ID: 954249812

View in Genome Browser
Species Human (GRCh38)
Location 3:49358722-49358744
Sequence CTGGCTGTCCCCTGCACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 6, 3: 44, 4: 374}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954249812_954249821 22 Left 954249812 3:49358722-49358744 CCGGCAGTGCAGGGGACAGCCAG 0: 1
1: 0
2: 6
3: 44
4: 374
Right 954249821 3:49358767-49358789 CCTCCTCCCTGTCTCCAAAGCGG 0: 1
1: 0
2: 5
3: 31
4: 369
954249812_954249816 -5 Left 954249812 3:49358722-49358744 CCGGCAGTGCAGGGGACAGCCAG 0: 1
1: 0
2: 6
3: 44
4: 374
Right 954249816 3:49358740-49358762 GCCAGAGGGATCTAGGCTTCCGG 0: 1
1: 0
2: 0
3: 11
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954249812 Original CRISPR CTGGCTGTCCCCTGCACTGC CGG (reversed) Intergenic
900171309 1:1270433-1270455 CTGGCTGAGCTCTGCACTCCAGG - Intronic
900224687 1:1527406-1527428 CTGCCTGACCCCTGCTGTGCTGG - Intronic
900481395 1:2901175-2901197 GTTGCTGTCCTCTGGACTGCAGG + Intergenic
900488668 1:2935544-2935566 TGGCCTTTCCCCTGCACTGCAGG + Intergenic
900927877 1:5717537-5717559 CTGCCCCTCCCCAGCACTGCAGG + Intergenic
901233064 1:7651956-7651978 ATGGCTGTCCCATGCAGTGGTGG - Intronic
901337351 1:8462563-8462585 CAGCCTGTCCGCTGCACAGCAGG + Intronic
902331833 1:15734645-15734667 CTGACTGTCCCCTGCTTGGCTGG + Exonic
902384992 1:16071527-16071549 CTGGCTGTCCCCTGCCCACATGG + Intronic
903188264 1:21641515-21641537 CTGTCTGTCTCCTGCACTGGAGG + Intronic
903546158 1:24124578-24124600 TTAGCTGGCCCCTGGACTGCAGG - Intronic
903939998 1:26923135-26923157 CTGTCTGCCACCTGCAATGCTGG - Intronic
904337836 1:29809664-29809686 CTGGCTGTCCCCAGCACCCATGG + Intergenic
906288225 1:44602377-44602399 GTTGCTGTCCTCTCCACTGCAGG - Intronic
906447790 1:45918410-45918432 CTGGCTGCCCACTACACTTCAGG - Intronic
906509425 1:46402345-46402367 CTGGCAGTCCCTGGCACTGTAGG - Intronic
908179482 1:61589604-61589626 GTGTGTGTCCCCTGCAGTGCAGG + Intergenic
908424841 1:63996799-63996821 CAGGCTCTCTACTGCACTGCTGG - Intronic
912499945 1:110115054-110115076 CTGTCTGTCCCCAGCACTGCAGG + Intergenic
915294712 1:154911895-154911917 CTGGCTGTCCTCAGGACAGCTGG - Intergenic
915297503 1:154931561-154931583 CTGTCTTTCCCATGCAGTGCAGG + Intronic
915655632 1:157357427-157357449 CTGCATGTCCCCTTCACTACTGG + Intergenic
920351193 1:205339143-205339165 CTGGCTGCCCACTGCCCTTCTGG - Intronic
920609828 1:207425268-207425290 CTGGCTGTCCCCTGCCTTTAGGG + Intergenic
920763903 1:208812552-208812574 GTGGCTGTCCTGTGCACTGTAGG + Intergenic
920854910 1:209654320-209654342 TTGGCTCTCCCCTACACTCCCGG + Intergenic
922151153 1:223005408-223005430 CTGGCTTTACTCTGCCCTGCAGG - Exonic
922237936 1:223735711-223735733 CTGGCTGTCCCCCTCGCTGCTGG - Intronic
922728550 1:227937984-227938006 GTGGCTGTGCCCTGCCCTGGGGG + Intronic
1062930248 10:1348145-1348167 CGGGGTGTGCCCTGCATTGCTGG + Intronic
1063368263 10:5504566-5504588 CTTGCTGTCCACTGCACTCCTGG + Intergenic
1065875496 10:29994086-29994108 GTGGCTGTCCCGTGCATTGGAGG + Intergenic
1066299256 10:34082392-34082414 CTGGAACTCCCATGCACTGCAGG + Intergenic
1067082233 10:43218271-43218293 CTGGCTGTCCCTTGCATGGGAGG - Intronic
1067253296 10:44608416-44608438 CTTGATGGCACCTGCACTGCGGG - Intergenic
1067542319 10:47165003-47165025 TTGGATGTCCCCTGCACTGCAGG - Intergenic
1067849698 10:49746878-49746900 CTGGCTCACACCTGCCCTGCAGG - Exonic
1069579940 10:69559073-69559095 CAGGCTGTCCCCTGCTCTTTGGG - Intergenic
1069779475 10:70945781-70945803 CAGGCTGTCCCCTGCCCTCAAGG + Intergenic
1069958042 10:72063519-72063541 CTGGCTGTCCCCTGCTAGGAAGG + Intronic
1075028712 10:119006198-119006220 CTGTCTGTTCCCTTCACTGATGG - Intergenic
1075152118 10:119943343-119943365 CAGTCTGTCCCGTGCACCGCAGG - Exonic
1075714572 10:124548591-124548613 CTGGCTTTGGCCTGCACGGCTGG + Intronic
1075777510 10:124998057-124998079 GTGGCTGTACCAGGCACTGCGGG - Exonic
