ID: 954277069

View in Genome Browser
Species Human (GRCh38)
Location 3:49549256-49549278
Sequence TCTATGAAACAGACATGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954277060_954277069 -3 Left 954277060 3:49549236-49549258 CCGGGCCTGTTCTCCCCCAATCT No data
Right 954277069 3:49549256-49549278 TCTATGAAACAGACATGGGTGGG No data
954277061_954277069 -8 Left 954277061 3:49549241-49549263 CCTGTTCTCCCCCAATCTATGAA No data
Right 954277069 3:49549256-49549278 TCTATGAAACAGACATGGGTGGG No data
954277058_954277069 1 Left 954277058 3:49549232-49549254 CCACCCGGGCCTGTTCTCCCCCA No data
Right 954277069 3:49549256-49549278 TCTATGAAACAGACATGGGTGGG No data
954277059_954277069 -2 Left 954277059 3:49549235-49549257 CCCGGGCCTGTTCTCCCCCAATC No data
Right 954277069 3:49549256-49549278 TCTATGAAACAGACATGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954277069 Original CRISPR TCTATGAAACAGACATGGGT GGG Intergenic
No off target data available for this crispr