ID: 954272161

View in Genome Browser
Species Human (GRCh38)
Location 3:49518409-49518431
Sequence AAGTAACCAGAAGCCCACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954272161_954272164 2 Left 954272161 3:49518409-49518431 CCTGTGTGGGCTTCTGGTTACTT 0: 1
1: 0
2: 0
3: 7
4: 160
Right 954272164 3:49518434-49518456 TTTCAGGAGGTTGTGCTGCCTGG 0: 1
1: 0
2: 0
3: 11
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954272161 Original CRISPR AAGTAACCAGAAGCCCACAC AGG (reversed) Intronic
900977842 1:6028202-6028224 CAGAAGCCAGGAGCCCACACAGG - Intronic
901828583 1:11878701-11878723 AACTAACCAGGAGCCCATATTGG - Intergenic
903497532 1:23779760-23779782 GAGTAAACTGAAGCCCATACAGG + Intronic
915281908 1:154828608-154828630 AAGAAACCAGAGGCCCAGAGAGG - Intronic
916596803 1:166251723-166251745 AAGTGACCAGAAGCTCGAACGGG - Intergenic
917973307 1:180222377-180222399 AAGTAAATGGAAGCTCACACGGG + Intergenic
918201442 1:182270987-182271009 AAATAACCATGAGTCCACACTGG + Intergenic
920278784 1:204828338-204828360 AAGTACCCTGAAGCCCCAACAGG - Intergenic
921167325 1:212516477-212516499 AACTACCCTGAAGCCCAGACAGG - Intergenic
921390131 1:214607662-214607684 AGGTCACCAGAGGCCCACCCGGG + Intronic
921442371 1:215202771-215202793 AAGGAAGCAGAAACACACACAGG + Intronic
923388708 1:233492126-233492148 AGGAAACCAGCAGCTCACACAGG + Intergenic
923849716 1:237780772-237780794 AATTAACCAAAAACCTACACAGG - Intronic
1063096905 10:2916171-2916193 AAGTAACCAGAAGTGGAGACAGG - Intergenic
1063785410 10:9378069-9378091 GAGCAATCAGAATCCCACACAGG + Intergenic
1065428933 10:25633863-25633885 GAGGAACCAGAAGCCCAGAGAGG + Intergenic
1065996628 10:31065381-31065403 AAGGAAACAGAAGCCCAGAGGGG - Intergenic
1067398056 10:45942623-45942645 AGGTGCCCAGAAGCCCACCCTGG - Intergenic
1067866374 10:49911712-49911734 AGGTGCCCAGAAGCCCACCCTGG - Intronic
1068096517 10:52498876-52498898 AAGGAACCAGAAACCAACCCTGG - Intergenic
1069254065 10:66310319-66310341 AAGAAATCTGAAGCCCACAGAGG + Intronic
1072024805 10:91444408-91444430 TAGAAACCAGAAGCCCAGATGGG + Intronic
1073422765 10:103437815-103437837 TAGTAAACTGAAGCCCACAGAGG + Intronic
1073608350 10:104918579-104918601 AAGGAAGCAGAGGCCCACAGAGG + Intronic
1074137808 10:110643651-110643673 AAGAAACCAGAAACCCACGGTGG + Intergenic
1074438851 10:113457336-113457358 AACTAACCACAAGGCTACACAGG - Intergenic
1075088592 10:119430348-119430370 AAGAAAGAAGAATCCCACACTGG - Intronic
1075202032 10:120412558-120412580 AAGAAACCAGGTGTCCACACAGG + Intergenic
1076041969 10:127257893-127257915 AATTAACCAACAGCCCTCACTGG - Intronic
1077695206 11:4387172-4387194 AGGTAACCAGAAGCCCAGCATGG + Intronic
1080265650 11:30398593-30398615 AAGAAACAAGAAGCCCAGAGAGG - Intronic
1081576897 11:44324371-44324393 AAGAAAACAGAAGCCCAGAGAGG - Intergenic
1083524662 11:63351183-63351205 AATGAACCAGAAGCACACAGAGG - Intronic
1083818351 11:65150814-65150836 AAGTCACCACAGGCCCTCACTGG - Intergenic
1088981563 11:114868755-114868777 AAGTTACCAGAGTCTCACACTGG - Intergenic
1090267458 11:125362273-125362295 GAGAAAACAGAAGCCCACAGAGG - Intronic
