ID: 954283612

View in Genome Browser
Species Human (GRCh38)
Location 3:49602169-49602191
Sequence ATGTTCCTCTTTCTGATCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954283612_954283616 1 Left 954283612 3:49602169-49602191 CCTTGGATCAGAAAGAGGAACAT 0: 1
1: 1
2: 3
3: 24
4: 211
Right 954283616 3:49602193-49602215 CATTGCAGGGTGATTTCCTCAGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954283612 Original CRISPR ATGTTCCTCTTTCTGATCCA AGG (reversed) Intronic
900348629 1:2224355-2224377 GTCTTCCTCTTTCTGGTCCTGGG + Intergenic
900785933 1:4650550-4650572 GTCTTCCTCTCTCTGATGCATGG + Intergenic
901084181 1:6600805-6600827 CTGTGCCTCTTTCCAATCCAAGG - Intronic
902532856 1:17101582-17101604 CTGTCCCTCTTTCTGTCCCAAGG - Intronic
902746771 1:18479890-18479912 CTTTTCCTCTTTCTGATCATCGG - Intergenic
903316739 1:22513967-22513989 ATCTGCCACTGTCTGATCCACGG - Intronic
906918761 1:50040810-50040832 ATTTCCCTCTTACTGACCCAAGG - Intergenic
907782716 1:57582033-57582055 AGCTTCCTCTCTCTGTTCCATGG - Intronic
907826278 1:58020143-58020165 ATGTTCCTCATTCTAATTCATGG - Intronic
907864140 1:58382543-58382565 ATGTTCCACTTGCTGAGCTATGG + Intronic
909055219 1:70812827-70812849 ATGTGCCTCTTTCTTATTGAGGG + Intergenic
909096297 1:71292525-71292547 TAGGTCCTGTTTCTGATCCATGG - Intergenic
909495792 1:76277040-76277062 ATGTTCTGCTTACTAATCCAGGG + Intronic
909872772 1:80764177-80764199 ATGTTGCTCTTGCTGTTGCATGG - Intergenic
910899386 1:92103462-92103484 ATGTTCTGTTCTCTGATCCAGGG - Intronic
911961411 1:104307809-104307831 ATGTTTGTCTTTCTGTTCCTGGG - Intergenic
912875427 1:113353415-113353437 AATATCCTCTTTCTGATTCAGGG + Intergenic
913044298 1:115060768-115060790 ATATTCCTCTGTCCAATCCAAGG - Intronic
915817441 1:158983749-158983771 ATGTGAATCTGTCTGATCCATGG + Intergenic
918186588 1:182132960-182132982 GTGTTCCACATTCTGGTCCAAGG - Intergenic
919786480 1:201261536-201261558 ATGTGCCTCTCTCTGAGGCAAGG - Intergenic
1062824259 10:556809-556831 ATGTTCCTCTCTGTGACTCAAGG - Intronic
1062981836 10:1730348-1730370 GGGTTTCTCTTTCTGATCCGTGG + Intronic
1064906579 10:20353218-20353240 ATGTTTATCATTCTTATCCATGG - Intergenic
1067200148 10:44162023-44162045 TAGTTCCTCTTTCTGATAAAGGG - Intergenic
1069483674 10:68806782-68806804 ATTTTTCTCTTTTTGATACAGGG - Intergenic
1069662677 10:70133867-70133889 ATCTACCTCTTTCTCATCCTTGG - Intergenic
1070488043 10:76949870-76949892 ATGTTCCACCTGCTGATGCACGG - Intronic
1070625802 10:78050191-78050213 TTGTTCCCCTTTCTGCCCCATGG + Intronic
1070655411 10:78267742-78267764 GTGAGCCTCTGTCTGATCCATGG - Intergenic
1070917527 10:80164378-80164400 ATGCTCAGTTTTCTGATCCATGG - Intronic
1072115297 10:92364915-92364937 CTGTTGCTCTTTCTGATTGAAGG + Intergenic
1072896953 10:99375585-99375607 ATTTTACTCTTTCTGCTACATGG + Intronic
1074696677 10:116056060-116056082 AAGTTCCTCTTGCTGTTTCAGGG + Intergenic
1075208107 10:120464171-120464193 TTGTTCCTCCTTCTGTTCAATGG + Intronic
1076407805 10:130224903-130224925 ATGTTCCTGCCTCTAATCCAGGG + Intergenic
1079181302 11:18196124-18196146 ATGGTCTTCTTTCTCCTCCATGG + Intronic
1079269776 11:18973109-18973131 ATGGTCTTCTTTCCTATCCATGG - Intergenic
1080303955 11:30816842-30816864 TTGTTCCTCTTCCTTAACCAAGG + Intergenic
1082612408 11:55317183-55317205 ATGTACCTATTTAAGATCCAAGG - Intergenic
