ID: 954249249

View in Genome Browser
Species Human (GRCh38)
Location 3:49355506-49355528
Sequence AGAGAGAACCAGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2047
Summary {0: 1, 1: 2, 2: 10, 3: 142, 4: 1892}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954249240_954249249 3 Left 954249240 3:49355480-49355502 CCCAAGGGGGACTCAAAGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 114
Right 954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG 0: 1
1: 2
2: 10
3: 142
4: 1892
954249239_954249249 4 Left 954249239 3:49355479-49355501 CCCCAAGGGGGACTCAAAGGCTG 0: 1
1: 0
2: 0
3: 22
4: 137
Right 954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG 0: 1
1: 2
2: 10
3: 142
4: 1892
954249242_954249249 2 Left 954249242 3:49355481-49355503 CCAAGGGGGACTCAAAGGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 174
Right 954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG 0: 1
1: 2
2: 10
3: 142
4: 1892
954249237_954249249 13 Left 954249237 3:49355470-49355492 CCTGGGTCACCCCAAGGGGGACT 0: 1
1: 0
2: 1
3: 12
4: 128
Right 954249249 3:49355506-49355528 AGAGAGAACCAGAGGGAGGTGGG 0: 1
1: 2
2: 10
3: 142
4: 1892

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954249249 Original CRISPR AGAGAGAACCAGAGGGAGGT GGG Intergenic
Too many off-targets to display for this crispr