGTGGGAGTGGGAGGG - Intronic
911121718 1:94303029-94303051 TGTTGGGGCTGGTGGTCTGGGGG - Intergenic
913223868 1:116681388-116681410 ATTTGGGGGTGGGGATGAGATGG + Intergenic
913229232 1:116728166-116728188 TTTTGGGGATGGGGGTGGGGAGG - Intergenic
913258999 1:116981675-116981697 TTTTGGCCCTGTGGGCCAGATGG + Intronic
913444298 1:118933445-118933467 TTTTGTGGGTGGGGGGCAGAGGG - Intronic
914088087 1:144472181-144472203 TTCAGGGGATGGGGATCAGAAGG + Intergenic
915093983 1:153446186-153446208 TTTTGAGACTGGGGTTCAAAGGG + Intergenic
915491218 1:156250995-156251017 TCCTGGGGATGGGGGGCAGAGGG + Exonic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
916089766 1:161298838-161298860 TTTTGGGGGGGTGGGGCAGATGG - Intergenic
916147044 1:161749585-161749607 CTTTGGGGGTAGGGGTCAGAGGG + Intergenic
916669493 1:167001244-167001266 TTTGGGGACTTGGGGGCAGAAGG + Intronic
917019941 1:170575204-170575226 TGTTGGGGGTGGGGGGCAAAGGG + Intergenic
918075589 1:181168769-181168791 TCATGGGGCTGAGGGACAGAGGG + Intergenic
918690702 1:187475614-187475636 TTTTGTGGCAAGGGCTCAGAAGG - Intergenic
918910104 1:190556398-190556420 TTCTGGGGGTGGGGGTCTAAGGG + Intergenic
919492302 1:198219926-198219948 TTTTGGGGCGGGGGGTGGGGTGG + Intronic
919825167 1:201498400-201498422 TAAAGGGGCTGGGAGTCAGAGGG + Intronic
919896538 1:202012811-202012833 TTATGGTGCTGGGAGCCAGAGGG - Intronic
919989791 1:202701948-202701970 GTGTGTGGCTGGGAGTCAGATGG - Intronic
920314338 1:205066670-205066692 GTTTGGGGATCGGGGTCTGAGGG + Intronic
920412607 1:205774295-205774317 TTGTGGGGCTGTGGGTGGGATGG - Intronic
920556868 1:206910229-206910251 TTCTGGGGCTGGTGGTGAAAAGG - Exonic
920825582 1:209421754-209421776 TTCTGGGGCTGGGGGTGATGGGG - Intergenic
922570452 1:226631648-226631670 TCTCAGGGCTGGGGGCCAGAAGG + Intergenic
923555372 1:234996652-234996674 TTTTGGTTTTGTGGGTCAGATGG - Intergenic
923886687 1:238165021-238165043 GTTTGGGGTTGGGGGAGAGATGG + Intergenic
924284450 1:242471227-242471249 GTTTGGGGCTGGGGCAGAGATGG - Intronic
1062893238 10:1082248-1082270 TTTCGTGGCTCTGGGTCAGAAGG - Intronic
1064479676 10:15726695-15726717 TGATGGGGCTGGAGGTAAGACGG + Intergenic
1064978442 10:21142864-21142886 TGTTGGGGGTGGGGGGCAGGAGG - Intronic
1065650975 10:27890822-27890844 TTTAGGATCTGGGGGCCAGATGG + Intronic
1067531743 10:47079138-47079160 TTCTGGGGCTGGGGGTGGTAAGG + Intergenic
1069615724 10:69805033-69805055 CTTTGAGGCTGGGGGCCAGAGGG + Intronic
1069619928 10:69830905-69830927 GCCTGGGGCTGGGGGTCGGAGGG - Intronic
1069871530 10:71536024-71536046 TGCATGGGCTGGGGGTCAGAAGG + Intronic
1070449993 10:76548523-76548545 TTTGGGGGCTGGGGAGGAGAGGG + Intronic
1071918647 10:90325117-90325139 ATTTGGGGGTGGGGGGCACAGGG - Intergenic
1073056719 10:100707863-100707885 CTTTGGGGCTGGAAGACAGACGG - Intergenic
1073388043 10:103143975-103143997 TTTGGGGGCTGGAGGTTGGAGGG - Intronic
1074001768 10:109380587-109380609 TTTTGGGGCTGGGGCAAAGAAGG - Intergenic
1074080853 10:110167022-110167044 TTTCAGGGCTGGGGGTCAGGTGG + Intergenic
1074551330 10:114445079-114445101 CATTGGTGCTGGAGGTCAGAGGG - Intronic
1075471147 10:122690570-122690592 TCTTTGGGCCTGGGGTCAGAAGG + Intergenic
1075693121 10:124413862-124413884 TTTTAGGGCTGGGGGTGACTGGG - Intronic
1076355627 10:129850826-129850848 TTGGGGGGCTGTGGGCCAGAGGG - Intronic
1076531852 10:131150232-131150254 GTTGGAGGCTGGGGGCCAGATGG - Intronic
1076981214 11:205891-205913 TTTGGGGAATGGGGATCAGAGGG - Intronic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1077456589 11:2685101-2685123 TTTTGGCACGGGGGGTCTGATGG + Intronic
1077609753 11:3637006-3637028 TTTGTGGGCTAGGGGTCAGGTGG - Intergenic
1078278892 11:9879464-9879486 TTTTGGGGTTGGAAGTCACAGGG - Intronic
1078931508 11:15915539-15915561 TTTGGGGGCGGGTGCTCAGATGG - Intergenic
1079237624 11:18701229-18701251 TCCTGGGGCTGGGGGATAGAGGG + Intronic
1079585621 11:22123465-22123487 TTTCGGGGGTGGGGGTCTGGGGG + Intergenic
