ID: 954278085

View in Genome Browser
Species Human (GRCh38)
Location 3:49555091-49555113
Sequence AGCAGTCAGGCCCGAGCGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954278085_954278097 30 Left 954278085 3:49555091-49555113 CCCAACGCTCGGGCCTGACTGCT 0: 1
1: 0
2: 0
3: 5
4: 40
Right 954278097 3:49555144-49555166 CCCTCCGCACAGGAGAGCAATGG 0: 1
1: 0
2: 0
3: 8
4: 140
954278085_954278092 6 Left 954278085 3:49555091-49555113 CCCAACGCTCGGGCCTGACTGCT 0: 1
1: 0
2: 0
3: 5
4: 40
Right 954278092 3:49555120-49555142 GGGCTTATGTAACCTTAACCTGG 0: 1
1: 0
2: 0
3: 5
4: 44
954278085_954278094 20 Left 954278085 3:49555091-49555113 CCCAACGCTCGGGCCTGACTGCT 0: 1
1: 0
2: 0
3: 5
4: 40
Right 954278094 3:49555134-49555156 TTAACCTGGTCCCTCCGCACAGG 0: 1
1: 0
2: 1
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954278085 Original CRISPR AGCAGTCAGGCCCGAGCGTT GGG (reversed) Intronic