ID: 954269718

View in Genome Browser
Species Human (GRCh38)
Location 3:49498168-49498190
Sequence AGGGAGCCCCAGGACCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954269718_954269726 18 Left 954269718 3:49498168-49498190 CCCTGATGGTCCTGGGGCTCCCT 0: 1
1: 0
2: 4
3: 29
4: 258
Right 954269726 3:49498209-49498231 TTCCACATTGCCTGCAGTTTAGG 0: 1
1: 0
2: 1
3: 12
4: 150
954269718_954269722 -8 Left 954269718 3:49498168-49498190 CCCTGATGGTCCTGGGGCTCCCT 0: 1
1: 0
2: 4
3: 29
4: 258
Right 954269722 3:49498183-49498205 GGCTCCCTCCATATCACTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 93
954269718_954269728 22 Left 954269718 3:49498168-49498190 CCCTGATGGTCCTGGGGCTCCCT 0: 1
1: 0
2: 4
3: 29
4: 258
Right 954269728 3:49498213-49498235 ACATTGCCTGCAGTTTAGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954269718 Original CRISPR AGGGAGCCCCAGGACCATCA GGG (reversed) Intronic
900096301 1:941494-941516 AGGGAGGCTGAGGCCCATCAGGG + Intronic
900191164 1:1352897-1352919 AGGGAGCCCAGTGACTATCAAGG + Exonic
900299651 1:1970286-1970308 AGGGAGCACCAGGCCCCTCCAGG - Intronic
900878124 1:5360589-5360611 AGAGAGCCACAGGATTATCATGG + Intergenic
901928067 1:12579424-12579446 AGGGAGCCACGGGGCCATGAGGG + Intronic
902605934 1:17569393-17569415 ATGGAGCCCCAGGACCCCCGGGG - Intronic
903032363 1:20472961-20472983 ATGGAGCCCCAGGAGGCTCAGGG + Intergenic
903173360 1:21567028-21567050 AAGGTGCCCCAGGACCAGCCTGG - Intronic
904819808 1:33234650-33234672 AGGGAGGTCTAGGACCAGCACGG + Intergenic
905391149 1:37636049-37636071 AGGGGGCCCCTGGACCAACTCGG - Intergenic
905502410 1:38450238-38450260 AGGCAGCCCCTGAACCATCAAGG + Intergenic
907521311 1:55025095-55025117 CGGAAGCCCCCAGACCATCACGG + Intergenic
910362438 1:86427081-86427103 AGAGAACCCAAGGACCAGCAAGG + Intronic
912003286 1:104860700-104860722 AGAGAGTCCCAGGACCCTCTTGG - Intergenic
913517089 1:119613948-119613970 GGGGAGCCCCAGGACTGTCAGGG + Intergenic
915163661 1:153936297-153936319 AGGTAGCCCCAGGACCTGCCAGG - Intronic
919809658 1:201400442-201400464 AGCGAGGCCCAGGAGCATGAGGG - Intergenic
920432365 1:205927229-205927251 ATAGATCCCCAGGACCAGCATGG + Exonic
920650077 1:207831148-207831170 AGTGAACCCCAGCACCAACAGGG + Intergenic
920829452 1:209451426-209451448 CGGAAGCCCCCAGACCATCACGG + Intergenic
921424599 1:214986720-214986742 AAGGAGCCTCAGGACCTTCAGGG + Intergenic
923110816 1:230888607-230888629 AGAGAGACCCAGGACAACCACGG + Intergenic
923801196 1:237210803-237210825 AGGCAGCACTAGGACCATCCAGG + Intronic
924282799 1:242454960-242454982 AGGGAGCCCCAGCACAATCAGGG + Intronic
924319146 1:242829736-242829758 AGGGAGGCACAGGAGCATCCAGG + Intergenic
1066109079 10:32180467-32180489 AAAGGGCCCCAGGACCTTCAAGG - Intergenic