1079917641 11:26390405-26390427 TTTTTTGGGAGGGGGTCAGATGG - Intronic
1080489996 11:32751846-32751868 TTTTGAGGGTGGGGGCAAGATGG - Intronic
1080879402 11:36305358-36305380 TTTAGGGGCTGGGGTTGAGTGGG + Intronic
1081701464 11:45155336-45155358 TTCTGGGGCTGAGGGTCTGGTGG - Intronic
1082105649 11:48218373-48218395 TTCTGGGGCTTATGGTCAGATGG - Intergenic
1083266983 11:61551301-61551323 CTGTGGGGCTGGGGGAGAGAAGG + Intronic
1084172099 11:67405719-67405741 TTGTGGGGCTGGGGGTCCCTGGG - Intronic
1084288625 11:68147477-68147499 ACTTGGGGCTGGGGGCCAGGAGG + Intergenic
1084743571 11:71154612-71154634 ATTTGGGGCAGTGTGTCAGAAGG - Intronic
1084764950 11:71302122-71302144 TCTTGGGGGTGGGGGACACAGGG + Intergenic
1084966499 11:72747318-72747340 GTGTGGGGCTCAGGGTCAGAGGG - Intronic
1085067186 11:73507776-73507798 TATTTGGTCAGGGGGTCAGAGGG - Intronic
1085162297 11:74359978-74360000 TTTAGGGGATGGGGGTGAGAAGG + Intronic
1085348628 11:75784059-75784081 TGTTGGGGGTGGGGGCAAGAGGG + Intronic
1086085496 11:82950518-82950540 TGTTGGGGGTGGGGGTCTGGGGG - Intronic
1088497687 11:110447690-110447712 TTTTGGGGATGGGAGAGAGAGGG - Intronic
1088884240 11:113994596-113994618 TTTTGAGGCTGGGGGACGGAAGG - Intergenic
1088894599 11:114068235-114068257 TCTTGGGGTGGGGGGGCAGAAGG + Intronic
1089198991 11:116711959-116711981 TTTTGGGGCTTGGGGAGAGAGGG - Intergenic
1089215592 11:116832759-116832781 TTTAGGGGCTGGGTGACCGATGG + Exonic
1089500635 11:118929481-118929503 TTTTGGGGCTGGGGGCCCAGGGG + Intronic
1089839858 11:121406669-121406691 ATTTTGAGCTGGGTGTCAGAGGG - Intergenic
1090159850 11:124481452-124481474 TTTTGGGGCTGTGGCTCATATGG - Intergenic
1091142344 11:133245964-133245986 TTTGGGGGCTGGGGGTCAAGGGG + Intronic
1091455754 12:606565-606587 TTTTGGAACTGGAGGTCAGAAGG + Intronic
1094033365 12:26039364-26039386 TATTGAGGCTGGGTGTTAGAGGG + Intronic
1094508873 12:31084228-31084250 TTTTTGAGCTGGAGGTCAGCAGG + Intronic
1096195606 12:49647207-49647229 AGTGGGGGCTGGGGGTCAGAAGG - Intronic
1096817089 12:54208586-54208608 CTTTGGGGCCTGGGGTCAAAAGG - Intergenic
1097016415 12:55990455-55990477 GTTTGGGGCAGGGGGTAAGGGGG + Intronic
1099176870 12:79432357-79432379 TTGTGGGGTTGGGGGGCAGGGGG - Intronic
1099742297 12:86655180-86655202 ATTGGGGGCTGGGGGACAGGGGG - Intronic
1100741169 12:97595260-97595282 CAAAGGGGCTGGGGGTCAGAAGG + Intergenic
1101413125 12:104485540-104485562 AGTTGGAGCTGGGTGTCAGATGG - Intronic
1101995544 12:109522746-109522768 TGTTTGGGCAGGGGCTCAGATGG - Intronic
1102701257 12:114841544-114841566 TTCTGAAGCTGGGGGTAAGACGG - Intergenic
1103051239 12:117781679-117781701 TTTTGTGCCAGGGGCTCAGATGG - Intronic
1103329516 12:120144485-120144507 TTTTTGGGCTGGGGGCCTGGGGG - Intronic
1104041442 12:125133865-125133887 GCATGGGGCTGGGGGCCAGAGGG - Intronic
1104070157 12:125337640-125337662 TATTGGGCCTGTGGGTGAGATGG - Intronic
1104305532 12:127607544-127607566 GTCTGGGCGTGGGGGTCAGATGG + Intergenic
1104796943 12:131526672-131526694 TTTTGGGGCTTGTGTGCAGAGGG - Intergenic
1106247473 13:27961829-27961851 TATGGGGGGTGGGGGTGAGAGGG - Intergenic
1106898224 13:34328451-34328473 TATTTGGGCTGGGGGGCACAGGG + Intergenic
1107298919 13:38945613-38945635 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1107298935 13:38945706-38945728 TTTTGGCTCTGGAGGACAGATGG - Intergenic
1108446111 13:50510608-50510630 TTATGGGGCTGGAGTTCAGAAGG + Intronic
1110204085 13:72890549-72890571 TTTTAGGCCTGGGGATGAGATGG + Intronic
1112679905 13:101751750-101751772 TTTTAGGCTTGTGGGTCAGATGG - Intronic
1114527058 14:23373062-23373084 GTTTGGGGCTGGGGGCCAAGTGG + Exonic
1114614163 14:24059539-24059561 TTCTGGGGCTGGGGGTCTTCTGG - Intronic
1115397575 14:32925957-32925979 TTTTTGCACTGAGGGTCAGAGGG - Intergenic
1115578595 14:34735994-34736016 TGTTGGCGCTGGGGGGTAGAGGG - Intergenic
1118082782 14:62380801-62380823 TTTTGGGGGTGGGGGTGGGGTGG + Intergenic
