ID: 954253409 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:49386141-49386163 |
| Sequence | CTGAATCTACAGATCGATTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2330 | |||
| Summary | {0: 1, 1: 9, 2: 40, 3: 383, 4: 1897} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 954253407_954253409 | 4 | Left | 954253407 | 3:49386114-49386136 | CCAGCTGGAATTTTGATAGGAAT | 0: 5 1: 23 2: 97 3: 299 4: 825 |
||
| Right | 954253409 | 3:49386141-49386163 | CTGAATCTACAGATCGATTTGGG | 0: 1 1: 9 2: 40 3: 383 4: 1897 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 954253409 | Original CRISPR | CTGAATCTACAGATCGATTT GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||