1095964673 12:47858783-47858805 AAGGAACCAGAAGCCCAGGGTGG + Intronic
1096226361 12:49869145-49869167 AGGGAACCAGGAGGCCACACTGG - Exonic
1097190853 12:57218848-57218870 AAGTGCACAGAAGCACACACAGG - Intronic
1099304857 12:80940705-80940727 AAGTAAACTGAAGCTCACAGAGG + Intronic
1104041782 12:125135420-125135442 AAGAAACCAGAAGCACAGAGAGG + Intronic
1104364718 12:128166447-128166469 AAGGAAGATGAAGCCCACACAGG - Intergenic
1105803197 13:23929199-23929221 AAGTATTCAGAAGCCCACTCTGG - Intergenic
1107572537 13:41678111-41678133 AAGTCCCCAGAGGCCCACAATGG - Intronic
1108212771 13:48154994-48155016 AACCAACCAGAATCCCACAAAGG - Intergenic
1110078204 13:71276891-71276913 CAGAAACCAGAAGGCCACTCTGG + Intergenic
1114991650 14:28296324-28296346 AAGTAGCTGGAAGCCCAGACTGG + Intergenic
1121598717 14:95186554-95186576 AAGAAACAAGTAGTCCACACAGG - Exonic
1122234746 14:100325274-100325296 AGGGAAGCCGAAGCCCACACCGG - Intronic
1122831470 14:104399270-104399292 AAGCAACCTGAGGCCCTCACCGG + Intergenic
1126983138 15:54269700-54269722 AAGTACACAGAAGTACACACCGG + Intronic
1127749974 15:62027408-62027430 AAGTAACTATAAGACAACACAGG + Intronic
1127819052 15:62639388-62639410 AACTTAGCAGCAGCCCACACAGG - Intronic
1129058940 15:72844935-72844957 CAGTAAACAGAATCCCACACGGG + Intergenic
1129232422 15:74204172-74204194 ATGTAATGAGGAGCCCACACTGG + Intronic
1131620252 15:94060722-94060744 AAGTTTCCTGAAGCCCTCACTGG + Intergenic
1131878201 15:96833801-96833823 AAATAGCCAGAAACCCACAAAGG + Intergenic
1135972664 16:27083957-27083979 AAGGAGCCGGAAGCCGACACAGG - Intergenic
1138679949 16:58677237-58677259 CAGGAACCAGAAGGCCACACAGG - Intronic
1143542673 17:7579005-7579027 AAGAAATGAGAAGCCCAAACAGG - Exonic
1143841325 17:9734357-9734379 AAGTAACCGAATGCCCACATTGG - Intergenic
1144830017 17:18126080-18126102 AAGTAGGCAGGAGCCCACCCAGG + Intronic
1147009238 17:37431112-37431134 AAATAATCTGAAGACCACACAGG - Intronic
1147458791 17:40555324-40555346 TAGTATCCAGATGCCCACACAGG + Exonic
1149364442 17:55928092-55928114 AAGTAACTTGAAGCCCAGAGAGG - Intergenic
1149657449 17:58317851-58317873 AAGGAAACAGAAGCCCAGAAAGG + Intronic
1151585391 17:75005317-75005339 AAGGAACCAGAAGCCCTGAAGGG - Exonic
1157551450 18:48584590-48584612 AAGGAAACAGAAGCCCAGAGAGG + Intronic
1157928913 18:51797948-51797970 AAGGAACCAGAAGTACACAATGG - Intergenic
1158366296 18:56740842-56740864 AAGAAAACAGAAGCTGACACAGG - Intronic
1160995207 19:1879268-1879290 AAGCCACCAGAGGCCCACCCGGG + Intronic
1162537075 19:11269086-11269108 AGGAAGCCAGAAGCCAACACAGG + Intergenic
1164986422 19:32651977-32651999 TAGCAACCAGAAGCCAACGCTGG + Intronic
925632993 2:5914467-5914489 AAGGAAACAGAAGCCCAAAGTGG - Intergenic
928402372 2:30988344-30988366 AAGGAACCAGAAGTCCAGAGTGG + Intronic
928413178 2:31070085-31070107 AAGAAGCCAGAAGCCACCACTGG + Intronic
928440370 2:31287155-31287177 AAATAATCAGAAGACCACATGGG + Intergenic
934912380 2:98271201-98271223 GAGTAACCAAAATCACACACAGG - Intronic
935403898 2:102688295-102688317 AAGTAAACTGAGGCCCACAGAGG - Intronic
943276347 2:185871619-185871641 AACTAAACAGAATCCCACATAGG + Intergenic