1076073673 10:127514447-127514469 CTTGCTGTCCTCTGAACTCCAGG + Intergenic
1076203028 10:128573104-128573126 CTGCCTGTCCCCTGCTCCCCTGG - Intergenic
1076470780 10:130716609-130716631 GGTGCTGTCCCCTGCCCTGCAGG + Intergenic
1076615862 10:131754332-131754354 CCACCTCTCCCCTGCACTGCAGG - Intergenic
1076615872 10:131754374-131754396 CCACCTCTCCCCTGCACTGCAGG - Intergenic
1076615892 10:131754458-131754480 CCACCTCTCCCCTGCACTGCAGG - Intergenic
1076615967 10:131754752-131754774 CCACCTCTCCCCTGCACTGCAGG - Intergenic
1076616002 10:131754878-131754900 CCACCTCTCCCCTGCACTGCAGG - Intergenic
1077299916 11:1842096-1842118 GGGGCTGCCCCCAGCACTGCGGG - Intergenic
1077475980 11:2790681-2790703 GTGCCTGTCCCCTCCACTGGGGG - Intronic
1078401876 11:11035521-11035543 CAGGTTGTCCCAGGCACTGCGGG - Intergenic
1079133139 11:17761172-17761194 CTGGCTGTGTGCTGCACTGGCGG + Intronic
1079194157 11:18310242-18310264 CTGGCTTTGCTCTGCTCTGCAGG - Intronic
1080582977 11:33658561-33658583 CTGGGTGCCTCCTGCCCTGCTGG + Intronic
1081595854 11:44459017-44459039 CTGGCTGTGCCCTGCTCAGTTGG - Intergenic
1084009698 11:66340675-66340697 CTGGCTGTCCCCTTGACTTCAGG + Intronic
1084437756 11:69154324-69154346 CAGGCTGTCACCTGTACTGAGGG + Intergenic
1084533863 11:69745638-69745660 CTGGCTGTCCCTGGCACATCTGG + Intergenic
1084750454 11:71201519-71201541 ATGGCGGTCACCTGCACAGCAGG + Intronic
1085170959 11:74449549-74449571 CTGGCTGTTTCCTACACTGCTGG + Intergenic
1087283952 11:96243982-96244004 CTGGCCTTCCTCTGCACTGATGG + Intronic
1088583441 11:111336639-111336661 CTGTCTGTCCCCTGGGCTGGAGG + Intergenic
1089508531 11:118980706-118980728 CTGGCTGGCTCATGCACTGTTGG - Exonic
1089589864 11:119533388-119533410 CTGGATGAGCCCTGCCCTGCCGG + Intergenic
1089974689 11:122722312-122722334 CTGGTTCTCTCCTGCACTCCAGG + Intronic
1090357125 11:126147500-126147522 CAGGCTGTCACCTGCCCCGCAGG + Intergenic
1090865937 11:130700592-130700614 CTTGCTGTGAGCTGCACTGCTGG + Intronic
1091301892 11:134513279-134513301 GTGGCTTTCCCCAGCTCTGCAGG + Intergenic
1091699365 12:2650068-2650090 CTGTCTGTCCCCTGCCTTGAGGG + Intronic
1092169018 12:6361847-6361869 CCTGCTGCTCCCTGCACTGCTGG - Intronic
1093957806 12:25241669-25241691 GGGGCTTTCCCGTGCACTGCAGG + Intronic
1094004629 12:25736567-25736589 TTATCTGTTCCCTGCACTGCCGG - Intergenic
1094682741 12:32679869-32679891 CTGGCTGTTCCCATCACTGTTGG + Intronic
1095357107 12:41288199-41288221 CAGCCTCTCCCCTGGACTGCTGG + Intronic
1096604529 12:52755102-52755124 CTGCCTCTCCCCTGCAGTGAGGG + Intergenic
1097176362 12:57145692-57145714 CTGGATGGCCCCTGCATTTCTGG + Intronic
1101781797 12:107844366-107844388 CTGGCTGTCTCCTCCTCAGCGGG - Intergenic
1101925445 12:108967691-108967713 GGGGCTGTCCCATGCACTGTGGG + Intronic
1102002192 12:109564155-109564177 GGGGCTGTCCCCTGCATTGCAGG + Intronic
1102354005 12:112217086-112217108 CTGGCTGACCCCAGCGCTGGGGG - Exonic
1102548507 12:113674053-113674075 CTCGCTCTCCCCTGCCCAGCCGG - Intergenic
1103232562 12:119344134-119344156 TAGGCTGTCCCTTGCATTGCAGG + Intronic
1103621617 12:122190422-122190444 CTGGCTGTGCCCCGCCCTCCTGG + Intronic
1103967778 12:124651175-124651197 CTGGCTGGTCCCTGCAGTCCAGG + Intergenic
1103968122 12:124652974-124652996 CCTTCTCTCCCCTGCACTGCAGG - Intergenic
1104953991 12:132454929-132454951 CCAGCTGCCCCCTGCACGGCCGG - Intergenic
1105870666 13:24503430-24503452 CTCCCTGTTCCCTGAACTGCAGG - Intronic
1106484152 13:30157855-30157877 CTGGCCGCCTCCTGCACAGCAGG + Intergenic
1106903641 13:34381897-34381919 CTTTCTGTCTCCTGCACTTCAGG - Intergenic
1112424225 13:99282085-99282107 GGGGCGGTCCCGTGCACTGCAGG + Intronic
1113295062 13:108950569-108950591 CTCACTGCCCCCTGCATTGCTGG + Intronic
1113528371 13:111000510-111000532 CTGGCTCTCCCCTCCAAGGCTGG + Intergenic
1113573901 13:111381465-111381487 CTGGCTGTGCTCTGCACCTCTGG + Intergenic
1113926958 13:113947001-113947023 CTGGCTGTGGCCAGCACTGCAGG + Intergenic
1114339623 14:21729548-21729570 CTTGCTGTCATCAGCACTGCAGG + Intergenic
1114634314 14:24178781-24178803 CTGGCTACCCCCTGAACTACTGG + Exonic
1116448482 14:45038966-45038988 CTGGGTCTCCCCTCCACTGAGGG - Intronic
1118312789 14:64705529-64705551 GTGCCTGTCCCCTGCTCTGGGGG + Intronic
1118343505 14:64916028-64916050 GTGGCTGTCCCATGTATTGCTGG - Intronic
1118605936 14:67503536-67503558 ATGGCTGCCCACTGCCCTGCGGG + Intronic
1118777156 14:68979906-68979928 CCGGCTGATCCCTGCCCTGCAGG + Intergenic
1119348728 14:73946934-73946956 CTTTCTGACCCCTGCACTCCAGG + Intronic
1119540063 14:75432111-75432133 ATGGCTGTCCCCAGCTCTGCAGG - Intronic
1121489223 14:94346030-94346052 GGGGCTTTCCCGTGCACTGCAGG - Intergenic
1121489235 14:94346086-94346108 GGGGCTTTCCCGTGCACTGCAGG - Intergenic
1121489247 14:94346142-94346164 GGGGCTTTCCCGTGCACTGCAGG - Intergenic
1121489269 14:94346254-94346276 GGGGCTTTCCCGTGCACTGCAGG - Intergenic
1121489280 14:94346310-94346332 GGGGCTTTCCCGTGCACTGCAGG - Intergenic
1121489291 14:94346366-94346388 GGGGCTTTCCCGTGCACTGCAGG - Intergenic
1121489313 14:94346478-94346500 GGGGCTTTCCCGTGCACTGCAGG - Intergenic
1122782431 14:104149369-104149391 CTGGCTGGCACCTGGGCTGCTGG + Intronic
1122792080 14:104188209-104188231 CTGGCCGGCCACTGCACTTCAGG + Intergenic
1122995491 14:105261738-105261760 CCTGCCGGCCCCTGCACTGCTGG - Intronic
1123804064 15:23853278-23853300 CTTGGTCTCCCCTGCACTGGTGG - Intergenic
1124006882 15:25801726-25801748 CTGGCTTTGCTCAGCACTGCTGG + Intronic
1124082713 15:26516573-26516595 CCAGCTGTCCCCTGGAGTGCAGG + Intergenic
1124082881 15:26517596-26517618 CTGGCTGGGCCCAGCACTGCTGG - Intergenic
1127599953 15:60525299-60525321 CTGGCTGGACGCTGCACTGTGGG + Intronic
1127641376 15:60918952-60918974 CTGCCTGTCCTCTGCTCTGTGGG + Intronic
1128152731 15:65373343-65373365 CCAGCCTTCCCCTGCACTGCCGG + Intronic
1129233856 15:74212132-74212154 CTGTCTGTCCCCAGTGCTGCAGG + Intronic
1129513614 15:76142932-76142954 CTGGCAGTCCTCTGCAGTCCTGG + Intronic
1129521150 15:76187012-76187034 CGGGCTGTCAGCTGCATTGCAGG - Intronic
1129605445 15:77022819-77022841 CTTCCTGTCCCCTGGGCTGCAGG - Intronic
1129613764 15:77082093-77082115 CTCCCTGTCCCCAGTACTGCTGG - Intronic
1129911291 15:79228884-79228906 CTGTCTGTCCTGTGCATTGCAGG - Intergenic
1130286269 15:82557653-82557675 ATGCCTGTCCCCTGGAATGCAGG - Intronic
1131329832 15:91486773-91486795 CAGGGCTTCCCCTGCACTGCTGG - Intergenic
1131501964 15:92976784-92976806 CTGCCTGTCTCCTGAACAGCTGG - Intronic
1131799734 15:96056672-96056694 GGGGCTGTCCTATGCACTGCAGG + Intergenic
1132293890 15:100720857-100720879 CTGGCTGCCCCCTCCCCTGAGGG - Intergenic
1132415057 15:101613683-101613705 CTCGCTGTCACGTGCTCTGCTGG - Intergenic
1132542271 16:516062-516084 CCGGCCGGCCTCTGCACTGCCGG - Intronic
1132587232 16:710866-710888 CTGCCTGTGCCACGCACTGCTGG + Intronic
1132599894 16:768746-768768 CTTGCTGGCCCCAGCCCTGCTGG + Exonic
1133334334 16:4996983-4997005 CTGGCAACCCCCTGCCCTGCTGG + Exonic
1133578761 16:7122596-7122618 CTGGATTTCTCCTGTACTGCTGG + Intronic
1133591349 16:7247324-7247346 GTGAGTGTCCCCTCCACTGCGGG - Intronic
1133836488 16:9372271-9372293 GGGGCTGTCCCATGCATTGCAGG + Intergenic
1134421458 16:14094783-14094805 CTGGCGCTCCGCTGCACTCCAGG + Intronic
1134541372 16:15069275-15069297 GGGGCTGTCCTCTGCACTGTAGG - Intronic
1135359362 16:21798855-21798877 GGGGCTGTCCTCTGCACTGTAGG - Intergenic
1135436829 16:22433832-22433854 GGGGCTGTCCTCTGCACTGTAGG - Intronic
1136263431 16:29098085-29098107 GGGGCTGTCCTCTGCACTGTAGG + Intergenic
1138203091 16:55104605-55104627 CTGGCTGTACCCTGTATTGAAGG + Intergenic
1139212832 16:65097481-65097503 AGGGCTGTCCTGTGCACTGCAGG + Intronic
1141171798 16:81696319-81696341 CTGGCTGTCAGCTGCACAGGAGG - Intronic
1141290420 16:82713456-82713478 CTGCCTGCCCCCAGCACTGTTGG + Intronic