1118614104 14:67563432-67563454 TTTGGGGGGTGGGGGTGAGGGGG + Intronic
1122564809 14:102645590-102645612 CTTTGGGGCTGGGTGGCAGGTGG - Intronic
1122897782 14:104768976-104768998 ACCTGGGGCTGGGGGGCAGATGG + Intergenic
1124879813 15:33631529-33631551 TTTTGAGCCAGGAGGTCAGATGG + Intronic
1125140608 15:36402341-36402363 TTTTGGTGCTTGGGGTAAAATGG - Intergenic
1125363889 15:38893012-38893034 TGTTGGGGGTGGGGGGCAGGGGG + Intergenic
1125536420 15:40443037-40443059 TTTTGGGTGTGGGGTTCACATGG - Intronic
1125539594 15:40462258-40462280 TGTTGGGGCTGCGTGTGAGAAGG + Exonic
1127013413 15:54655537-54655559 TTGGGGGTCTGGGGATCAGACGG - Intergenic
1127899865 15:63333192-63333214 TTTGGGGGCTGAGGCTAAGAGGG + Intronic
1127958255 15:63871604-63871626 TTTTCAGGCTGGGGTCCAGAGGG - Intergenic
1128559533 15:68655555-68655577 TTCTGGGGAAGGGGGCCAGAGGG - Intronic
1128676420 15:69612397-69612419 TGGTGGAGCTGGGGGTCACAAGG - Intergenic
1129491574 15:75931399-75931421 TTTTGGGGCACTGGGTCAGTTGG - Intronic
1130474646 15:84253697-84253719 GTTTGGACCTGGGGGTCTGAGGG + Intergenic
1130482062 15:84367751-84367773 GTTTGGACCTGGGGGTCTGAGGG + Intergenic
1130507974 15:84564315-84564337 GTTTGGACCTGGGGGTCTGAGGG - Intergenic
1130586139 15:85184417-85184439 GTTTGGACCTGGGGGTCTGAGGG + Intergenic
1130710417 15:86275163-86275185 TTTTGGTGCTGAAGGGCAGAGGG + Intronic
1130719059 15:86368205-86368227 TTTCTGGACTGGGGGTCTGAAGG + Intronic
1131994247 15:98119125-98119147 TCTTGGGGGTGGTGGGCAGAGGG + Intergenic
1132125288 15:99218301-99218323 TGTAGGGGCTGGGGGTGAGGAGG + Intronic
1132647819 16:1007180-1007202 CTTTGGTGCTGGGGGACAGAGGG + Intergenic
1132845389 16:1998845-1998867 GCCTGGGTCTGGGGGTCAGAAGG + Exonic
1134200290 16:12192272-12192294 GTTTGGGGCTGGGAGTGGGAAGG + Intronic
1134352023 16:13446559-13446581 ATTTTGAGCTGGGGGTTAGAAGG + Intergenic
1135325185 16:21521201-21521223 ATTTGGGGGTGGGGGTCTTATGG - Intergenic
1135948070 16:26882962-26882984 TGTTGGGGGTGGGGGACAAAAGG + Intergenic
1136336669 16:29614469-29614491 ATTTGGGGGTGGGGGTCTTATGG - Intergenic
1136407629 16:30057726-30057748 GTTTGGGGCTGAGGGGCAGAAGG + Intronic
1136554363 16:30999046-30999068 TTTTGGGGGTGGGGGGTGGAGGG - Intronic
1137056472 16:35748712-35748734 TTTGGGGGCCAGGTGTCAGAAGG - Intergenic
1137687032 16:50393397-50393419 CTCTGGGGCTGGGGGTAAGAGGG - Intergenic
1137715475 16:50595734-50595756 TCTTGGGCCTGGGGATAAGAAGG - Intronic
1137969560 16:52970666-52970688 TTTAGGGGCAGGGAGTCAGGTGG + Intergenic
1138166086 16:54802777-54802799 TTTCGGGGGGGGGGGTCACATGG + Intergenic
1138381767 16:56607710-56607732 CCTTGGGCCTGAGGGTCAGAAGG - Intergenic
1138382331 16:56611282-56611304 CCTTGGGCCTGAGGGTCAGAAGG - Intergenic
1138743762 16:59339487-59339509 TTTCAGGGCTGTGGGTCAGGAGG + Intergenic
1138929614 16:61636541-61636563 TTTTGGGGGTGGGGGACTAAGGG + Intergenic
1139957501 16:70700158-70700180 CTTTGGGGCTGGGGGTGGGGAGG - Intronic
1140123972 16:72105316-72105338 ATTTTGGCCTGGAGGTCAGAAGG - Exonic
1141280427 16:82626224-82626246 CTTTGGGACTGAGGGTAAGAGGG - Intergenic
1142005563 16:87688034-87688056 TGGTGGGGCTGGGCGTCAGGTGG + Intronic
1142037396 16:87870253-87870275 ATTTGGGGGTGGGGGTCTTATGG - Intergenic
1142125020 16:88405900-88405922 TTTTGGGGGCGGGGGTCGGGAGG - Intergenic
1143023833 17:3929769-3929791 ATTAGGGTCTGGGGGTCAGTGGG - Intronic
1143304348 17:5933977-5933999 TTTTGGGGGTTGGGGGCTGAGGG + Intronic
1144314341 17:14045854-14045876 GATGGGGGCTGGGGGTCAAAGGG + Intergenic
1144328005 17:14200090-14200112 TTTGGGGGGTGGGGGTGGGAAGG + Intronic
1146002625 17:29140309-29140331 TTCCGGGGTGGGGGGTCAGAGGG + Intronic
1146107670 17:30055920-30055942 TTTTGGGACTTGGGTTCACAGGG - Exonic
1146654059 17:34625034-34625056 GTTTTGGGCTGGGAGTGAGAGGG + Intronic
1146895663 17:36539951-36539973 TCTGGGGGCTGGGGGGCAAATGG + Intronic
1147428112 17:40355945-40355967 TGCTGGGGCTGGGGGTGGGAGGG + Intronic