943718517 2:191178595-191178617 AAGAATCCAGAAGAACACACTGG - Intergenic
944652087 2:201840855-201840877 AAGTAAAAAGAAATCCACACTGG - Intronic
945060938 2:205908255-205908277 AAACAACCAGAATCCCACAAAGG + Intergenic
946691157 2:222309310-222309332 AAGTAAACAGAAACCTATACCGG + Intergenic
948335491 2:237203864-237203886 AAGTCACCAGAAGCTGACAGAGG - Intergenic
1169019872 20:2321757-2321779 ACACAACCAGAAACCCACACCGG + Intronic
1169578192 20:6989751-6989773 AAGAAAACTGAAGCACACACAGG + Intergenic
1170633584 20:18085631-18085653 AAGTAAAGAGCAGCCCCCACTGG + Intergenic
1171235804 20:23523759-23523781 GAGTAAGCAGAAACCAACACTGG - Intergenic
1172306533 20:33884669-33884691 GAGGAACAAGAAGGCCACACTGG - Intergenic
1173463260 20:43261053-43261075 AAGTTCCCAGAAGCCCTCGCTGG + Intergenic
1173643645 20:44620269-44620291 AACTGCCCAGAAGCCCAGACAGG + Intronic
1175037352 20:56012529-56012551 AAATATCCAGGAGCCAACACGGG + Intergenic
1179271017 21:39850995-39851017 ATGTACCCAAAGGCCCACACGGG - Intergenic
1179345999 21:40557703-40557725 AAGCAACCTGAGGCCCTCACTGG + Intronic
1180259209 21:46656247-46656269 AAATAGCCTGAAGCCCTCACTGG + Intronic
1185235047 22:49707333-49707355 AAGAAAGCAGAGCCCCACACTGG + Intergenic
950507067 3:13401583-13401605 AAGCAGGCACAAGCCCACACAGG + Intronic
952852072 3:37737573-37737595 AACTCCCCAGAAGCCCCCACAGG - Intronic
954272067 3:49517758-49517780 AAGTATCTAGAACCCTACACAGG - Intronic
954272161 3:49518409-49518431 AAGTAACCAGAAGCCCACACAGG - Intronic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
960440707 3:117684143-117684165 AAGTCAACAGAAGTCCAAACAGG + Intergenic
963834507 3:150043083-150043105 AAGCAGCCTGAAGCCCTCACTGG + Intronic
965458805 3:168935181-168935203 AAGAAGCCTGAAGCCCACATGGG - Intergenic
965899213 3:173618102-173618124 AAGGAATGAGAACCCCACACAGG - Intronic
971328863 4:25665854-25665876 AAGTAACCAGGGGCTCACAGTGG + Intronic
973263787 4:48190290-48190312 AAAGAAACAGAAGCCCACAGAGG + Intronic
975540018 4:75499746-75499768 AAGACACCAGAAGCCTACAAGGG + Intronic
975606734 4:76162487-76162509 AAGTGACCAGCAGCCCAGCCAGG - Intronic
975669062 4:76761966-76761988 AAATATCCAGAAGCCCACTGTGG + Intronic
977420291 4:96791115-96791137 AAGGAATCAGAAGACCACCCTGG - Intergenic
978166098 4:105609107-105609129 AAGTTACCAGAAGAAAACACAGG - Intronic
979965131 4:127068105-127068127 AAGCAGCCAGAAGCTCAAACTGG - Intergenic
986190890 5:5495107-5495129 AAGTAACCCGAAGCCCACGGAGG - Intergenic
988035428 5:25822367-25822389 AAGTAAACAGAAGCAGACATAGG + Intergenic
990863488 5:60354283-60354305 AAGTAAACAGAAGTTCATACAGG + Intronic
993593830 5:89827939-89827961 AAGAACCCAGAACTCCACACAGG + Intergenic
994981659 5:106882447-106882469 GAGTAACCGGAGGCCCACATAGG - Intergenic
997371773 5:133366047-133366069 AAGGATCCAGAAGCCCAGGCAGG - Intronic
998591315 5:143481668-143481690 ATGGGACCAGAAGCCCATACAGG + Intergenic
999652032 5:153777196-153777218 AAGTAAACAGCAGTCCACTCTGG + Intronic
1001231414 5:169991739-169991761 AGTTAACCAGAAGGACACACTGG - Intronic
1001454816 5:171852549-171852571 AAGAAACCAAAAGCTGACACTGG + Intergenic