1067087289 10:43249665-43249687 AGGAAGCCCCAGGGCCAGCCAGG - Intronic
1069438354 10:68406722-68406744 GGGGCCCCCCAGGACCATCGCGG + Intronic
1069634988 10:69919663-69919685 AGGGAGACCCAGGAGCAGAAGGG + Intronic
1069655234 10:70083049-70083071 AGGGATTCCCAGCACCAACAGGG + Intronic
1070983791 10:80670991-80671013 AGGCAGCCCCAGGGCCATGCTGG + Intergenic
1071604952 10:86979583-86979605 AGGGACCCCCAGGACATTGAGGG + Intronic
1076715571 10:132362237-132362259 AGGCAGCCACAGGCCCATCAGGG + Intronic
1076904987 10:133357161-133357183 AGCGAGCCCCAGGTCCCCCAGGG - Intronic
1077076634 11:705259-705281 AGGGCGCCCCAGGCCCATGCAGG - Intronic
1077087823 11:763342-763364 AGGGAGCTCGAGGAGCAGCACGG + Exonic
1077194326 11:1271919-1271941 AGGGACCCGCAGCACCAGCAGGG - Intergenic
1077418523 11:2437126-2437148 GGGGATCCCCAGGTCCTTCATGG + Intergenic
1079244236 11:18741310-18741332 AGGGAGTCCCAGGAGCAGCACGG + Intronic
1084638238 11:70407634-70407656 ATGGAGCCCCAGGTGCAACAGGG + Intronic
1084652570 11:70497810-70497832 TGGGAGGCCCAGGACCACCCAGG + Intronic
1085304211 11:75476046-75476068 AGGAAGCCCCTTGGCCATCAGGG - Intronic
1085677114 11:78533131-78533153 CTGGAGCCCCAGCACCAGCATGG + Intronic
1085936581 11:81152975-81152997 AGGGAGCCCCAGATCCTACAAGG - Intergenic
1087727804 11:101741998-101742020 AGGGAGCCCCAAGGCCAACGTGG - Intronic
1088316557 11:108512803-108512825 ATGGAACCACAGGAGCATCAAGG + Exonic
1090021183 11:123130357-123130379 AAATGGCCCCAGGACCATCAAGG + Intronic
1090374532 11:126279679-126279701 AGGGAGTGCCTGAACCATCATGG + Intergenic
1091346279 11:134856506-134856528 AGGGTGCTCCAGGCCCAGCAAGG + Intergenic
1091541861 12:1469564-1469586 ACGGAGCTCCAGGACCCACATGG - Intronic
1092011437 12:5116168-5116190 AGGGAGCCCATGGACCCTTAGGG - Intergenic
1096476705 12:51913218-51913240 AGGCACCCCCAGGAACATCGGGG + Exonic
1099910438 12:88826207-88826229 ATGTAACACCAGGACCATCATGG - Intergenic
1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG + Intergenic
1101553969 12:105789536-105789558 AGGAATCCACAGGACCACCAAGG + Intergenic
1102823560 12:115927591-115927613 AGCTAGCCCCAGGGCCAGCATGG + Intergenic
1102993430 12:117330706-117330728 TGGGACCCCCAAGACCATCCGGG - Exonic
1104313835 12:127679071-127679093 AGGGAGCCCGTGGGGCATCATGG + Intergenic
1104647893 12:130509879-130509901 AGGGAGCCTCTGAGCCATCATGG - Intronic
1106220627 13:27743747-27743769 AGGGAGCACCAGGACAGTGACGG - Intergenic
1106302754 13:28484463-28484485 AAGGAGCCCCAAAGCCATCAAGG - Intronic
1106669341 13:31888258-31888280 ATGGAACACCAGGACCAGCAGGG - Intergenic
1106909897 13:34452403-34452425 AGGGAGCATCTGGACCATGAAGG - Intergenic