1082951799 11:58824385-58824407 TTTTTCCTTTTTCTGGTCCAGGG - Intergenic
1084965989 11:72744839-72744861 CTGTTCCAGTTTCTGTTCCACGG - Intronic
1085462387 11:76701988-76702010 CTTCTCCTCGTTCTGATCCAGGG - Intergenic
1085646157 11:78224351-78224373 ATGCTCCTTGTTCTGATCCAGGG - Intronic
1085946013 11:81274447-81274469 ATGTTCCTCATGCTAATCCAGGG - Intergenic
1087794124 11:102437841-102437863 ATGTTCCTCATCCTGTTTCAGGG + Intronic
1088547705 11:110977075-110977097 ATGTTCTCTTTTCTGTTCCATGG - Intergenic
1088735245 11:112723379-112723401 ATGTTGCTTTTTCTGAGGCATGG + Intergenic
1088889094 11:114030709-114030731 ATTCTCCTCTATCTTATCCAAGG + Intergenic
1090371224 11:126254495-126254517 ATGTTCCCCTTTAAGATCTATGG - Intronic
1090691672 11:129189505-129189527 ATATTCCTCCTTCTTATCCAGGG + Intronic
1091561115 12:1614405-1614427 TGGTGACTCTTTCTGATCCATGG + Intronic
1091931143 12:4396299-4396321 ATGTTGCTATTTCTCATCCTGGG - Intergenic
1093292089 12:17339259-17339281 CTGTTCCTCTTTCTGATTCTAGG + Intergenic
1094547152 12:31415422-31415444 ATTTTCTTCTTTCTGGTCCGAGG + Exonic
1094697845 12:32839298-32839320 ATGTGCCCCTTTCTGAATCAAGG + Intronic
1094700365 12:32864224-32864246 ATTATCCTGTTTCTGATCCCAGG - Intronic
1097493293 12:60296794-60296816 ATGTTCCTCTGTGTGATTGAAGG + Intergenic
1100024101 12:90106642-90106664 ATGATCCTCTTTCTGATGTATGG - Intergenic
1101177663 12:102172146-102172168 TTGTTTCTCTTTCTGCCCCAGGG + Intronic
1101875629 12:108595139-108595161 ACCTTCCTCTGTCTGATCCCAGG + Intronic
1102154555 12:110714307-110714329 ATGTTCCTCTCACTGTTCTAGGG - Intergenic
1102535261 12:113576292-113576314 ATGGTCCTCTTGCTGCTCCCTGG - Intergenic
1106243348 13:27927178-27927200 AAGTTCCCCTTTCTGATCCAAGG - Intergenic
1107162472 13:37247229-37247251 ATGCTCATGTTTCTGATCCGGGG + Intergenic
1109961119 13:69632663-69632685 ATTTTCTTCATTCTAATCCAAGG + Intergenic
1110162028 13:72389809-72389831 ATTATCCCCTTTCTGATTCAAGG - Intergenic
1110619011 13:77574332-77574354 ATGTTCCTATTTCTGATTCTTGG + Intronic
1111446328 13:88349247-88349269 AGGTTCCTATTTCTCATTCAGGG - Intergenic
1113735006 13:112672300-112672322 AGGCTCCTCTTTCTGTTCCCTGG - Intronic
1114181902 14:20374698-20374720 CTGTTTCTCTTTCTGAGCCTTGG + Intronic
1115407671 14:33036433-33036455 ATTTCCCTCTTTTTGGTCCAAGG - Intronic
1118472568 14:66088598-66088620 ATGTTCTTCTCCCTAATCCATGG - Intergenic
1120059101 14:79960813-79960835 ATGTTCTCCTTTCTGTTTCATGG + Intergenic
1121387071 14:93537603-93537625 ATGTTGCACTCTCTGATCCATGG + Intronic
1124724887 15:32147982-32148004 ATGCTCATCTATCTGATCTAAGG - Intronic
1125979358 15:43985843-43985865 AAGTTTCTCTTTCTCCTCCAGGG - Intronic
1127472048 15:59298799-59298821 ACTTTCCTCTTTGTGATTCAAGG - Intronic
1128140387 15:65296208-65296230 GTGTTCCTTTTTCTGTTCAATGG + Intronic
1128768290 15:70264463-70264485 CTGTTCCTCTTGCTCCTCCAGGG + Intergenic
1130709068 15:86261506-86261528 ATGTTTGTATTTCTGATCCAAGG - Intronic
1131789518 15:95948954-95948976 ATATTCCTCTTTCCAATCCACGG + Intergenic
1134683079 16:16140081-16140103 ATGTTCTTCCTTTAGATCCAAGG - Intronic
1135126364 16:19813053-19813075 ATGCTGATATTTCTGATCCATGG + Intronic
1135344637 16:21678548-21678570 CTATTCCTTTTTCTGAGCCATGG + Exonic
1135914831 16:26596465-26596487 CTGTTCCACCATCTGATCCAAGG + Intergenic
1139158581 16:64475296-64475318 ATGTTCCATTTCTTGATCCAGGG + Intergenic
