ID: 954283457

View in Genome Browser
Species Human (GRCh38)
Location 3:49601095-49601117
Sequence CTGGCCACTGACCATATCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 64}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954283457_954283463 26 Left 954283457 3:49601095-49601117 CCTGCGATATGGTCAGTGGCCAG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 954283463 3:49601144-49601166 ACCCCTCTAGGGGAACAGACAGG 0: 1
1: 0
2: 0
3: 8
4: 104
954283457_954283461 15 Left 954283457 3:49601095-49601117 CCTGCGATATGGTCAGTGGCCAG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 954283461 3:49601133-49601155 CTCTCAGAGAAACCCCTCTAGGG 0: 1
1: 0
2: 1
3: 14
4: 147
954283457_954283462 16 Left 954283457 3:49601095-49601117 CCTGCGATATGGTCAGTGGCCAG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 954283462 3:49601134-49601156 TCTCAGAGAAACCCCTCTAGGGG 0: 1
1: 0
2: 1
3: 14
4: 119
954283457_954283460 14 Left 954283457 3:49601095-49601117 CCTGCGATATGGTCAGTGGCCAG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 954283460 3:49601132-49601154 TCTCTCAGAGAAACCCCTCTAGG 0: 1
1: 0
2: 1
3: 19
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954283457 Original CRISPR CTGGCCACTGACCATATCGC AGG (reversed) Intronic
905872093 1:41410490-41410512 CTGGCCACTGAGCAAAGCACTGG + Intergenic
907260865 1:53217530-53217552 CTGCACACTGACCACATCTCTGG + Intronic
920456764 1:206107529-206107551 CTCCCCACTGTCCATATCACAGG + Intergenic
920558983 1:206925518-206925540 CTGCACTCTGACCACATCGCAGG - Intergenic
922404641 1:225299119-225299141 CTGGCGACTGGCCAGATGGCTGG - Intronic
923976713 1:239272232-239272254 CAGGCCACTGACCACGTGGCCGG + Intergenic
1067551143 10:47237463-47237485 CTGGTCATTGCCCATATCACTGG - Intergenic
1067571567 10:47375387-47375409 CTGGCCACTCACGATATCCCTGG - Intronic
1067759406 10:49032308-49032330 CCGGCCTCTGACCACATCACTGG + Intronic
1069907355 10:71739656-71739678 CTGGCCTCTGGCAACATCGCGGG + Intronic
1070325122 10:75383899-75383921 CTGGCCATTGATCAAATAGCTGG - Intergenic
1070957531 10:80474176-80474198 CTGGCCTCTGACCTGATCACAGG - Intronic
1076924065 10:133472775-133472797 CTTTCCACTGACCAGATCTCAGG - Intergenic
1076924076 10:133472849-133472871 CTTTCCACTGACCAGATCTCAGG - Intergenic
1076924097 10:133472988-133473010 CTTTCCACTGACCAGATCTCAGG - Intergenic
1077299818 11:1841742-1841764 CTGGCCACTGACCACACTGCAGG - Intergenic
1080189432 11:29526501-29526523 CAGGCCCCTGACCATTTAGCTGG - Intergenic
1087015325 11:93549098-93549120 ATGGCCACTGACCATAAGGCAGG - Intergenic
1097263475 12:57732776-57732798 CTGACCACTGAGAATATCCCAGG + Intronic
1097786495 12:63765735-63765757 CTTGCCACTGCCAATATTGCTGG - Intergenic
1105019726 12:132808025-132808047 CTGGCCGTTGACCATATAGGGGG + Exonic
1105520534 13:21127097-21127119 CTGGCCCCTGCCCACATCTCTGG + Intergenic
1112136577 13:96584913-96584935 CTGGGCACAGACCATATGGAGGG + Intronic
1116301301 14:43187413-43187435 AGGGCCACTGACTATATCACAGG + Intergenic
1121288497 14:92755407-92755429 CTGGGCACTGACTATATGACAGG - Intergenic
1122824845 14:104364607-104364629 CTGGGCACTGTCCACGTCGCTGG + Intergenic
1202861884 14_GL000225v1_random:88751-88773 CGGGCCGCTGACGGTATCGCGGG + Intergenic
1128789601 15:70423318-70423340 CTGGCTTCTGCCCATATCCCTGG + Intergenic
1131958411 15:97762749-97762771 CTGACCACTGACCAGATGGCCGG - Intergenic