1112221778 13:97498391-97498413 AGCCAGCCCCAGGAAAATCAGGG + Intergenic
1122904901 14:104797132-104797154 AGGGAGCCCCAGGTGGCTCATGG - Intergenic
1123144608 14:106116566-106116588 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123156814 14:106234993-106235015 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123207585 14:106728094-106728116 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1123212596 14:106775088-106775110 AGGGGTCCCCAGGACCACCAGGG - Intergenic
1124591914 15:31061231-31061253 TGGGTGCTCCTGGACCATCATGG - Intronic
1126175639 15:45732927-45732949 GGGGAGCCTCAGGACGATCTTGG + Intergenic
1126313672 15:47344512-47344534 AGGGAGACCAAGGAAGATCATGG + Intronic
1127927623 15:63562090-63562112 GGGGAGCCCCAGCACCATGGGGG - Intronic
1129674679 15:77626108-77626130 ACTGAGGCCCAGGAGCATCAGGG + Intronic
1129758330 15:78112010-78112032 AGGGAGGGCCAGGCCCACCAGGG - Intronic
1131831181 15:96355542-96355564 AGTGGGCCCCAGGACCCTCTTGG + Intergenic
1132591368 16:727735-727757 AGGGAGCCCCAAGATAAACAAGG - Intronic
1132974494 16:2704663-2704685 ATGGAGCCCCAACACCACCAAGG - Intronic
1133766715 16:8843309-8843331 TGGAAGCCCCCAGACCATCACGG - Intronic
1134090701 16:11390314-11390336 AGGGGGTCCAAGGCCCATCAGGG - Exonic
1135187203 16:20325475-20325497 AGGCACCCCCAGAACCATCTTGG + Intronic
1136872113 16:33816777-33816799 AGGAATGCCCAGGACCATTAGGG + Intergenic
1137958140 16:52853359-52853381 AGAGAGCCCCTTGACCATCACGG - Intergenic
1138456576 16:57124663-57124685 AGGGAGCCTCAGGCCCAGAAGGG + Intronic
1138504692 16:57472413-57472435 AGGGAGCCTCAGCACCATGTGGG + Exonic
1139343861 16:66289514-66289536 AGGAGGCACCAGGGCCATCATGG + Intergenic
1139548070 16:67659025-67659047 CGGGAGGACCAGGAGCATCAGGG - Exonic
1139573517 16:67827621-67827643 AGGGAGACCCAGGGGCTTCAGGG - Intronic
1141155214 16:81592585-81592607 TGGGAGCCCCAGGATGAGCAGGG - Intronic
1141792452 16:86245885-86245907 AGGGAGCCCCAGGAGGAACCTGG + Intergenic
1142213943 16:88821814-88821836 GGGAAGACCCAGGAGCATCAGGG - Intronic
1142257419 16:89021015-89021037 AAGCATCCCCTGGACCATCAGGG - Intergenic
1142270708 16:89088069-89088091 AGGGTCCCCCAGGGCCATCCTGG + Intergenic
1203100059 16_KI270728v1_random:1299291-1299313 AGGAATGCCCAGGACCATTAGGG - Intergenic
1143101357 17:4506427-4506449 AGGGACTCCCAAGACCACCAGGG - Intronic
1143164390 17:4890670-4890692 AGGAAGCCCCTGTACCATTATGG + Exonic
1144600378 17:16607622-16607644 TGGGAGTCCCAGGACAATCCAGG - Intergenic
1145778094 17:27543440-27543462 AGGGATCCCCAGGAACATGGAGG - Intronic
1146137732 17:30337870-30337892 AGAGGGCCCCAGGGCCAGCAGGG + Intergenic
1148244544 17:46021846-46021868 GGGGATCCCCAGGACCAGGATGG - Intronic
1151280948 17:73073599-73073621 GGGGAGCCCCAGGGCCTCCAAGG - Intronic