1141605748 16:85152439-85152461 CTGGGTGTCCCAGGCTCTGCAGG + Intergenic
1141672901 16:85502167-85502189 CTGGCTGTCCCAAGCTCAGCTGG - Intergenic
1141804793 16:86335557-86335579 CTGGATGGCCCCTGCACCTCTGG + Intergenic
1142064935 16:88056631-88056653 CACGCTGGCCCCTGCACTCCTGG + Intronic
1142398184 16:89844944-89844966 CAGTCTGTCCCGGGCACTGCAGG - Intronic
1143091181 17:4449905-4449927 CTGGCTGTCTGCTGCCCGGCTGG + Intronic
1143554670 17:7652592-7652614 CTGGCTCTCCCAAGCATTGCTGG - Intronic
1143765964 17:9137985-9138007 CTGGTTGCCCACTGCACTTCAGG - Intronic
1144576627 17:16433759-16433781 GCAGCTGTGCCCTGCACTGCAGG - Intronic
1144930946 17:18858300-18858322 CTGGCTGGCTCCGGCATTGCGGG + Intronic
1145018292 17:19412762-19412784 GCCGCTGCCCCCTGCACTGCAGG + Exonic
1145059194 17:19721472-19721494 CTGTCTCTCCCCTGGCCTGCAGG - Intergenic
1146543657 17:33719291-33719313 CAGGCTCTCCCTTGCACTCCTGG - Intronic
1147034583 17:37670714-37670736 CTAGGTGTCCCCTTCACTACAGG - Intergenic
1151401253 17:73857461-73857483 GGGGCTGTCCCATGCACTACAGG - Intergenic
1151489581 17:74424896-74424918 CTGGCCCTGCCCTGCCCTGCTGG + Intronic
1151891222 17:76951546-76951568 ATGGCTGTCCTGTGCACTGGAGG - Intergenic
1152279543 17:79377143-79377165 CTGGCTTTCCACTGCCCAGCTGG + Intronic
1152409530 17:80116415-80116437 CTGGATGCCCCCTGCACGTCCGG + Intergenic
1152450750 17:80378017-80378039 TGGGCTGTCCTGTGCACTGCAGG + Intronic
1152716791 17:81904121-81904143 CAGGCTGCCCGCTGCACTCCCGG + Intronic
1152787606 17:82257657-82257679 TGGGCTGCCCCCTGCACTGCTGG + Intronic
1153027674 18:686462-686484 TGGTCTGTCCCCTGCAGTGCAGG + Intronic
1154039453 18:10839376-10839398 CTGGATATCCCCACCACTGCAGG - Intronic
1154270272 18:12912329-12912351 CTCTCTGTCCCCGGCTCTGCGGG - Intronic
1154290361 18:13101528-13101550 CTGTCTGTCTCCCTCACTGCTGG + Intronic
1155623460 18:27807773-27807795 CTGGCTGTCCCCTGAGCTGATGG - Intergenic
1156402954 18:36757397-36757419 CTTGGTGTCCCAGGCACTGCTGG - Intronic
1156452037 18:37272252-37272274 GTGGCTGTCCTGTGCACTGTAGG + Intronic
1157380171 18:47207153-47207175 CTGTCTGCCCCTTTCACTGCAGG - Intergenic
1157566289 18:48681087-48681109 CTGCCTGGCCGCTGCAATGCTGG - Intronic
1157574127 18:48732393-48732415 CTGGGTGTGCACTGCCCTGCTGG - Intronic
1157989802 18:52481331-52481353 CCGGCTGTCACCTGCAATCCTGG + Intronic
1158216230 18:55103319-55103341 CTGTCTGTCCCCTGCCCTCTGGG - Intergenic
1158326055 18:56314936-56314958 GTGACTGTCCCTTGCACTGTGGG + Intergenic
1158544098 18:58381245-58381267 CTGGTTCTCCCCTTCACTGTGGG - Intronic
1160047993 18:75405788-75405810 CTGGCCTTCCCCTTCACAGCAGG - Intergenic
1161601492 19:5186567-5186589 CTGGCTCTCTCCCGCAGTGCTGG - Intronic
1162064228 19:8115417-8115439 CTGGCTGTGCTCTGCCCTGGGGG + Intronic
1162494795 19:11017691-11017713 CTGACTGTCCCCATCACTCCAGG + Intronic
1162502592 19:11062501-11062523 CTGCCTGCTCCCTGCACTGTAGG - Intronic
1162514210 19:11138505-11138527 CAGGCTGCCCCCAGCCCTGCAGG - Intronic
1163013015 19:14437070-14437092 GAGGCTGTCCTGTGCACTGCAGG + Intronic
1163598345 19:18233284-18233306 CTCGCTGTCGCCTCCACTCCCGG - Exonic
1164448047 19:28334369-28334391 CTGCCTGTCTCCTCCCCTGCTGG - Intergenic
1164720357 19:30427463-30427485 CTTGCTGTCCCCTGCACCCTTGG - Intronic
1164732562 19:30517384-30517406 CTGGCTGGCCCCCACCCTGCAGG - Intronic
1164752911 19:30669484-30669506 CTGGCAGTCCCCTACTCTCCAGG - Intronic
1164792250 19:30997133-30997155 CTGCCTGTGGCCTGCTCTGCAGG + Intergenic
1165915537 19:39256771-39256793 CTGGCTGCCCCCTGCAAGTCTGG + Intergenic
1166432735 19:42740860-42740882 CTGGCTCTCCCCTTCAGTGCAGG + Intronic
1166435843 19:42766088-42766110 CTGGCTCTCCCCTTCAGTGCAGG + Intronic
1166445724 19:42856116-42856138 CTGGCTCTCCCTTGCAGTGCAGG + Intronic
1166448706 19:42880076-42880098 CAGGCTCTCCCCTTCAGTGCAGG + Intronic
