ID: 954256629

View in Genome Browser
Species Human (GRCh38)
Location 3:49411929-49411951
Sequence GAGAACCGACGGAGGACCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954256624_954256629 -4 Left 954256624 3:49411910-49411932 CCAGACCGTGGACTAACGAGAGA 0: 1
1: 0
2: 1
3: 2
4: 21
Right 954256629 3:49411929-49411951 GAGAACCGACGGAGGACCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 32
954256625_954256629 -9 Left 954256625 3:49411915-49411937 CCGTGGACTAACGAGAGAACCGA 0: 1
1: 0
2: 1
3: 1
4: 37
Right 954256629 3:49411929-49411951 GAGAACCGACGGAGGACCGCGGG 0: 1
1: 0
2: 0
3: 0
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954256629 Original CRISPR GAGAACCGACGGAGGACCGC GGG Exonic
901501055 1:9652758-9652780 GAGAACCGGGGAAGGGCCGCTGG + Exonic
905109535 1:35585141-35585163 GAGAACCGAAGGAGCACTGTGGG + Intronic
920504618 1:206507411-206507433 GAGAACCGCCGACGGACCGAAGG - Intergenic
922917619 1:229271273-229271295 GAGACGCGCCGGCGGACCGCGGG + Exonic
1078109641 11:8382161-8382183 GAGGAACATCGGAGGACCGCAGG + Intergenic
1090243588 11:125200603-125200625 GAGAACAGACGGAGGGCCAGGGG - Intronic
1091626381 12:2124067-2124089 GAGACCAGAGGGAGGACAGCAGG - Intronic
1097676115 12:62603612-62603634 GAGGAAGGACGGAGGAGCGCCGG + Exonic
1101536654 12:105623957-105623979 GAGAACAAACAGAGGACAGCTGG - Intergenic
1103597796 12:122034802-122034824 GAGAAAGGAGGGAGGACCCCGGG - Intronic
1106603171 13:31204528-31204550 GAGAAAGGACGGAGGACTGAAGG + Intronic
1127993321 15:64136641-64136663 GAGAAACGACAGGGGACCGAGGG - Intronic
1133221965 16:4322726-4322748 GAGAACCGAGGCAGGAGGGCAGG + Intronic
1136845440 16:33572658-33572680 AAGAACCTAGGGAGGAGCGCTGG - Intergenic
1203107148 16_KI270728v1_random:1421311-1421333 AAGAACCTAGGGAGGAGCGCTGG - Intergenic
1147602565 17:41755304-41755326 AAGACCCTACGGAGGACCTCTGG + Exonic
1151755419 17:76072771-76072793 GAGAACCGGAGGTGGACCCCAGG + Intronic
925943729 2:8842116-8842138 GAGGACCCACAGAGGACAGCAGG + Intergenic
932773627 2:74514770-74514792 GAGAACCGCCGGAGGTTCGGTGG - Exonic
943247818 2:185477861-185477883 GAGAACTGACTGATGACAGCTGG + Intergenic
949000106 2:241608244-241608266 GAGAACCGAGGGTGGAGAGCAGG + Intronic
954256629 3:49411929-49411951 GAGAACCGACGGAGGACCGCGGG + Exonic
999262063 5:150244536-150244558 GAGACGGGAAGGAGGACCGCAGG + Intronic
1013754210 6:113441813-113441835 GGGAACCGAGGGAGGACTGGGGG + Intergenic
1024087109 7:45902735-45902757 GAGAACTGAGGGATGACAGCTGG + Intergenic
1030649509 7:112102117-112102139 AAGAACCGAGGGAGGTCGGCCGG - Intronic
1037454642 8:19051249-19051271 GAGAACTGAAGGACGAGCGCTGG - Intronic
1053174181 9:35910363-35910385 GAGAGCCGCCGGAGGAGCACGGG + Intergenic
1061889397 9:133609570-133609592 GAGAGCGGAGGGAGCACCGCAGG - Intergenic
1061896030 9:133648136-133648158 CAGAAAAGAGGGAGGACCGCAGG - Intronic
1189333549 X:40156740-40156762 GAGAACCGGCGGGGGGCCCCGGG - Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic