ID: 954253409

View in Genome Browser
Species Human (GRCh38)
Location 3:49386141-49386163
Sequence CTGAATCTACAGATCGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2330
Summary {0: 1, 1: 9, 2: 40, 3: 383, 4: 1897}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954253407_954253409 4 Left 954253407 3:49386114-49386136 CCAGCTGGAATTTTGATAGGAAT 0: 5
1: 23
2: 97
3: 299
4: 825
Right 954253409 3:49386141-49386163 CTGAATCTACAGATCGATTTGGG 0: 1
1: 9
2: 40
3: 383
4: 1897

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954253409 Original CRISPR CTGAATCTACAGATCGATTT GGG Intronic
Too many off-targets to display for this crispr