1151377072 17:73697197-73697219 AGAGAGCCACAGGAGCCTCAGGG - Intergenic
1151624390 17:75267595-75267617 AGGGTTCACCAGGGCCATCATGG + Exonic
1153619988 18:6968280-6968302 AGGGAGCCCTCGGAGAATCAGGG - Intronic
1153659676 18:7315802-7315824 TGGGAGCCCCTGCACCATAAGGG + Intergenic
1157670710 18:49526208-49526230 AGCAAGCCCCAGGAGCATCAAGG + Intergenic
1158867585 18:61652694-61652716 CAGGAGCCCCATGGCCATCAAGG - Intergenic
1159564343 18:70031979-70032001 AAGGAACCCCTGGACCACCATGG + Intronic
1160009055 18:75089911-75089933 AGGGCGTCCCAGGGCCGTCACGG - Intergenic
1161574331 19:5047496-5047518 CGGGAGCCTCCGGACCATCCTGG + Exonic
1161953495 19:7480380-7480402 CCGGAGCCCCAGGAACATCCAGG + Intronic
1163478178 19:17539290-17539312 CGGGACCCCCAGGACCCTCCCGG + Intronic
1165150432 19:33757008-33757030 AGGGGGGCCCCAGACCATCATGG - Intronic
1165429439 19:35764142-35764164 AGAGACCCCAAGGACCATCCTGG - Intronic
1166751381 19:45165360-45165382 AGGGAGCCCCAGCACCCTAGAGG - Intronic
1166951041 19:46428264-46428286 CGGGATCCCCAGGATCATCAGGG + Intergenic
1168081253 19:54012136-54012158 AGGGACCCCCAGGGCCAGGAAGG - Exonic
1168094474 19:54106849-54106871 AGCCACCCCCAGGACCCTCAGGG + Exonic
1168171504 19:54592936-54592958 AGAGGGTCCCAGGACCTTCAAGG - Intronic
925377936 2:3401394-3401416 AGGGAGGCCCAGGAGCATGAAGG - Intronic
926324148 2:11770005-11770027 AGGGATCCCCAGTATCAACAGGG - Intronic
927911632 2:26903939-26903961 AGGGAGTCTCTGGACCCTCACGG - Intronic
928290613 2:30034175-30034197 AAGGAGCCCCATGGACATCATGG - Intergenic
928339063 2:30425766-30425788 AGGGATCCACAGGTCCAGCACGG + Intergenic
929775643 2:44929273-44929295 AGGGAGCTCCAGGGCCTTCCTGG - Intergenic
929916636 2:46142191-46142213 AGGGAAGCCCAGGGCCATGATGG - Intronic
930658446 2:54030157-54030179 TGGGGGCCCCAGGACCTTCAAGG + Intronic
930716295 2:54596740-54596762 AGGGCTCCCCAGGGCTATCATGG - Intronic
931357583 2:61550620-61550642 AGGCAGCCCTAAGGCCATCAGGG + Intergenic
931372618 2:61677860-61677882 AGGGGGCCACAGGACCAGCTGGG - Intergenic
931409226 2:62012936-62012958 AGGCAGCCCCAGGAAGATCTGGG + Intronic
932265471 2:70364006-70364028 AGGGTGCCCCAAGAGCAGCATGG + Intergenic
932583580 2:73008428-73008450 GGAGAGCCCCAGGCCCATGAGGG + Intronic
933659266 2:84914199-84914221 ATGCAGCCCCAAGACCTTCATGG + Intergenic
933724872 2:85420996-85421018 AGGGCCCTCCAGGCCCATCAAGG + Intronic
933792688 2:85895680-85895702 AAAGAGCCCTAGGAGCATCAAGG + Intergenic
934768184 2:96892257-96892279 AGGGAGCCCCAGGCCAAGGAGGG - Intronic
936951557 2:117982822-117982844 AGTGAGTCCCAGGGCCAGCAGGG + Intronic
937259640 2:120577174-120577196 AGGGACCCCCGGGACCCCCAGGG + Intergenic
