ID: 954263367

View in Genome Browser
Species Human (GRCh38)
Location 3:49455836-49455858
Sequence CAGGGTAAGGAATTGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954263367_954263374 0 Left 954263367 3:49455836-49455858 CCTCCTCCCAATTCCTTACCCTG No data
Right 954263374 3:49455859-49455881 AGTACAAATAACGACTGAAGTGG No data
954263367_954263375 1 Left 954263367 3:49455836-49455858 CCTCCTCCCAATTCCTTACCCTG No data
Right 954263375 3:49455860-49455882 GTACAAATAACGACTGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954263367 Original CRISPR CAGGGTAAGGAATTGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr