ID: 954280881

View in Genome Browser
Species Human (GRCh38)
Location 3:49576876-49576898
Sequence TGCCAGATGGTGCCCTACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954280878_954280881 -6 Left 954280878 3:49576859-49576881 CCTGCCTTTCTTCTTGATGCCAG 0: 1
1: 0
2: 2
3: 34
4: 293
Right 954280881 3:49576876-49576898 TGCCAGATGGTGCCCTACATTGG 0: 1
1: 0
2: 1
3: 7
4: 69
954280879_954280881 -10 Left 954280879 3:49576863-49576885 CCTTTCTTCTTGATGCCAGATGG 0: 1
1: 0
2: 4
3: 27
4: 275
Right 954280881 3:49576876-49576898 TGCCAGATGGTGCCCTACATTGG 0: 1
1: 0
2: 1
3: 7
4: 69
954280877_954280881 1 Left 954280877 3:49576852-49576874 CCAGCATCCTGCCTTTCTTCTTG 0: 1
1: 0
2: 1
3: 48
4: 654
Right 954280881 3:49576876-49576898 TGCCAGATGGTGCCCTACATTGG 0: 1
1: 0
2: 1
3: 7
4: 69
954280876_954280881 29 Left 954280876 3:49576824-49576846 CCATTGCAGCATGAGTAGTCATT 0: 1
1: 0
2: 0
3: 4
4: 94
Right 954280881 3:49576876-49576898 TGCCAGATGGTGCCCTACATTGG 0: 1
1: 0
2: 1
3: 7
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954280881 Original CRISPR TGCCAGATGGTGCCCTACAT TGG Intronic
900465616 1:2824002-2824024 TGGCAGATGGTGGGCTCCATTGG + Intergenic
902760496 1:18577603-18577625 TGCCAGATGGTCACCTGCACAGG + Intergenic
905511826 1:38527848-38527870 TGCCACATGGTCCTCTCCATTGG - Intergenic
910122409 1:83804931-83804953 TGCTAAATGGGCCCCTACATAGG + Intergenic
918069170 1:181122428-181122450 TGCCAGCTGGTGCCCAGCACAGG + Intergenic
920505593 1:206513240-206513262 TGCCAGCAGCTGCCCTCCATGGG - Intronic
922386022 1:225083995-225084017 TAGCAGCTGGTGGCCTACATGGG + Intronic
923109184 1:230877366-230877388 TTCCAGATGCTGCCCTGCAATGG + Intergenic
1077344261 11:2039158-2039180 TGACAGATGGTCCCCTACTTTGG - Intergenic
1078187035 11:9060827-9060849 TGCCAGATGTGGTCCTACTTAGG - Intronic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1089762779 11:120740530-120740552 TGCCAGCTGGGGCCCTATATGGG - Intronic
1202827247 11_KI270721v1_random:94347-94369 TGACAGATGGTCCCCTACTTTGG - Intergenic
1100264054 12:92959047-92959069 TGCCATATGGGGCACCACATGGG + Intergenic
1104111118 12:125705547-125705569 CTCAAGATGGTGCCCAACATGGG + Intergenic
1106202608 13:27553230-27553252 TGCCAGTTGGTCCCCATCATGGG - Exonic
1111732953 13:92100006-92100028 TGCCACATGGTTCTCTCCATAGG - Intronic
1113552135 13:111200793-111200815 TGCCAGAAGGGGCCCTGCACTGG - Intronic
1114615795 14:24067693-24067715 TGAAAGATGGAGCCCTACTTTGG - Intronic
1114825293 14:26070295-26070317 AGCAAGATGTTGCCCTACACAGG - Intergenic
1124074719 15:26433831-26433853 AGCCAGATGGTGCCCTGGAGTGG + Intergenic
1129610091 15:77046381-77046403 CACCAGATGGTGCCCCTCATTGG - Exonic
1133139222 16:3732034-3732056 TGCCTGGTGGTGACCTACTTTGG - Intronic
1133658185 16:7887539-7887561 TGCCAGAGGGTGCACAACCTGGG - Intergenic
1137384761 16:48031204-48031226 TGCCACATGGTATCCTACACTGG - Intergenic
1138725024 16:59126773-59126795 TGCCATATGGTGCCTTTGATAGG + Intergenic
1144223907 17:13126001-13126023 TGCAATATGGTGCCCTGGATTGG - Intergenic
1145051185 17:19662519-19662541 TGCTAGTTGGTGACTTACATTGG + Intronic
1150479582 17:65499140-65499162 TGCCAGCTGGTGCCCTCCAAAGG + Intergenic
1151467943 17:74299786-74299808 AGCCAGATGGTGCCATACACAGG - Exonic
1156692646 18:39726992-39727014 TGCTAGATTGTGCCATAAATTGG - Intergenic
1157218392 18:45805166-45805188 TGCAATATGGTACCCTAGATTGG + Intergenic
1157848736 18:51028464-51028486 TGCCATGTGGTGCTCTCCATAGG - Intronic
1160937018 19:1601260-1601282 TGCCACATGGGTCCCTTCATAGG - Intronic
1166170616 19:41025539-41025561 TGCCAACTGCTCCCCTACATGGG - Intergenic
1167271387 19:48508496-48508518 TACCAGCTGGTACCCAACATTGG + Intronic
928817034 2:35309737-35309759 TGCCATAAGTTGCCCTACCTGGG + Intergenic
930033107 2:47070117-47070139 TGCCTGATGATGCCCTCCAAGGG - Intronic
932569092 2:72928367-72928389 AGCCCGTTGGTGCCCCACATGGG - Intronic
936427781 2:112434934-112434956 TGCCAGATGCTGCCCACCACCGG - Intergenic
940899241 2:159111166-159111188 TGCCTGGTGGTGCCCTGCCTGGG + Intronic
943146208 2:184048809-184048831 TGCCATATGGTCCCCTACGTAGG - Intergenic
1170365913 20:15598144-15598166 TGCCAGCTGGTGCTTTTCATAGG - Intronic
1171258557 20:23710755-23710777 TGAGAGATGGTGCCCTATGTTGG - Intergenic
1171279283 20:23882447-23882469 TTCCTGAGAGTGCCCTACATGGG - Intergenic
1174197110 20:48781144-48781166 TGCAACATGGTGCCCTAGGTTGG + Intronic
1175073219 20:56352012-56352034 TGCCACATGGGGCTCTCCATGGG + Intergenic
1176374463 21:6080277-6080299 TGCCAGATGCTGCCCACCACCGG + Intergenic
1177413329 21:20760436-20760458 TACCAGATGGTACCTCACATTGG + Intergenic
1179749012 21:43457968-43457990 TGCCAGATGCTGCCCACCACCGG - Intergenic
949838277 3:8292654-8292676 TGCCACTTGGTGCACTTCATTGG + Intergenic
953715799 3:45316064-45316086 GGCCAGATGGAGCCCTGCCTAGG + Intergenic
954280881 3:49576876-49576898 TGCCAGATGGTGCCCTACATTGG + Intronic
962609620 3:137063476-137063498 TGCCACATGGTCCTCTCCATAGG + Intergenic
963043475 3:141085795-141085817 TGCCAGAAGGTCCCCTCCCTAGG + Intronic
972315950 4:37926018-37926040 TGCCAGATGGTGCCCTGCAATGG + Intronic
973747934 4:53982829-53982851 TTCCCCATGATGCCCTACATGGG - Intronic
985786781 5:1899719-1899741 TGCCAGCAGGGGCCCCACATTGG + Intergenic
989107395 5:37876456-37876478 TGCCACATGGGCCCCTCCATAGG - Intergenic
993425773 5:87762627-87762649 TGCAAGATGTTGCCCCTCATAGG + Intergenic
1001357306 5:171041107-171041129 TGCCACATGAAGCCCTCCATAGG + Intronic
1001413556 5:171527612-171527634 TGACAGATGTTGTCCTACCTGGG + Intergenic
1003799694 6:9649754-9649776 TGCCACAGGGTCCCCTCCATAGG + Intronic
1007546421 6:42698178-42698200 TGTAAGATGGTGCCCTCCTTGGG + Exonic
1016946946 6:149544158-149544180 TGCCAGGTGCTACTCTACATGGG + Intronic
1023457512 7:40357342-40357364 TGCTAGATGTTGGCATACATTGG - Intronic
1028155971 7:87429770-87429792 TGCCAGAGGGTGTTCTACAGTGG - Intronic
1032580735 7:133101004-133101026 TGCCAGCTGTAGTCCTACATCGG + Intergenic
1034370045 7:150587091-150587113 TGCCAGAAGGAGACCTTCATTGG - Intergenic
1036618177 8:10404603-10404625 TGGCAGATGGTGACCAAAATGGG + Intronic
1042808316 8:72796084-72796106 TGCCAGATGGAGCCTTAAAAGGG - Intronic
1046794501 8:118356346-118356368 GGCCAGGTGGTGCCCTACACCGG - Intronic
1048025001 8:130578067-130578089 TGCCAGATGGTGCCCTGACAAGG - Intergenic
1050256742 9:3800462-3800484 TTCCACATGATGCCCTACGTGGG + Intergenic
1051758873 9:20438285-20438307 GTCCAGATGGTACCCTGCATAGG + Intronic
1058421051 9:104833813-104833835 TGCCAGTTGGTTCCTCACATGGG + Intronic
1189610834 X:42732608-42732630 TGCCACATGGTGCTGTCCATAGG - Intergenic
1195851520 X:109287486-109287508 TTCCACATGGTGATCTACATTGG - Intergenic