937499214 2:122460365-122460387 AGAGAACCCCAGGAAAATCAGGG + Intergenic
937985686 2:127637138-127637160 AGGGAGACCCAGCTCCAGCAGGG + Intronic
938320381 2:130358720-130358742 AGGCAGGCCCAGTGCCATCAGGG + Intronic
939982906 2:148802150-148802172 AGAGACCCCCAGGAGCTTCATGG - Intergenic
940183729 2:150960800-150960822 CGGAAGCCCCCGGACCATCATGG + Intergenic
941353435 2:164461607-164461629 CGGAAGCCCCCAGACCATCACGG + Intergenic
941924867 2:170884686-170884708 AGGGTGCCCAAGGACCATGTGGG - Intergenic
942954435 2:181757846-181757868 AGGGAGCACTATTACCATCACGG - Intergenic
945442556 2:209896991-209897013 GGGTATCCCCAGGACCATCACGG + Intronic
946853314 2:223928910-223928932 AGAGAGCCCCAGGACCAAAAAGG + Intronic
947151523 2:227121128-227121150 AGGGTCCACCAGGACCACCAGGG - Exonic
948256880 2:236574852-236574874 GAGGAGCCCCAGTACCATCTGGG + Intronic
948897511 2:240934209-240934231 AGGGAGGCCCAGGAGGAGCATGG - Intronic
948922702 2:241073198-241073220 GGGTGGCCCCAGGACCATCCCGG + Intronic
1170842377 20:19934470-19934492 AGTGGGCCCCAGGGCCATCTAGG - Intronic
1172033270 20:31995946-31995968 AGGGGTCCCCAGGGCCATGAGGG - Intronic
1173837406 20:46134926-46134948 AGGGAGCCCCAGGGACAGGAAGG - Intergenic
1174722448 20:52827506-52827528 AGAGAGCCCCCACACCATCATGG - Intergenic
1174774698 20:53333003-53333025 AGGCAGCCCCAGGAAGATCTGGG - Intronic
1175300647 20:57940524-57940546 AGGGAGCTCTTGGACCAGCAGGG - Intergenic
1175391828 20:58632318-58632340 AGGGACTCCCAGGGTCATCAGGG - Intergenic
1175413158 20:58784783-58784805 CAGGAGCCCCAGGAGCAGCACGG + Intergenic
1176277284 20:64279621-64279643 AGGGTGCCCCAGGCAGATCACGG + Intronic
1178683912 21:34696454-34696476 AGGGGACCCCAGGGCCAGCAGGG - Intronic
1179663175 21:42891507-42891529 GGGGAGCTCCAGGTCCATGAAGG + Intronic
1180800674 22:18630496-18630518 GGGGAGCCCCAGGAAGAGCAAGG - Intergenic
1180851906 22:19026053-19026075 GGGGAGCCCCAGGAAGAGCAAGG - Intergenic
1180878428 22:19186375-19186397 AGGGACCCCCAAGACCCTGAAGG - Intronic
1181221045 22:21364766-21364788 GGGGAGCCCCAGGAAGAGCAAGG + Intergenic
1181517130 22:23421269-23421291 AAGGAGCCCCAGAAGCAGCATGG + Intergenic
1181967550 22:26667562-26667584 AGCAAGCTCCAGGAGCATCATGG - Intergenic
1182114000 22:27744480-27744502 CGGAAGCCCCCAGACCATCACGG + Intergenic
1182524774 22:30908232-30908254 AGGGCACCCCAGGGGCATCAGGG + Intergenic
1183622748 22:38983971-38983993 GGGGAGGCCCAGGGCCATCCTGG + Intronic
1184498787 22:44859709-44859731 AGGGAGCCCCATGCCCTTCCAGG + Exonic
1184500038 22:44865895-44865917 AGGGAGCCCCATGCCCTTCCAGG - Intergenic
1185133678 22:49056166-49056188 TGGGAAGCCCAGGATCATCACGG - Intergenic
1185381325 22:50508567-50508589 AGGGAGCCCGAGGACCTGCGCGG - Intronic