1141102773 16:81210195-81210217 CTGGCCTCTGCTCATATCACAGG + Intergenic
1144968516 17:19092745-19092767 CTTGCCACAGACCACATGGCTGG - Intergenic
1144979401 17:19159318-19159340 CTTGCCACAGACCACATGGCTGG + Intergenic
1144988821 17:19218914-19218936 CTTGCCACAGACCACATGGCTGG - Intronic
1153271138 18:3322735-3322757 CCTGCCACTGACCATGTAGCAGG + Intergenic
1155755757 18:29493496-29493518 CTGACCACTGACCATAGAGTTGG + Intergenic
1160153014 18:76409613-76409635 CTGGCCACTGAGCATATTTTTGG - Intronic
1163727126 19:18929154-18929176 CTGGGCACTTAACATGTCGCCGG - Intronic
1164828698 19:31303510-31303532 CTGGCACCTGACCATCTCGGTGG + Intronic
1165280527 19:34793377-34793399 CTGACCACTGACCCTATGCCAGG - Intergenic
1165407070 19:35637545-35637567 CTGGCCACAGACCCTATCTCAGG - Exonic
1167119000 19:47505655-47505677 CTGGCCGCTGATCTGATCGCTGG - Intronic
928106894 2:28476406-28476428 ATGGCCACTGACCTCATGGCTGG - Intronic
929441794 2:41970868-41970890 CTGGCCCCTCTCCATATCACAGG + Intergenic
930054032 2:47238426-47238448 CTGGGAACTGACCATATCAGCGG - Intergenic
935622093 2:105139128-105139150 CTGAACCCTGACCATATCACTGG - Intergenic
945807284 2:214505152-214505174 ATGGCCACTGTGCATATGGCCGG - Intronic
947297832 2:228652315-228652337 GTGCCCACTTACCATATTGCAGG + Intergenic
948953195 2:241268476-241268498 CTGGCTACTGACCGTTTTGCTGG - Exonic
1175329529 20:58153784-58153806 CTGGGCACTGACCACATGCCAGG + Intronic
1175814637 20:61877126-61877148 CTGGGCACTGTCCCTATCACGGG - Intronic
950197941 3:11022387-11022409 CTGGCCACTGGCCATCACGCTGG + Exonic
953352014 3:42222873-42222895 CTGGCCACTGACCCTTTCTCTGG + Intronic
954283457 3:49601095-49601117 CTGGCCACTGACCATATCGCAGG - Intronic
954717663 3:52534315-52534337 CTGCCCACTGACCAGAGCCCGGG + Intronic
955134522 3:56203253-56203275 CAGGCCACTGTCCATCTCTCAGG - Intronic
958996942 3:100915789-100915811 CTGCACACTGACCACAACGCTGG + Intronic
966330593 3:178807999-178808021 CTGGGCACTGGACATATGGCAGG + Intronic
969697074 4:8740951-8740973 CTGGCCCCTGACCAGCTCGAGGG - Intergenic
971092704 4:23363339-23363361 CTGGCCACTGTCCACATCACTGG + Intergenic
974700075 4:65431686-65431708 CTGGCCAGTGACCATACAGCTGG + Intronic
979693100 4:123581435-123581457 CTGGCCACTTGCCATGTCCCAGG - Intergenic
985625598 5:983511-983533 CTTGCCTCTGACCAGATCGCTGG + Intergenic
987248663 5:16076876-16076898 CTGGCCACTGGCCATTTCGCAGG - Intronic
989430834 5:41353479-41353501 CTGACCTCAGACCATATCCCAGG - Intronic
992189482 5:74277055-74277077 CTGGCCCCTGCCCATTTCCCTGG - Intergenic
993439328 5:87936585-87936607 CTGGCCACTGTCCATGTAGTTGG - Intergenic
994393275 5:99208952-99208974 CTGGATATTAACCATATCGCAGG + Intergenic
996487668 5:124055974-124055996 CTGTCCACAAACCATATGGCAGG + Intergenic
1022011319 7:26310314-26310336 CTGGGCACTGACAATATGCCAGG + Intronic
1025823324 7:64991717-64991739 CAGGCCCCTGACCATTTAGCTGG + Exonic
1029953217 7:104608948-104608970 CTGGGCACTTACTATATTGCAGG - Intronic
1037926179 8:22845803-22845825 CTGTCCTCTGATCAGATCGCAGG + Intronic
1044795257 8:95890720-95890742 GTGGCCAGTGAACATATCGGAGG - Intergenic
1059956540 9:119521859-119521881 CTGGTCACTGACCACATCACTGG - Intronic
1061397016 9:130348882-130348904 CTGGCCACTGGCCACCTCTCGGG + Intronic
1062181735 9:135194588-135194610 CTGGCCACTGAGCCTCTCCCTGG - Intergenic
1062592074 9:137278682-137278704 CTGGCCGCGGTCCATGTCGCAGG - Exonic