1002373688 5:178773870-178773892 AAGAAACCAGAAGCACAGAGAGG - Intergenic
1002897136 6:1385844-1385866 AAGGAACCCGCAGCCCAGACGGG + Intergenic
1006875336 6:37290522-37290544 AAGAAGCCAGAGGCCTACACTGG - Intronic
1007859483 6:44892703-44892725 AGGGAAACAGAAGCCCACATAGG + Intronic
1008483224 6:52007972-52007994 AAGTAGCCAGAAGCACACGAGGG - Intronic
1008680449 6:53866311-53866333 AAGGAAACAGAAGCCCAAAGTGG + Intronic
1010045389 6:71436923-71436945 AAGGAACCAGAAACCAACTCTGG + Intergenic
1010349187 6:74851348-74851370 AGGTATCCAGAGACCCACACTGG - Intergenic
1011008903 6:82681494-82681516 AAGTAACAGAAAGCCAACACAGG + Intergenic
1013387421 6:109645545-109645567 AAGCAGCCAGAAGCTCAAACTGG + Intronic
1016057789 6:139596843-139596865 AACTAACCAGATGCACACATTGG - Intergenic
1017089470 6:150745879-150745901 AAGCCACCAGCTGCCCACACCGG + Intronic
1018241613 6:161781124-161781146 TAGTAACCAGAAGCTGAGACAGG - Intronic
1018258910 6:161950087-161950109 AAGTAAGAAGAAGCCAACAGTGG + Intronic
1019406128 7:885076-885098 AAGTAAACAGCAGTGCACACCGG - Intronic
1021855558 7:24851526-24851548 TTGTAACCAGAAGCCAACACAGG - Intronic
1022453599 7:30537958-30537980 AAGCAGCCAGAAGCTCAAACTGG + Intronic
1022974545 7:35545383-35545405 ACGAAACCAGAAGACCACTCAGG + Intergenic
1023701359 7:42894168-42894190 AAGGAACCAGAAAACCACCCAGG + Intergenic
1026131400 7:67623797-67623819 CAGTATCCGGAAGTCCACACTGG + Intergenic
1027382550 7:77626011-77626033 AGGGAACCAGTAGTCCACACTGG + Intronic
1032981963 7:137294331-137294353 AGGTGAACACAAGCCCACACAGG + Intronic
1035785339 8:2255334-2255356 AATTAACCAGAATCCCATAGAGG - Intergenic
1035807469 8:2466382-2466404 AATTAACCAGAATCCCATAGAGG + Intergenic
1038182136 8:25239425-25239447 AAGTAAGCAGAAGCTCTCAAAGG - Intronic
1038545456 8:28422832-28422854 AGGTAGCCAGGAGCCCAAACAGG - Intronic
1039027475 8:33273172-33273194 AAATAAACAGAGGCTCACACAGG - Intergenic
1040865681 8:52046984-52047006 AAGCAGCCAGAAGCTCAAACTGG - Intergenic
1042268599 8:66933994-66934016 ACGTAACAAGAAGCCTACGCTGG - Intergenic
1044422202 8:92010007-92010029 AAGTATCCAGAAGCCTAGAAAGG - Intronic
1047974201 8:130113127-130113149 AAGCAGTCAGAAGCCCACAGAGG - Intronic
1050044130 9:1525925-1525947 CAGAAGCCAGAAGTCCACACAGG - Intergenic
1051122656 9:13768768-13768790 AAGAAACCAGGAGCCAACAATGG - Intergenic
1051696576 9:19774310-19774332 AAGTAAACACAAGCCCAGAGAGG + Intronic
1053507326 9:38654377-38654399 AAGGGATCTGAAGCCCACACGGG - Intergenic
1055993802 9:82135725-82135747 AAGGAATCAGAAGCCCAGAGGGG - Intergenic
1056076215 9:83043644-83043666 AAATAACCAGAAGCACCCCCAGG + Intronic
1058528978 9:105887482-105887504 AAGGAAACTGAAGCCCACAGAGG - Intergenic
1060086868 9:120711562-120711584 AAACAACCAGAAGTCCACAAAGG - Intronic
1186212317 X:7262359-7262381 AAGTAACAAAAAGCCCCCAAGGG - Intronic
1192089807 X:68141802-68141824 AAGAAACCAGAAGTACACTCTGG + Intronic
1193692640 X:84666251-84666273 AAGATGCCAGAAGCACACACTGG - Intergenic
1195779540 X:108446616-108446638 AAGGAATCAGAAGCCCACATTGG + Intronic
1199867938 X:151871096-151871118 AACTGCCCAGAAGCCCACCCAGG + Intergenic