1147440973 17:40447093-40447115 TTTTGGGGCTGAGTGTCAGCAGG + Intronic
1147645469 17:42031049-42031071 TTTTGGGGGTGGGGGTGGGCAGG + Intronic
1147783819 17:42963690-42963712 TAGTGGTGCTGGGGGGCAGAGGG - Intronic
1148432309 17:47651320-47651342 TGTTGGGGGATGGGGTCAGAGGG + Intronic
1148653930 17:49269302-49269324 TGTTTGGGGTGGGGGTCAGGGGG - Intergenic
1149778257 17:59375507-59375529 TTTTTAGGCTGGGACTCAGAGGG + Intronic
1150488253 17:65558943-65558965 TTTCGGGGTTGGGGGTGGGAGGG + Intronic
1151636735 17:75354261-75354283 TTTTGGGGGGGGGGGGGAGATGG + Intronic
1152492740 17:80648690-80648712 ATTTGGGGGTGGGGGGCACAAGG - Intronic
1152598916 17:81251665-81251687 TTGGGGGGTTGGGGGACAGAAGG + Intronic
1152709243 17:81862066-81862088 TGTAGGGGCTGGAGGACAGAAGG + Intergenic
1155140190 18:23037856-23037878 ATTTGGGGCTGGGGATCTTAAGG - Intergenic
1155524160 18:26699602-26699624 TTTTGGGGGCGGGGGGCAGGGGG - Intergenic
1157371878 18:47121293-47121315 TTTTGGGGAGTGGGGTGAGAGGG - Intronic
1157480571 18:48051077-48051099 TGTTGGGGCTGGAGGTCAACAGG - Intronic
1157574464 18:48734213-48734235 TGCTGGGGGTGGGGGACAGAAGG - Intronic
1158425070 18:57332108-57332130 CATTGGGGCTGGGGGTTGGAGGG - Intergenic
1158547793 18:58410679-58410701 ATTTGGGGCTGGGAGTCTGAAGG + Intergenic
1160154134 18:76420315-76420337 TTTTGGGCCAGAGGGTGAGAAGG - Intronic
1160757188 19:763984-764006 TTGAGGGGCTGCGGGTCTGAGGG + Exonic
1161313845 19:3608832-3608854 GTGAGGGGCTGGGGGGCAGATGG + Intergenic
1161473766 19:4473574-4473596 TTGAGGGGCTGGGGGGCCGAGGG + Intronic
1161497819 19:4597275-4597297 TTGCGGTGATGGGGGTCAGAGGG - Intergenic
1161933112 19:7354373-7354395 ATTTGGGGCTGGGGGTGATTTGG + Intronic
1162405911 19:10473687-10473709 GCTTTGGGCTGGGGGTCAGGAGG + Intergenic
1162751527 19:12832889-12832911 TCTTGGCACTGGGGGACAGAAGG - Intronic
1163184431 19:15628204-15628226 TTATAGGACTGAGGGTCAGAGGG + Intronic
1163622646 19:18369971-18369993 TTGTGGGGCTGGAGTTCAGCTGG + Intergenic
1163677677 19:18663433-18663455 TTTTGGGGCTGGCTGGCAGTGGG + Intronic
1163762984 19:19147049-19147071 TTTGGGGGCTGCTGGTCGGAAGG + Exonic
1165279924 19:34787038-34787060 CTGTGGGGCTGGGGCCCAGAGGG + Intergenic
1165353619 19:35290928-35290950 TTGTGGGGCTGGGGGGGAGTTGG - Intergenic
1165426176 19:35746615-35746637 TGTTGGGGCTCTGGGTGAGAAGG + Intronic
1165497387 19:36161245-36161267 TTATGGGACTGGGAGTCAGGGGG - Intergenic
1166276620 19:41758485-41758507 TTTAGGGACAGGGGTTCAGAGGG - Intronic
1166423629 19:42656962-42656984 TTTAGGGGCAGGGGTTCAGAGGG - Intronic
1166993086 19:46704877-46704899 TTCAGGGTCTGGGGGACAGATGG - Intronic
1166993116 19:46704996-46705018 TTCAGGGTCTGGGGGACAGATGG - Intronic
1166993147 19:46705119-46705141 TTCAGGGCCTGGGGGGCAGATGG - Intronic
1167018913 19:46860406-46860428 TTTTGGGGGTGGGGGGCGAAGGG - Intergenic
1167080085 19:47272209-47272231 CTCTGGGGCTGAGGGGCAGAGGG + Intergenic
1167108549 19:47445691-47445713 TTGTGGGGGTGGGGGACAGAGGG + Intronic
1167135396 19:47612609-47612631 TGTAGGGGCTGGGGGGCTGAGGG + Intronic
924985204 2:264253-264275 TGTTGGGGGTGGGGGTCTCAGGG + Intronic
925357185 2:3250120-3250142 TCTTGGGCCTGGAGGGCAGAAGG - Intronic
925922142 2:8645309-8645331 CGGAGGGGCTGGGGGTCAGAGGG - Intergenic
927145411 2:20162331-20162353 GTTTGGTGATGGGGGTCAGGTGG + Intergenic
927357567 2:22190509-22190531 TTTTCTGGGTGGGGGGCAGAGGG + Intergenic
927557940 2:24049417-24049439 TGTGGGGGGTGGGGGGCAGAAGG - Intronic
927721778 2:25387729-25387751 TGCTGGGGCTGGAGGTGAGAAGG - Intronic
927774341 2:25890544-25890566 TCTTGGGGCTGGGAGTTTGAGGG + Intergenic
928722626 2:34138067-34138089 TTTAGGGGCTGTGGGTCAGCTGG + Intergenic
929558256 2:42938785-42938807 TTGTGGGGCTGGGGATGACATGG - Intergenic
929592829 2:43158182-43158204 TACTGGGGCTGGGGGCCAGGAGG - Intergenic
929957360 2:46468614-46468636 CTGAGGGGTTGGGGGTCAGAAGG - Intronic