950227023 3:11244079-11244101 TGGCAGCCCCATGATCATCAGGG + Intronic
952191724 3:31029804-31029826 AGCCAGACCCAGGCCCATCAGGG + Intergenic
952526895 3:34220062-34220084 GGGGAGTCTCAGGCCCATCAGGG + Intergenic
953016060 3:39077532-39077554 AGGTAGCCCAAGTACCAACAAGG + Intronic
953514012 3:43572279-43572301 GGGGAGTCCCAGGCCCAGCAAGG - Intronic
954269718 3:49498168-49498190 AGGGAGCCCCAGGACCATCAGGG - Intronic
954684717 3:52364268-52364290 AGGAAGCTCAAGGGCCATCAAGG + Intronic
958464575 3:94442447-94442469 AGGGAACCCCTCTACCATCATGG + Intergenic
958949372 3:100400634-100400656 AGTGAGCACCGGGACCTTCAGGG + Exonic
962369864 3:134812259-134812281 AGGGAGGCACATGACCATGAAGG - Intronic
966687174 3:182708766-182708788 AGGTAGCTCCAGGAACTTCAGGG - Intergenic
966869751 3:184282605-184282627 ATGGAGCCTCAGGGCCAGCAGGG + Intronic
968902979 4:3439846-3439868 AGGGAGCCCCATGGCCAGCATGG - Exonic
968969076 4:3784151-3784173 CGGGAGCCCCTGATCCATCACGG - Intergenic
969336893 4:6516271-6516293 TGGGGGCTCCAGGACCATCCTGG + Intronic
969633090 4:8349876-8349898 AGGAAGACCCGGGACCTTCAAGG + Intergenic
969711919 4:8849602-8849624 CGGCAGCCCCAGGACACTCACGG + Intronic
971123138 4:23725240-23725262 CGGAAGCCCCCAGACCATCACGG - Intergenic
976227781 4:82810029-82810051 TGGGACCCCCAGGAGCATCCTGG - Intergenic
977789868 4:101087128-101087150 AGGTAGCCCCAGGACACTCCTGG - Intronic
978716636 4:111851695-111851717 AAGAACCCCCAAGACCATCATGG + Intergenic
982069813 4:151685432-151685454 AGGGAGCCTCTGGAACGTCAGGG - Intronic
982191075 4:152855754-152855776 GGAGAGCCCCTGGACCCTCATGG - Intronic
982574043 4:157085883-157085905 AGGGAGCCCCTTGAAAATCAAGG - Intronic
984870200 4:184318424-184318446 AGGGATCCCCATGACCCCCATGG - Intergenic
985096755 4:186420502-186420524 AGGCAGCCCCATGACCATCGGGG - Intergenic
985860605 5:2467791-2467813 AGGGAAACCCATGACCCTCATGG - Intergenic
986124139 5:4869711-4869733 GGGGAGACCCAGGTCCATGAGGG - Intergenic
986742011 5:10712662-10712684 AGGAACCCACAGGACCAACATGG + Intronic
988482361 5:31640555-31640577 AGAGACCCCCTGGACCTTCAGGG + Intronic
989479442 5:41913095-41913117 AAGGAGCTCCAGGAACATCTTGG - Intronic
995140281 5:108728073-108728095 AGGGCGACCCAGGGCCAGCACGG + Intergenic
996358574 5:122622089-122622111 TGGAAGCCCCTAGACCATCACGG - Intergenic
997248446 5:132370624-132370646 AGGGACCGCCAGGACCTTCCTGG - Intronic
997261206 5:132466687-132466709 AGGCGGCCCCAGGACCTTCAAGG - Intronic
998214484 5:140227077-140227099 AGGTGGCCCCTGGAGCATCATGG + Intronic
998642918 5:144032385-144032407 ATGGAGCCCCAGGAGCTGCAAGG - Intergenic
999180445 5:149666460-149666482 AGTGAGCCCCAGGATCACCAGGG + Intergenic
999243547 5:150140946-150140968 TGGGAGCCTCAGGACCCTGAGGG - Intronic