1166453114 19:42918264-42918286 CTGGCTCTCCCCTTCAGTGCAGG + Intronic
1166455599 19:42937575-42937597 CTGGCTCTCCCCTGCAGTGCAGG + Intronic
1166465388 19:43026850-43026872 CTGGCTCTCCCCTTCAGTGCAGG + Intronic
1166471521 19:43083055-43083077 CTGGCTCTCCCCTTCAGTGCAGG + Intronic
1166482660 19:43186870-43186892 CTGGCTCTCCCCTTCAGTGCAGG + Intronic
1166485139 19:43206011-43206033 CTGGCTCTCCCCTTCAGTGCAGG + Intronic
1166492285 19:43269922-43269944 CTGGCTCTCCCCTTCAGTGCAGG + Intergenic
1166492463 19:43270783-43270805 CTGCCTGCCCCCTGCACCCCAGG - Intergenic
1167264242 19:48475492-48475514 CTGGCTATTCCCTCCACAGCTGG - Intronic
1168314409 19:55478150-55478172 AGGGCTGTCCTGTGCACTGCAGG - Intronic
925129105 2:1481861-1481883 GAGGCTGTTCCCTGCCCTGCAGG + Intronic
925192837 2:1899229-1899251 TTGGCTCTGCCCTGCACTGTGGG + Intronic
925266504 2:2570076-2570098 CTAGCTGTCCCCAGGCCTGCCGG - Intergenic
926060111 2:9799934-9799956 CTGGCCCTTCCCTGCCCTGCCGG - Intergenic
926302715 2:11616193-11616215 CGGGCTGTGCCCTGCCCTTCTGG + Intronic
927807947 2:26164800-26164822 CTGGCTGTGCCCTGCTGTGTAGG + Intergenic
928085977 2:28346688-28346710 CAGGCCAGCCCCTGCACTGCGGG + Intergenic
928453077 2:31396181-31396203 CTTGCTCTGCTCTGCACTGCAGG + Intronic
928549693 2:32357985-32358007 CGGTCTGTCCCCCGCACTGCGGG - Intronic
929879543 2:45823983-45824005 CTGGCTTTCCTTGGCACTGCAGG + Intronic
932735443 2:74251140-74251162 GGGGCTGTCCCATGCACTGCAGG + Intronic
933227748 2:79770160-79770182 ATGGCTGTCCTGTGCATTGCAGG - Intronic
934576025 2:95402188-95402210 CAGGCCTTCACCTGCACTGCTGG - Intergenic
934638202 2:96010045-96010067 CAGGCCTTCACCTGCACTGCTGG - Intergenic
934795449 2:97095365-97095387 CAGGCCTTCACCTGCACTGCTGG + Intergenic
934861214 2:97764855-97764877 CTGGCTGTCACCTGCTCTCCCGG + Intronic
935121277 2:100185647-100185669 CTTGCTGTCCCCTGCCCCGAAGG - Intergenic
935693928 2:105754275-105754297 CTGGCTGCCCCCACCATTGCTGG - Intronic
936252485 2:110877278-110877300 CTGCCTGCCCTCTGCTCTGCAGG + Intronic
937325281 2:120986446-120986468 CTGGCTGCCCCCTCCGCTGGTGG + Exonic
938965156 2:136381669-136381691 CTTGCTCTCCCATCCACTGCAGG - Intergenic
940851533 2:158691722-158691744 CTGGCTGTGCCCTGTACTCTGGG - Intergenic
941620929 2:167777976-167777998 CTGGCTGTCCTGTGCATTGTAGG - Intergenic
943892120 2:193302117-193302139 TTGGATGTCCCATGCACTGTAGG + Intergenic
944651855 2:201838316-201838338 GGGGCTGTCCTCTGCACTGTAGG - Intronic
944826248 2:203485836-203485858 GTGGCTGTCCCATGCACTGTAGG - Intronic
946414583 2:219533452-219533474 ATGGCTGTCCACAGCCCTGCCGG - Intronic
946662758 2:222018983-222019005 GTGGCTGTCCCCTGCAGGCCTGG + Intergenic
947577701 2:231289616-231289638 CTGCCTTGGCCCTGCACTGCTGG - Intronic
948413315 2:237781745-237781767 GTGGCTGTCCCCTGCACCGTGGG + Intronic
948566448 2:238890211-238890233 CTGGCTGACCCCAGCCCAGCAGG - Intronic
948660896 2:239505865-239505887 GGGGGTGTCACCTGCACTGCCGG + Intergenic
1169140481 20:3224712-3224734 CTGGGTGTTCCCTGCACAGGGGG - Intergenic
1169488526 20:6052913-6052935 CTGGATGTTCCCTGCAGGGCGGG + Intronic
1170039920 20:12029037-12029059 ATGGCTGTTATCTGCACTGCAGG - Intergenic
1170833065 20:19860123-19860145 CTGGCTGCCCCTTGCACTTCTGG + Intergenic
1173798153 20:45877130-45877152 CTGGCTGTCACCCACACTGAAGG - Exonic
1173873290 20:46354965-46354987 GTGCCTGTCCCCCGCCCTGCAGG - Exonic
1174412960 20:50347795-50347817 GGGGCTGTCCCATGCATTGCAGG + Intergenic
1174671818 20:52315274-52315296 CAGGCTGTCCTGTGCATTGCAGG - Intergenic
1175176580 20:57115985-57116007 CTGCCAGTCACCTGCGCTGCAGG + Intergenic
1175951212 20:62584375-62584397 CAGGCTGTCCCCAGAACTGCTGG + Intergenic
1176219845 20:63964701-63964723 CAGGCTGTCCGCAGCCCTGCAGG + Exonic
1176388026 21:6149035-6149057 CTGCCTGCCGCCTGCCCTGCAGG + Intergenic
1178176256 21:30103119-30103141 CTCTCTGTGCCCTGCACTGATGG + Intergenic
