ID: 954263670

View in Genome Browser
Species Human (GRCh38)
Location 3:49457687-49457709
Sequence TGCTTGACCCCGGGGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954263670_954263680 5 Left 954263670 3:49457687-49457709 CCTCCGCCCCCCGGGGTCAAGCA No data
Right 954263680 3:49457715-49457737 CCCTCAGCCTACGGAGTAGCTGG No data
954263670_954263682 6 Left 954263670 3:49457687-49457709 CCTCCGCCCCCCGGGGTCAAGCA No data
Right 954263682 3:49457716-49457738 CCTCAGCCTACGGAGTAGCTGGG No data
954263670_954263684 14 Left 954263670 3:49457687-49457709 CCTCCGCCCCCCGGGGTCAAGCA No data
Right 954263684 3:49457724-49457746 TACGGAGTAGCTGGGATTACAGG 0: 17
1: 2987
2: 114667
3: 260004
4: 229380
954263670_954263677 -4 Left 954263670 3:49457687-49457709 CCTCCGCCCCCCGGGGTCAAGCA No data
Right 954263677 3:49457706-49457728 AGCAATCCTCCCTCAGCCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954263670 Original CRISPR TGCTTGACCCCGGGGGGCGG AGG (reversed) Intergenic
No off target data available for this crispr