1001889410 5:175326769-175326791 AGGGGCCCCCAGAACCCTCATGG + Intergenic
1002270852 5:178070967-178070989 AGGGAACCCCAGGGCCCCCAGGG - Intergenic
1002299990 5:178252559-178252581 AGGGGCCCCCAGGGCCACCAGGG - Exonic
1002703366 5:181142924-181142946 AGTGAGCCCCAGCGCCCTCATGG - Intergenic
1003099779 6:3168358-3168380 CGGGAGCCCCCGGACCATCACGG + Intergenic
1003265190 6:4559617-4559639 AGGGAGCCCCAGGGAAAGCAGGG - Intergenic
1004260080 6:14100464-14100486 AGTGGGCCCCAGCACCATCTGGG - Intergenic
1004843206 6:19610854-19610876 AGGGAGACCAGGGACCCTCAAGG - Intergenic
1006390434 6:33755086-33755108 AGAGAGCCCCACGACCCTCTGGG - Intergenic
1007349321 6:41257223-41257245 TGAGAGCCCCAGTACCTTCAAGG - Intergenic
1012145973 6:95682140-95682162 AATGGGCCCCAGGACCTTCAAGG + Intergenic
1013992195 6:116265958-116265980 AGGGAACCCCTTGACCACCATGG - Intronic
1014776037 6:125511065-125511087 AGGGACCTCAAGTACCATCATGG + Intergenic
1015658465 6:135546605-135546627 AGGGAGCCCCAGTTCCATCAAGG + Intergenic
1015812719 6:137177392-137177414 GGGGAGCCCAAGGCCCAGCATGG - Intergenic
1016869394 6:148801675-148801697 AGGAAGCCCCAGGAGGATGAGGG - Intronic
1017898574 6:158701902-158701924 AGACAGCCCCGTGACCATCAGGG - Intronic
1018480725 6:164186946-164186968 AGGCAGCCACAGGATCATGAGGG - Intergenic
1018845340 6:167551807-167551829 AGGGTCCCCCAGGACCAGCTGGG + Intergenic
1019358837 7:594641-594663 AAGGAACCCCAAGACCATGAGGG + Intronic
1019358852 7:594680-594702 AGGGGACCCCAAGACCATGAGGG + Intronic
1019358890 7:594796-594818 AGGGGACCCCAAGACCATGAGGG + Intronic
1019532236 7:1509525-1509547 AGGGAGTCCCAGGACCAGCTGGG - Intergenic
1024639608 7:51317911-51317933 AGTGAGCCCCAGGGCCACCTGGG - Intergenic
1026171076 7:67954460-67954482 ACTGAGCCCCAGGACCTCCATGG + Intergenic
1026969161 7:74457548-74457570 AGGGGGCCCCAGGAAGTTCAGGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1029618234 7:101673485-101673507 AGGAAGCCCAAGGAGCCTCATGG - Intergenic
1030089952 7:105849685-105849707 AGGGAGCCCCAGTGACCTCAGGG - Intronic
1032410188 7:131689014-131689036 GGGGAGGCCCAGTAGCATCAGGG + Intergenic
1033936620 7:146593344-146593366 TGGGAGCTCCAGGAACATGAAGG - Intronic
1034421118 7:150991440-150991462 AGGGAAGCACAGGACCATTAGGG + Intronic
1034492690 7:151402435-151402457 AGGGAGCTCCAGGCCCAGAAGGG + Intronic
1035399691 7:158556880-158556902 CGGGAGCCCCCTGACCTTCACGG - Intronic
1035560848 8:602530-602552 AGGGAGCCCCAAGACCAAGGAGG + Intergenic
1035643528 8:1201178-1201200 AGGGAGCCCCTTGTCCATCAGGG + Intergenic
1042892929 8:73633393-73633415 AGGGAGAGACAGGACCAGCAAGG + Intronic
1044206449 8:89496731-89496753 AGGGATCCCCGGGACCGGCAGGG + Intergenic
