ID: 954269718

View in Genome Browser
Species Human (GRCh38)
Location 3:49498168-49498190
Sequence AGGGAGCCCCAGGACCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954269718_954269728 22 Left 954269718 3:49498168-49498190 CCCTGATGGTCCTGGGGCTCCCT 0: 1
1: 0
2: 4
3: 29
4: 258
Right 954269728 3:49498213-49498235 ACATTGCCTGCAGTTTAGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 101
954269718_954269726 18 Left 954269718 3:49498168-49498190 CCCTGATGGTCCTGGGGCTCCCT 0: 1
1: 0
2: 4
3: 29
4: 258
Right 954269726 3:49498209-49498231 TTCCACATTGCCTGCAGTTTAGG 0: 1
1: 0
2: 1
3: 12
4: 150
954269718_954269722 -8 Left 954269718 3:49498168-49498190 CCCTGATGGTCCTGGGGCTCCCT 0: 1
1: 0
2: 4
3: 29
4: 258
Right 954269722 3:49498183-49498205 GGCTCCCTCCATATCACTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954269718 Original CRISPR AGGGAGCCCCAGGACCATCA GGG (reversed) Intronic