1178877508 21:36424126-36424148 TTGGCCTTCCTCTGCACTGCTGG - Intergenic
1179640693 21:42745657-42745679 CTGGCTGTCCCTTGCGCCCCAGG + Intronic
1179735446 21:43389213-43389235 CTGCCTGCCGCCTGCCCTGCAGG - Intergenic
1179880387 21:44291178-44291200 CTGCCTGTCCCCTCCGCTCCGGG + Exonic
1180612898 22:17109178-17109200 CTGGCTGACCCCGGGGCTGCAGG - Exonic
1180832797 22:18914638-18914660 CTGGCTGCCCCCTCCCCTGCTGG + Intronic
1181067024 22:20311614-20311636 CTGGCTGCCCCCTCCCCTGCTGG - Intergenic
1181455622 22:23058736-23058758 CTGCTTGTCACCTTCACTGCAGG + Intergenic
1181523014 22:23460104-23460126 CTGGGGGTCCCAGGCACTGCAGG - Intergenic
1182102775 22:27669720-27669742 CCGCCTCACCCCTGCACTGCAGG + Intergenic
1182155142 22:28064472-28064494 CTGGCTGACCCCTGAACCACTGG + Intronic
1183142260 22:35953491-35953513 CTGTCTTTCCCCTTCCCTGCTGG - Intronic
1183248488 22:36711650-36711672 ATGGCTGTCCCCAGCAATCCTGG - Intergenic
1183347702 22:37317134-37317156 CTGGCTGTCCCTTGCAGGGACGG + Intergenic
1184405722 22:44299350-44299372 CTGGCTGGCCCCTCCCCTGAAGG + Intronic
1184476837 22:44726679-44726701 CTGGCTGGCTGCTGGACTGCTGG + Intronic
1203282882 22_KI270734v1_random:139942-139964 CTGGCTGCCCCCTCCCCTGCTGG + Intergenic
950099522 3:10348359-10348381 CAGGCCGTGCTCTGCACTGCAGG + Intronic
950265585 3:11570461-11570483 CTGGCTGGACCGTGCACTCCCGG + Intronic
950451638 3:13068719-13068741 CTTGCTGTCCCCTGCACCCGGGG + Intronic
951102965 3:18710620-18710642 CTGGCTGTTCTATGCACTGCAGG + Intergenic
951625270 3:24654171-24654193 CTGGCTGTCCAGTGCACTGTAGG - Intergenic
952764963 3:36945500-36945522 CTCGCTGCCCCCTTCACTCCCGG - Intergenic
952769883 3:36989677-36989699 CAGGCTGTCCCATGCACTGCAGG + Exonic
954249812 3:49358722-49358744 CTGGCTGTCCCCTGCACTGCCGG - Intergenic
954625319 3:52019284-52019306 CTGCCTGTCCCCTGCTCAGGTGG - Intergenic
955027008 3:55177953-55177975 CAGGCTCTTGCCTGCACTGCTGG + Intergenic
955694215 3:61619489-61619511 GTGGCTGTCCTGTGCACTACTGG - Intronic
956193493 3:66629759-66629781 CTTGCTCTCCCCTGGCCTGCTGG - Intergenic
956330644 3:68103131-68103153 CTGGCTCCAGCCTGCACTGCAGG - Intronic
956583528 3:70840057-70840079 CTGTCTGTCCCCTGCATCGAAGG + Intergenic
956673680 3:71715180-71715202 AGGGCTGTCCCGTGCACTGTAGG - Intronic
957976205 3:87448025-87448047 CTGGCTAGCCCCATCACTGCAGG - Intergenic
961075153 3:123975540-123975562 GTGTCTGTCCCCTGCCCTGCAGG - Exonic
961306235 3:125960254-125960276 CTGCCTGATCACTGCACTGCAGG - Intergenic
961308542 3:125976982-125977004 GTGTCTGTCCCCTGCCCTGCAGG + Exonic
961504714 3:127362492-127362514 CTTTCTGCCCCCAGCACTGCTGG - Intergenic
961574839 3:127825958-127825980 CTGGTTCTCTCCTACACTGCTGG - Intergenic
961656007 3:128442163-128442185 CTGGATGTCCCAGGCTCTGCAGG + Intergenic
961828838 3:129612918-129612940 CTGGCTGTTCCCTGTTCTCCAGG + Intergenic
964157095 3:153599617-153599639 CTGTCTTTCCCCTGAAGTGCTGG - Intergenic
965542083 3:169880424-169880446 CTGGCCATCCTCTGCCCTGCTGG - Intergenic
965700822 3:171458332-171458354 CCGGCTGCCCCCTGCGCAGCGGG - Intronic
966423991 3:179761378-179761400 CTGGCTTTCTCCTCCACTGCAGG - Intronic
966476386 3:180352762-180352784 TTGTATGTCCCCTGAACTGCTGG - Intergenic
967906372 3:194504297-194504319 GGGGCTGTCCTGTGCACTGCAGG + Intergenic
968092925 3:195909441-195909463 CGGGCTGAGCCCTGCGCTGCCGG - Intronic
968287403 3:197517108-197517130 CTGCCTGTCTCCTGGGCTGCTGG + Intronic
968652650 4:1766346-1766368 CTGGCACTCGCCTGCCCTGCGGG - Intergenic
968941829 4:3643064-3643086 CTGGCTCTCCACTGCCCTGAGGG + Intergenic
969958557 4:10918370-10918392 GGGACTGTCCTCTGCACTGCAGG + Intergenic
970961136 4:21872132-21872154 CTGGCTCTCCCCTTCTCTGAGGG - Intronic
971094692 4:23387478-23387500 CAGCCTGTCCCCTTCATTGCTGG + Intergenic
971167573 4:24199740-24199762 CGGTCATTCCCCTGCACTGCTGG + Intergenic
978628304 4:110712935-110712957 CTTGCTTTCCCCTGCCCTTCTGG + Intergenic
979336592 4:119470523-119470545 CTGGCTTTCCCCTATACTCCTGG + Intergenic
983012237 4:162562300-162562322 CTGCATGTCCCTTTCACTGCTGG - Intergenic
986349902 5:6867534-6867556 CTGCCTCTCCCCTGCACTCCTGG - Intergenic
986369752 5:7068334-7068356 GGGGCTGTCCCTTGCCCTGCAGG - Intergenic
990858166 5:60295539-60295561 GGTGCTGTCCCGTGCACTGCAGG + Intronic
991593294 5:68276896-68276918 GTGGCTGTCACCTGCTCTTCTGG - Intronic
995461394 5:112406971-112406993 CTGGCTGTCTGCTGCACTTTGGG + Intronic
995736342 5:115304068-115304090 CTGCCTGTCTTCTCCACTGCTGG + Intergenic
996137993 5:119868878-119868900 CAGGCTGCCTCCTGCCCTGCTGG - Intergenic
998957581 5:147453488-147453510 CTCCCTGTCCGCTGCGCTGCGGG - Intronic
999042339 5:148427913-148427935 CAGACTGTCCCATGTACTGCTGG + Intronic
1000063649 5:157677222-157677244 AGGGCTGTCCCATACACTGCGGG - Intronic
1000441635 5:161270761-161270783 CAGGCTGTCCTCTGCATTGTAGG + Intergenic
1001041306 5:168337483-168337505 GGGGCTGTCCTGTGCACTGCAGG - Intronic
1001305156 5:170567080-170567102 ATGGCCTTCCCCTGCACTTCAGG - Intronic
1001549025 5:172588602-172588624 CCGGCTGTCCACTGCACGGCTGG - Intergenic
1003187157 6:3841884-3841906 CCGGCTGTCCCTTGGCCTGCTGG + Intergenic
1004392593 6:15222068-15222090 CTGTCTTGACCCTGCACTGCAGG + Intergenic
1004426320 6:15509604-15509626 CTGGCTGTCCCCTCCCCAGCTGG - Intronic
1005673829 6:28134139-28134161 GGGGCTGTCCTCTGCACTGTAGG + Intergenic
1005981169 6:30837909-30837931 CAGACTGTCCCATGCATTGCTGG - Intergenic
1005992296 6:30910878-30910900 CTGGCTGACAGCTGCACTGGGGG - Exonic
1006541875 6:34746638-34746660 CAGCCTCTCCCCTGCACTTCAGG + Intergenic
1007483064 6:42162747-42162769 ATGGCTCTCCCCTGCTCTGGAGG + Intronic
1007984013 6:46189379-46189401 GGGGCTGTCCTGTGCACTGCAGG + Intergenic
1008594060 6:53023514-53023536 CTCATTGTCCCCTGCACTACTGG - Intronic
1009416684 6:63423391-63423413 CTGCCTGCCTCCTGCAGTGCTGG - Intergenic
1010275843 6:73967504-73967526 CTGGCTTTTGCCTGCACTGATGG + Intergenic
1015994513 6:138984478-138984500 GAGGCTGTCCTGTGCACTGCAGG + Intronic
1016979090 6:149837828-149837850 CTGGCTGTCGATTGCTCTGCAGG + Intronic
1017098973 6:150830937-150830959 GTTGCTCTCCCCAGCACTGCTGG - Exonic
1017099555 6:150835673-150835695 CTGGCTGTTCCCTGTACATCTGG + Intronic
1017822426 6:158059361-158059383 CAGGCTGTCCTCTCCACAGCTGG + Intronic
1018034048 6:159866771-159866793 CTGCCTGTCACCTCAACTGCAGG + Intergenic
1019310610 7:358943-358965 CTCTCTGTCCCCTGCCCTTCGGG + Intergenic
1019361232 7:605145-605167 GTGTGTGTCCCCTGCTCTGCCGG - Intronic
1019414051 7:919332-919354 GTGGCTGGCCCCTCCTCTGCTGG - Intronic
1019482904 7:1274588-1274610 GGTTCTGTCCCCTGCACTGCGGG + Intergenic
1019542872 7:1559440-1559462 CTGCCTGCCTCCTTCACTGCTGG + Intronic
1020106466 7:5424362-5424384 CTGGCTGCACCCCGCACTCCGGG + Intronic
1021542707 7:21777531-21777553 CTGGCTCTCTCATACACTGCTGG - Intronic
1022339540 7:29455522-29455544 GTGGCTTTCCCCACCACTGCAGG + Intronic
1023815096 7:43943494-43943516 GTGGCTCTCCTGTGCACTGCAGG - Intronic
1024429566 7:49271021-49271043 GCGGCTGTCCGGTGCACTGCAGG + Intergenic
1024525214 7:50342847-50342869 CACGCTGTCTCCTGAACTGCAGG - Intronic
1029611459 7:101628725-101628747 CTGCCTGAACCCAGCACTGCCGG - Intronic
1030522359 7:110613824-110613846 TTGGCTGTCTCATACACTGCTGG + Intergenic
1031076350 7:117216677-117216699 TTGACTGGGCCCTGCACTGCAGG + Intronic
1031412573 7:121457278-121457300 CTGGCTAGCCCCATCACTGCAGG - Intergenic
1033275430 7:139967923-139967945 CAGGCTGTTCCAGGCACTGCCGG - Intronic
1034079290 7:148261643-148261665 CTGGCTGCCCTCTGGAGTGCAGG + Intronic
1034433856 7:151053892-151053914 CCGGCTGGGCCCAGCACTGCTGG + Exonic
1035319509 7:158019754-158019776 CTGGCTGTGCCTGGCAATGCCGG + Intronic
1035437962 7:158873411-158873433 CTGTTTATCCCCTTCACTGCTGG + Intronic
1035735072 8:1881800-1881822 CTGGTTCTCAGCTGCACTGCTGG + Intronic
1037951443 8:23020887-23020909 CGCGTTGTCCCCTGCACTTCTGG - Exonic
1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG + Intronic
1039308528 8:36290965-36290987 GGGTCTGTCCCATGCACTGCAGG + Intergenic
1039799109 8:40938898-40938920 CTGGCTGATCCCTGCAGGGCCGG - Intergenic
1041131387 8:54705570-54705592 CTGGCTGACCCAAGCTCTGCAGG + Intergenic
1041941237 8:63390429-63390451 GGGGCTGTCCTGTGCACTGCAGG - Intergenic
1042165257 8:65938947-65938969 CTGGGTTTCCCATGCACTTCAGG + Intergenic
1042999990 8:74746435-74746457 GTGTCTGTCCCCTTCACTGAGGG - Intronic
1043554930 8:81420303-81420325 CTGGCTGTCCACTTCAATGTGGG + Intergenic
1044328960 8:90893709-90893731 CTGATTGCCTCCTGCACTGCTGG - Intronic
1046849094 8:118952400-118952422 CTGCCTGACCCCTTCACTTCGGG + Intergenic
1047201344 8:122770242-122770264 CTGGCTGGGCCCAGCACAGCTGG - Intergenic
1047311115 8:123692936-123692958 TGGGCTGTCCTGTGCACTGCAGG + Intronic
1047636225 8:126765561-126765583 GGGGCTGTCCCGTGCATTGCAGG - Intergenic
1048037137 8:130688132-130688154 GATGCTTTCCCCTGCACTGCAGG + Intergenic
1049233505 8:141496309-141496331 CTGGCAGTCACCTGCACTGTAGG + Intergenic
1049755777 8:144310758-144310780 CTGGCTGTCCCATGTCCTGTAGG - Intronic
1050279089 9:4032082-4032104 CTTGGTGTCCCTTGCTCTGCAGG - Intronic
1051209067 9:14722454-14722476 CTGGCCTTCCCCTGCAGGGCTGG + Exonic
1052514553 9:29462991-29463013 TTTGGAGTCCCCTGCACTGCAGG - Intergenic
1053285851 9:36849088-36849110 CTGGCTTTGCCCTGACCTGCAGG + Intronic
1054296325 9:63334496-63334518 CTCGGTCTCCACTGCACTGCTGG - Intergenic
1054394342 9:64639001-64639023 CTCGGTCTCCACTGCACTGCTGG - Intergenic
1054428991 9:65144200-65144222 CTCGGTCTCCACTGCACTGCTGG - Intergenic
1055110758 9:72556994-72557016 GGGGCTGTCCTGTGCACTGCAGG - Intronic
1056861084 9:90182638-90182660 GTGGATGTCCCCTCCACTACAGG - Intergenic
1057414253 9:94847229-94847251 CTCCTTGTACCCTGCACTGCAGG - Intronic
1058534957 9:105949716-105949738 GTGGCTGTCCCTTTAACTGCTGG + Intergenic
1058609013 9:106755000-106755022 GTGGCTGTCCTGAGCACTGCAGG + Intergenic
1060838372 9:126775501-126775523 CTGGCTCTCCCCAGCCCAGCTGG + Intergenic
1060908939 9:127333450-127333472 CTGGATGTCCCCTGGACTGCAGG - Intronic
1060920286 9:127415707-127415729 CTGGAACTCCCCTACACTGCTGG - Intergenic
1061196374 9:129109321-129109343 CTGGCTGTCCCATCCACTGATGG - Intronic
1061871300 9:133522204-133522226 AGGTCTGCCCCCTGCACTGCAGG - Intronic
1062034067 9:134375018-134375040 CTGACTGTGCCCTGCACTGCAGG + Intronic
1062086643 9:134652606-134652628 GGGGCTGTCCCGTGCACTGTGGG - Intronic
1062091071 9:134679223-134679245 CGATCTGTCCCCTGCACTGTGGG + Intronic
1062172018 9:135140091-135140113 CTTCCTTTCCCCTGCAGTGCTGG - Intergenic
1062267305 9:135693064-135693086 CTGGCTTCCACCTCCACTGCTGG - Intergenic
1062482654 9:136759563-136759585 CTGACTGACCCCAGCACTGCTGG - Intergenic
1186232065 X:7466209-7466231 CAGGCTGTCCTGTGCACTGCAGG - Intergenic
1186699791 X:12077996-12078018 CTGGCTGACACCAGCATTGCAGG - Intergenic
1186965094 X:14778349-14778371 ATGGCTGTCCTGTGCACTGCAGG - Intergenic
1187212822 X:17246603-17246625 CTGGCTCTGCTCTGCATTGCTGG - Intergenic
1187885597 X:23886028-23886050 GGGGCTGTCCTGTGCACTGCAGG + Intronic
1190709712 X:53058220-53058242 GTGGGTGTGACCTGCACTGCTGG + Intronic
1192179491 X:68907506-68907528 CTGGCTCTCCTCTGGCCTGCAGG + Intergenic
1192195389 X:69024399-69024421 CCGGGTGCCCCCTGCCCTGCTGG - Intergenic
1194532803 X:95071928-95071950 CTGGCTTTCCCCTACTCTTCTGG + Intergenic
1195675864 X:107506909-107506931 CTGGCTGTGCCCAGCGCTGAAGG - Intergenic
1196462866 X:115947686-115947708 CTGGCTGTCTTCTGTACTGATGG - Intergenic
1199597340 X:149516568-149516590 CTAGCTGTCTCCTGCCCTGTAGG - Intronic
1200869416 Y:8081366-8081388 CTGCCTGTGCCCTGCCCTGCAGG - Intergenic
1201599128 Y:15708634-15708656 GAGGCTGTCCCATGCACTGTAGG - Intergenic