931551806 2:63454349-63454371 GTTTGGGGGTGGGGGACTGAGGG + Intronic
931857862 2:66322729-66322751 TCTTGAGGGTGGGGGTGAGAGGG + Intergenic
932104002 2:68926495-68926517 CTGAGGGGCTGGGGTTCAGAAGG + Intergenic
932424521 2:71620650-71620672 TTGTGGGGCTGGGGGTAGGGGGG + Intronic
932760579 2:74436711-74436733 ATTTGGGGCTGGAGATCAGTAGG - Intronic
934951125 2:98576422-98576444 CTGTGGGGCTGGTGGTCAGGAGG + Intronic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
937454975 2:122033388-122033410 ACTTGGGGATGGGGGTCTGAAGG - Intergenic
938195531 2:129324307-129324329 TTTTGGCTCTGAGGGACAGAGGG - Intergenic
938922453 2:136007777-136007799 TTTTGGGGTGGGGGTTCAGGAGG + Intergenic
942410008 2:175699362-175699384 TTTTGGGGCTGTGGGGGAAATGG + Intergenic
942410649 2:175705789-175705811 TTTTGGGGCTGTGGGGGAAATGG + Intergenic
946037831 2:216757869-216757891 TTTGGGGGCTGGGGAGAAGATGG + Intergenic
1168870019 20:1119741-1119763 TGTTGGGGATGAGGGTCACAGGG - Intronic
1169289324 20:4335205-4335227 TTAGGGAGCTGGAGGTCAGATGG + Intergenic
1170696660 20:18665216-18665238 AGTTGGGGCTGGGGGCCAGGGGG + Intronic
1171177954 20:23068279-23068301 TTATGGGCCCTGGGGTCAGAGGG - Intergenic
1171426511 20:25051919-25051941 GTTTCTGGCTGTGGGTCAGATGG + Intronic
1172867641 20:38112464-38112486 TCTTGGGGCTGGGGCTGGGAAGG + Intronic
1174494478 20:50930444-50930466 TTTTGGGGGTGGGGGGCGGACGG + Intronic
1174911699 20:54615205-54615227 TTTTGGGATTGAGGGTCATAAGG - Intronic
1175246336 20:57584455-57584477 GTGTGGGTCTGAGGGTCAGAGGG + Intergenic
1175393736 20:58644255-58644277 TTTGGGGGCTGGGCCTCAGAGGG + Intergenic
1175940551 20:62535718-62535740 TTGAGGGGGTGGGGGTCAGGGGG + Intergenic
1176145165 20:63562238-63562260 GGGTGGGGCTGGGGGCCAGAGGG + Intronic
1177518574 21:22187668-22187690 TTTTGGGGCGGGGGGGCGGTGGG + Intergenic
1178215036 21:30586483-30586505 TTTTGGGGGCGTGGGTCATATGG - Intergenic
1179047768 21:37861689-37861711 TTTTATGGCTGTGGGGCAGAGGG - Intronic
1179148041 21:38786078-38786100 ATTCTGGGCTGGGGGTCAGTGGG + Intergenic
1179221684 21:39413423-39413445 TTGTGGGACTGGGGCTCATAAGG + Intronic
1179486243 21:41712500-41712522 GCTGGGGGCTGGGGCTCAGAGGG - Intergenic
1179943789 21:44656920-44656942 ATTTGGGGTTAGGAGTCAGATGG - Intronic
1180081189 21:45488501-45488523 TCTTGGGGCTGGGGGAGACAGGG + Intronic
1182162700 22:28139049-28139071 TTTTGGGGGTTGGGGAGAGATGG + Intronic
1182658425 22:31907763-31907785 TTCAGGAGCTGTGGGTCAGAGGG + Intergenic
1182774851 22:32823472-32823494 CTTTGGGGCTGGGACACAGACGG - Intronic
1182892077 22:33827415-33827437 TTTTTTGGCGGGGGGACAGAGGG - Intronic
1183005387 22:34897101-34897123 TGTTGGGTCTGGGTGGCAGAAGG - Intergenic
1183307056 22:37088160-37088182 TTTTGGACCTGGAAGTCAGATGG + Intronic
1183713622 22:39520973-39520995 TTGCGGGGCTCGGGGTCCGAGGG - Exonic
1184694760 22:46133159-46133181 TGCTGGGGCTGGGGGTCCGAAGG + Intergenic
1184695011 22:46134164-46134186 AGTTGGGGTTGGGGGTCAGGAGG - Intergenic
1184826871 22:46958324-46958346 TGAAGGGGCTGGGGGTCACAAGG - Intronic
949562803 3:5218302-5218324 TTGTGGGGCTGGATGCCAGAAGG + Exonic
949572155 3:5303916-5303938 TTTTGGGGCTTGGATACAGAAGG - Intergenic
950006853 3:9697006-9697028 TTTTGGGGGTGGGAGGAAGAAGG - Intronic
950215049 3:11153484-11153506 GTGTGGGGGTGGGGGTCAGAGGG - Intronic
951210135 3:19965750-19965772 TTTTGGGGCAGGGGTTGGGATGG + Intronic
951221454 3:20072769-20072791 TTTTGGGGGTTGGGGCCTGAGGG + Intronic
952132989 3:30385824-30385846 TTTTGGGGGTGGGGGGCTGGGGG - Intergenic
952211234 3:31231243-31231265 TATTGGGGGTGAGGGTCAGGGGG + Intergenic
954239861 3:49285078-49285100 TTTTGGGGCTGGGGGTCAGAAGG - Intronic
954489228 3:50885876-50885898 TTTTTGGTGTGGGGGGCAGAGGG + Intronic
955103994 3:55878419-55878441 TTTTGGGGCAGGAGGACAGCAGG - Intronic
959456249 3:106566155-106566177 TTTTGGGGCTGGGGGTGGACTGG + Intergenic
961461646 3:127053854-127053876 ATTTGGGGCTGAGGGTCTGATGG + Intergenic
962920990 3:139950284-139950306 TTTTGAGGCTGGTGTTGAGAGGG + Intronic
963430548 3:145196884-145196906 GTTGGGGGATGGGGGACAGAGGG - Intergenic
964302440 3:155304037-155304059 TTTGGGGAATGGGGGTGAGAAGG - Intergenic
965447522 3:168793903-168793925 TGTTGGGGGTGGGGGTCAAGTGG + Intergenic
965895417 3:173570085-173570107 TCTTGGGAGTGGGGGCCAGAAGG + Intronic
966710915 3:182972067-182972089 TTTTTTGGTTGGGGGTAAGAAGG + Intronic
966728014 3:183125661-183125683 TCTTGGGGCAGGGAGGCAGAGGG + Intronic
966928959 3:184663539-184663561 TATTGGGGGTGGGGGTCGGGAGG - Intronic
967097203 3:186186838-186186860 TTTTGGGGCTGGGGTAGAGGTGG + Intronic
967451112 3:189624307-189624329 TTATGGGGGTGGGGGTGACAGGG - Intergenic
967707269 3:192665601-192665623 TTTTGGGGGTGGGGGGCAAGGGG + Intronic
968292676 3:197550793-197550815 TTCTGGAGCTGGGGGGCAGATGG - Intronic
969059489 4:4423826-4423848 TCTTGGGACTGAGGGTCAGTTGG - Intronic
969363760 4:6681918-6681940 TTTGGGGGCTGTGGGGCAGCTGG + Intergenic
969533525 4:7742036-7742058 CTTTGGGTCTGGGGGACAGGTGG - Exonic
970588784 4:17540574-17540596 TGTTGGGGTTGGGGGTTAGATGG + Intergenic
970654831 4:18219455-18219477 TGTTGGGGGTGGGGGCCAGGGGG - Intergenic
971753636 4:30681191-30681213 CTGTGGGGCTGGGGGTTAGGGGG - Intergenic
972262638 4:37425742-37425764 TTTTGAGAATTGGGGTCAGAAGG + Intronic
974751965 4:66153818-66153840 TTTTGTTAGTGGGGGTCAGAAGG + Intergenic
974958383 4:68671789-68671811 TCTTGGGGCTGGGCCTGAGAAGG - Intergenic
976990974 4:91366020-91366042 TTTGGGGGGTAGGGGTGAGATGG + Intronic
977993811 4:103478175-103478197 TTTAGGGGGAGGGAGTCAGAGGG - Intergenic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979204805 4:118025781-118025803 TTTTGTGGCTGTGGGACTGAGGG + Intergenic
980156760 4:129117384-129117406 CTATGGGGCTGGGGGACAGTGGG - Intergenic
981044634 4:140253458-140253480 TTTTGGGGGTGGGGATAAGGAGG + Intergenic
983618093 4:169730123-169730145 TGTTGGGGATGGGGGAGAGAAGG - Intronic
984117718 4:175703174-175703196 TTTTGGGGGTGGGTGGAAGATGG + Intronic
985043381 4:185915696-185915718 TGCTGGGGGTGGGGGGCAGAAGG - Intronic
985564755 5:609857-609879 TGATGGGGCTGGGGGTGTGAGGG + Intergenic
985570060 5:639940-639962 TTATGGGGCTGGGGTCCAGGTGG - Intronic
985872426 5:2568186-2568208 TTTTGGGGGTGGGACTCTGATGG - Intergenic
986534420 5:8772173-8772195 TTCTGCGGCTGGGGATCAGTAGG + Intergenic
988143510 5:27273959-27273981 TTTTAGAGGTGGGGTTCAGAGGG + Intergenic
990287530 5:54314656-54314678 CTTTGGAGCTGGGGGGTAGAAGG - Intergenic
994662502 5:102670620-102670642 TTTTGGGGATGGGGGTGGCAGGG + Intergenic
997636777 5:135415173-135415195 TTTTGGGGCTGGGGGGGATGGGG - Intergenic
999153886 5:149444273-149444295 TGTTGGGACTGAGGGTCAGATGG - Intergenic
999230912 5:150061307-150061329 TCTTGGAGCCGGGAGTCAGAGGG + Intronic
999394332 5:151217400-151217422 ACTTGGGGCTGGGGGTGAGAGGG + Intronic
999858223 5:155618104-155618126 TTTTGGGGCAGGGGATGGGAGGG + Intergenic
1000449200 5:161363374-161363396 GTTCGGGGCTGGGGGGCTGAGGG + Intronic
1001246284 5:170107728-170107750 TTTGGGGGTTGGGGGTTGGAGGG - Intronic
1001828556 5:174766315-174766337 TTCAGAGGCTGAGGGTCAGAGGG + Intergenic
1001906749 5:175479071-175479093 TCCTGGTGCTGGGGGTCGGAGGG + Intronic
1004268136 6:14167439-14167461 TGTGGGGGCTGGGGCTCAGCTGG - Intergenic
1004640529 6:17510918-17510940 TGTTGGGGCTGTGGGTGTGAGGG + Intronic
1004643680 6:17539497-17539519 TTTTGTGTCTGGGAGCCAGAGGG - Intronic
1005886467 6:30101391-30101413 TTTTCAGGATGGGGTTCAGATGG + Intergenic
1006017675 6:31095127-31095149 TTTTGGGGGTGGGGGACACATGG + Intergenic
1006177034 6:32128650-32128672 TTTGGGGGTGGGGGGCCAGAGGG - Intergenic
1006707368 6:36032441-36032463 TTTTGGGGTTTTGGGACAGAAGG + Intronic
1007408472 6:41648203-41648225 ATTAGGAGCTGGGGCTCAGAGGG - Intronic
1007412888 6:41674973-41674995 TTGTGGGGTTGGGGGACAGGAGG + Intergenic
1007620594 6:43211756-43211778 TTTTGGGGGTGGGGAATAGATGG - Intronic
1007711617 6:43827879-43827901 TTTTGGGCTTGGGCCTCAGAGGG + Intergenic
1008540362 6:52541424-52541446 TTTTCGAGCTGAGGGTGAGAAGG - Intronic
1008845843 6:55963141-55963163 TTTTGGGGTTCTGGTTCAGAAGG - Intergenic
1008906326 6:56681318-56681340 TGTTTGGGGTGGGTGTCAGAGGG - Intronic
1009318399 6:62253744-62253766 ATTTGGGCCTCAGGGTCAGATGG - Intronic
1010316663 6:74459295-74459317 TCGTGGGGATGGGGGTCAGTGGG - Intergenic
1010582714 6:77619311-77619333 TTTTGGGGCTGGGTTTTAAAAGG + Intergenic
1010966876 6:82220670-82220692 TCTTGTGTCTGGGGGTCATATGG - Exonic
1011504118 6:88022288-88022310 TTTGGGAGCTGGGTGTAAGATGG + Intergenic
1011989848 6:93500690-93500712 TTTGGGGGAGGGGGGTCACATGG + Intergenic
1012096593 6:94970236-94970258 TTCTGGGGGTGGAGGTCAGGAGG + Intergenic
1012551520 6:100467875-100467897 TTTTGCGGGGAGGGGTCAGAAGG - Intergenic
1013454510 6:110318055-110318077 TGTTAGGGTTGGGAGTCAGAGGG - Intronic
1013693878 6:112677267-112677289 TTTTGGGGGTGGGGGCCTGGGGG + Intergenic
1016781995 6:147969095-147969117 GTTGGGGGCTGGGGGGCTGAGGG - Intergenic
1017310134 6:152966504-152966526 TGTTGGGGCTGGGGGACTGGGGG - Intergenic
1018296188 6:162346617-162346639 TTTTGGGGGTGGGGGTATGGGGG - Intronic
1019382008 7:728705-728727 GCTTGGGGCTGGGGCACAGATGG - Intronic
1019519103 7:1452660-1452682 CTGTGGGTCTGGGGGTGAGATGG - Intronic
1019733926 7:2641297-2641319 TTTGGGGGCTGCGGGGCAGTCGG + Intronic
1020257583 7:6510611-6510633 TCTTGGGGTTGGGGGTCTCAGGG + Exonic
1021979344 7:26039535-26039557 TGTTGGGGCTGGGCGGCAGGGGG + Intergenic
1022128329 7:27379125-27379147 TTTTGAGATTTGGGGTCAGATGG - Intergenic
1022252392 7:28621190-28621212 GTTGGGGGGTGGGGGTCACAGGG + Intronic
1023527210 7:41117299-41117321 TTTTTGAGCTTGGGATCAGAGGG - Intergenic
1024395752 7:48864768-48864790 ATTTGGGGGTGGGGGTGGGAAGG + Intergenic
1024399482 7:48907508-48907530 ATTTGGGGGTGGGGGTGGGAAGG - Intergenic
1024570646 7:50720481-50720503 TTTTGGCGCCTGGTGTCAGATGG - Intronic
1024840410 7:53579139-53579161 TTTGGGGACTTGGGGTAAGACGG + Intergenic
1024840877 7:53585967-53585989 TATTGGGGCTGTTGATCAGATGG + Intergenic
1025651739 7:63476177-63476199 TTTTGGGGCGGGGGGGCACAGGG + Intergenic
1027667099 7:81053623-81053645 TTTTTTGGCTGGGGGTCAGGGGG + Intergenic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1028985085 7:97003233-97003255 TGTGGGGGGTGGGGGACAGAAGG - Intergenic
1029488403 7:100857049-100857071 TTTTGTGGCTGTGGGGCCGAGGG + Exonic
1030772372 7:113490082-113490104 TTGTGGGGCAGGGGGGCAGAGGG + Intergenic
1031155700 7:118108867-118108889 GTTTGGGGGTGGGGGGCTGAGGG + Intergenic
1031731212 7:125303020-125303042 TTTTGGGGGTGGGGGTGAGGGGG - Intergenic
1032606409 7:133359161-133359183 TTTTGGGGCTGGGATTCCAAAGG + Intronic
1032756753 7:134898112-134898134 TTTTTTGGATGGGAGTCAGAGGG + Intronic
1032845158 7:135745770-135745792 TGGTGGGGCTGGGGGCCAAAGGG + Intronic
1033677042 7:143553029-143553051 TTTTAAAGCTGGGTGTCAGAGGG + Intergenic
1033694793 7:143776408-143776430 TTTTAAAGCTGGGTGTCAGAGGG - Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1034414249 7:150956497-150956519 TTTGGGGGCTGGGGGTGGGTGGG - Intronic
1034473301 7:151268071-151268093 TTTCTGGGCTGGGGGATAGAAGG + Intronic
1034553111 7:151833603-151833625 TGCTGGGGCTGGGGACCAGATGG - Intronic
1034630580 7:152527432-152527454 TTTTGGGGCGTGGGGAGAGATGG - Intergenic
1034647762 7:152663836-152663858 TTTTGGGGGGGGGGGGCAGGGGG - Intronic
1034726534 7:153341088-153341110 TGTTGGGGCTGGGGCTTAGTGGG - Intergenic
1035336133 7:158128020-158128042 TCTTGGTGCTGAGGTTCAGATGG - Intronic
1035882517 8:3257740-3257762 TTCTGGGGCTGGAGCTGAGAAGG + Intronic
1036529154 8:9566341-9566363 TTTTGGGGCTGGGGAGAAGGAGG - Intronic
1037009803 8:13827228-13827250 TGTTGGGGGTAGGGGGCAGAGGG - Intergenic
1037689871 8:21172636-21172658 TTGCAGGGCAGGGGGTCAGAGGG + Intergenic