1046512134 8:115214718-115214740 CGGAAGCCCCTAGACCATCACGG + Intergenic
1046763965 8:118049836-118049858 AGGCAGCCCCACGACCGCCAGGG + Intronic
1046960588 8:120109117-120109139 AGGAAGATCCAGGACCATAAAGG - Intronic
1046980580 8:120332166-120332188 CGGGACCTCCAGGACCACCAGGG + Exonic
1048832259 8:138488531-138488553 AGTGAGCCACAGGAACATCAGGG + Intronic
1049112532 8:140656631-140656653 AGGGAGCCCCAGGACCTCTGGGG + Intergenic
1049231951 8:141489113-141489135 AGGGAGGCCCAGGCCCAGCAGGG - Intergenic
1049782597 8:144435702-144435724 AGGGAGCCCCAGCACCCCCAGGG - Exonic
1050111728 9:2223838-2223860 AGAAAGCACCAGGCCCATCAGGG - Intergenic
1050348679 9:4718944-4718966 AGGTTGCCCCAGGAGCAGCAGGG - Intronic
1052894168 9:33731766-33731788 AGGGAGGCCCAGGGCCATCAGGG - Intergenic
1053053716 9:34981228-34981250 AGGGAGCAGCAGGACCAGAAAGG - Exonic
1053278891 9:36804005-36804027 AAGGAGTTCCAGGAGCATCAGGG - Intergenic
1057176129 9:93001421-93001443 AAAGAGCCCCAGTACCTTCAAGG + Intronic
1058721854 9:107771712-107771734 ATGGAGTCCCAAGTCCATCAGGG + Intergenic
1060678065 9:125534857-125534879 AGGGAGCCCTAGTTCCATCCTGG - Intronic
1060694930 9:125700949-125700971 GGGGAGCACCTGGCCCATCAAGG + Intronic
1061070832 9:128309596-128309618 TGGGAGTCCCAGGACCATCCCGG + Exonic
1061149867 9:128822574-128822596 AGGCAGCCTCAAGGCCATCACGG + Exonic
1061367665 9:130181016-130181038 ATTAAGTCCCAGGACCATCATGG + Intronic
1061781650 9:132999781-132999803 CTGGAGCCCCAGGACCTTCCAGG - Intergenic
1061810764 9:133161818-133161840 GGGCAGCCCCAGGAGCTTCATGG + Intronic
1203653733 Un_KI270752v1:3585-3607 AGTGAGTTCCAGGACCACCAGGG + Intergenic
1187679437 X:21752245-21752267 AGGGAGGCCAGGGACCATTAAGG + Intronic
1189772626 X:44441641-44441663 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189772944 X:44444323-44444345 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1190988535 X:55522266-55522288 AGGGACTTCCAGGACCTTCAGGG - Intergenic
1191177276 X:57517346-57517368 AGGAAACCCCAGGATCCTCATGG - Intergenic
1192968307 X:76203203-76203225 ATGGAGACTCAGGATCATCAGGG - Intergenic
1194308496 X:92276285-92276307 CGGAAGCCCCTAGACCATCACGG - Intronic
1194351336 X:92826985-92827007 CGGAAGCCCCCAGACCATCACGG + Intergenic
1195703489 X:107722208-107722230 AGGGAGCCCAAGGAGAATCTTGG + Intronic
1195793330 X:108614977-108614999 AGGGACCACCAGGACCACCAGGG + Exonic
1197445881 X:126552163-126552185 AGGCTGGCCCAGGACCAACAGGG - Exonic
1197727761 X:129787807-129787829 AGGTAGCCCCAAGAACATCGAGG + Intronic
1197762041 X:130034788-130034810 AGGCAGCCCCAGGGCAATCTGGG - Intronic
1198598489 X:138261299-138261321 CGGAAGCCCCCAGACCATCACGG + Intergenic
1202062130 Y:20899064-20899086 TGGAAGCCCCCGGACCATCACGG + Intergenic