1037926533 8:22847801-22847823 TTTGGGGGCTGGGGTTGAGCAGG - Intronic
1038349739 8:26765150-26765172 TTGTGGGGTTTGGGGTTAGAGGG - Intronic
1039598190 8:38809688-38809710 TTTGGGGGCTGTGGGACTGATGG + Intronic
1039923906 8:41911892-41911914 TCGTGGGGCTGGGGGTCTAAAGG - Intergenic
1040452552 8:47562611-47562633 TGTTGCTGCTGGGTGTCAGAAGG + Intronic
1040928941 8:52714301-52714323 GTCTGGGGCCGGGGGACAGAAGG + Exonic
1041177662 8:55213258-55213280 TTTGGTGGGTAGGGGTCAGAGGG + Intronic
1043747187 8:83889608-83889630 TGTTGGGGCTGGGGGTGGCAAGG + Intergenic
1044057811 8:87594105-87594127 CTTGGTTGCTGGGGGTCAGAAGG - Intronic
1046708779 8:117486720-117486742 TTTTGGGGGTGGGGCCAAGATGG + Intergenic
1047436961 8:124842825-124842847 CTTTGGGGGTGGGGTTGAGAAGG + Intergenic
1047795874 8:128255019-128255041 CTTGGGGGCTGGGGGTTAAATGG + Intergenic
1048653569 8:136509476-136509498 TTTGGGGGTTGGGGTTCAAAGGG + Intergenic
1049283658 8:141763113-141763135 GTTTGGAGCTGGGACTCAGAGGG + Intergenic
1049334187 8:142073899-142073921 TCCTGGGGTTGGGGGACAGATGG - Intergenic
1049435123 8:142583035-142583057 GTGTGAGGCTGGGGGACAGAAGG + Intergenic
1049498604 8:142948770-142948792 TGTTGGGGGTGGGGATCTGATGG - Intergenic
1050425171 9:5505524-5505546 TTTTGGGGGTGGGGGTTGGTAGG - Intergenic
1051237683 9:15019047-15019069 TGTTGGGGATGGGGGAGAGAAGG + Intergenic
1052360191 9:27546902-27546924 TTTGGTGGGTGGGGGGCAGAAGG + Exonic
1052999679 9:34571087-34571109 GTGAGGGGCTGAGGGTCAGAAGG - Intronic
1054781280 9:69168346-69168368 TCTTGGGGGTGGGTGTCAGAGGG + Intronic
1055820374 9:80254699-80254721 TTTTGGGGGTGGAGGTGAGGGGG - Intergenic
1056518358 9:87376181-87376203 TTTTGGGGGTGGGGGTTGGCAGG - Intergenic
1056764390 9:89435983-89436005 ATTTGGGGGTGGGGGGCAGCGGG - Intronic
1056830297 9:89911797-89911819 AGTTGTGGCTGGGAGTCAGAAGG + Intergenic
1057112917 9:92491314-92491336 TTGTGGGGCTGGGGGTCCTGAGG + Intronic
1060183737 9:121551432-121551454 TTTGGGGGCTGGGCGGCAGGGGG - Intergenic
1061826447 9:133261108-133261130 GTTGGGGACTGGAGGTCAGAAGG + Intronic
1061957470 9:133971165-133971187 TTTGGAGACTGAGGGTCAGAGGG - Intronic
1061963755 9:134001707-134001729 AGGTGGGGATGGGGGTCAGATGG - Intergenic
1062149827 9:135012227-135012249 CTTTGGGTCTGGGAGTCAAAGGG - Intergenic
1185548384 X:964585-964607 GTTTGGGGCTGGGGGGCCAAGGG - Intergenic
1186763105 X:12743459-12743481 TTTTGTTGCAGGGGGTCAGGGGG - Intergenic
1186788720 X:12976145-12976167 TTTTCAGGCTGCGGGTCGGAGGG + Exonic
1187958541 X:24544767-24544789 TTTTGGATGTGTGGGTCAGAGGG + Intergenic
1191067662 X:56367391-56367413 TTTTGCAGCTGGGAGGCAGATGG - Intergenic
1191850496 X:65582470-65582492 GTTTGGGGGTGAGGGTGAGAAGG + Intergenic
1192429628 X:71103339-71103361 TTTGGGGGCTGGGGTGGAGAAGG - Exonic
1193056288 X:77154713-77154735 TTTTGGGGGTGGGGGACAAGGGG + Intergenic
1194234340 X:91363271-91363293 TCTTGGGGATGGGTATCAGAAGG + Intergenic
1194297665 X:92146333-92146355 TTTGGGGGGTGGGGGTGAGAGGG + Intronic
1194972721 X:100361999-100362021 TTTTGCTGCTGGGAGTCTGATGG - Intronic
1195706785 X:107743085-107743107 TGGTGGGGCAGCGGGTCAGACGG - Intronic
1195716684 X:107825578-107825600 TTGTGGGGTTGGGGGACAGGGGG + Intergenic
1197204852 X:123781027-123781049 TTATGGGGCTGGGGGACAAAAGG + Intergenic
1197251210 X:124218011-124218033 TTCCGGGGCTGGGGGTAGGAGGG + Intronic
1197784514 X:130186984-130187006 TTCTGGGGCTGGGAGTTGGATGG - Intergenic
1199380625 X:147168289-147168311 TCTTGGAGCTGGGGTTCATATGG - Intergenic
1199753235 X:150840875-150840897 TATTGGGGGTGGGGGTGATAAGG + Intronic
1200045857 X:153400832-153400854 CTGTGGGGCTGGGGGTCGGGAGG - Intergenic
1200409757 Y:2849561-2849583 TCTTGGGGCTGGAGGACAGAAGG + Intronic
1200615240 Y:5371232-5371254 TTTGGGGGGTGGGGGTGAGAGGG + Intronic
1202376342 Y:24241174-24241196 GTTTGGACCTGGGGGTCTGAGGG - Intergenic
1202494438 Y:25428945-25428967 GTTTGGACCTGGGGGTCTGAGGG + Intergenic