1140748228 16:77999726-77999748 ATGTTCCGATTGCTGACCCATGG - Intergenic
1146637382 17:34516564-34516586 AGATTCCTCCTTCTGACCCAGGG - Intergenic
1147036076 17:37682154-37682176 ATGTTTCTCTTCCTGCCCCAGGG + Intergenic
1147278618 17:39338717-39338739 ATGTACCTCTTGTTGATACATGG + Intronic
1147349143 17:39826494-39826516 ATGTTTCAGTTTCTGATTCATGG + Intronic
1147727888 17:42577921-42577943 AACTTCCTCTTTCTGCTCCCGGG + Intergenic
1152119425 17:78409100-78409122 CTCTTCATCTTTCTGCTCCATGG + Intronic
1155172060 18:23274370-23274392 ATCTACCTCTTTATAATCCATGG - Intronic
1155832499 18:30535333-30535355 ATATTCTTCTGTCTGATCCTTGG - Intergenic
1156610906 18:38722977-38722999 AAGGTCCTCTTTCTGAACTATGG - Intergenic
1157167112 18:45367970-45367992 ATGTTCCTGTTTTCAATCCAAGG - Intronic
1157427409 18:47595614-47595636 AGGTTCCTCTTTCTGTGCCAAGG - Intergenic
1159341125 18:67135025-67135047 ATGTTCCATTTTCTGAGGCAAGG + Intergenic
1160673127 19:375719-375741 AAGTGCCTCTTTGGGATCCAGGG + Exonic
1162890333 19:13728196-13728218 ATGTCCCTGTTTCTACTCCATGG + Intergenic
1167020594 19:46872385-46872407 ATTTTACTATTTCTGATTCAGGG + Intergenic
1167604414 19:50474077-50474099 CTGTTCCTTTTTCTCACCCAAGG - Intronic
1168321659 19:55513875-55513897 GTTTTCCTCTTTCTCATCTAGGG - Intronic
1168541174 19:57211678-57211700 ATTTTCCTCTTCCTGAATCATGG - Exonic
929215916 2:39413190-39413212 ATTTTTCTCTTTCTGATACAAGG - Intronic
929230051 2:39549951-39549973 ATAGTCCAGTTTCTGATCCATGG + Intergenic
933167023 2:79087548-79087570 ATGTTCCTGTCTCTGAGCCAAGG - Exonic
933172345 2:79137966-79137988 ATGTTCCTGTCTCTGAGCCAAGG - Intergenic
933438868 2:82283975-82283997 ATTTTCCTCTTTCTCATCTAAGG + Intergenic
933516357 2:83308727-83308749 GTGTTCCTGTTGCTGATTCAAGG - Intergenic
935499012 2:103815450-103815472 ATTTTCCTAATTCTGCTCCAGGG + Intergenic
937654154 2:124356055-124356077 ATTTTCCTCTTTCTAAGCCTTGG + Intronic
937688062 2:124721048-124721070 ATCTTCCTCTGTCTGATTAATGG - Intronic
938869484 2:135460014-135460036 GTGTTTCTCTTTCTGTTTCAAGG - Intronic
939049128 2:137286430-137286452 GTGTTCTTCTTTCTGATGCCAGG + Intronic
940330204 2:152466073-152466095 ATCTTGATCTTTCTGAGCCATGG + Intronic
940453977 2:153872887-153872909 CTGTTTCTCTTTCTGAGCCTTGG + Intronic
943947031 2:194079722-194079744 ATGTTTATCTATCTGATACATGG - Intergenic
946514003 2:220392010-220392032 ATGTTCTGTTTTCTGACCCAGGG - Intergenic
947265253 2:228272546-228272568 AGGTTCCTATTTGTGAACCATGG - Intergenic
947337554 2:229103078-229103100 AGGTTCCTCTTTTTGAATCAGGG + Intronic
947392311 2:229651757-229651779 ATGTTCCTTTTTGAAATCCAGGG - Intronic
1169928285 20:10805837-10805859 ATGTGCCTCTCTCATATCCAGGG + Intergenic
1170435420 20:16322637-16322659 ATTTTTCTCTTTCTGATTCCCGG + Intronic
1171268650 20:23795793-23795815 ATTTTACTTTCTCTGATCCAAGG + Intergenic
1172323498 20:34016389-34016411 ATGTTACTGTTTATGACCCAAGG + Intronic
1172627041 20:36353246-36353268 GTCTTCCTCTCTCTGAGCCATGG - Intronic
1173176744 20:40770764-40770786 GTGTTGCTCTCTCTGCTCCATGG + Intergenic
1174467200 20:50726755-50726777 CTGTTTCTTTGTCTGATCCATGG + Intergenic
1178794857 21:35734555-35734577 ATATTCATCTTTCTGAGCCTGGG - Intronic
1181409388 22:22708065-22708087 ATGATCTTCTGTCTGGTCCAAGG + Intergenic
1181865696 22:25853159-25853181 ATCATCCTCTTTCAAATCCAGGG + Intronic
1182290167 22:29270923-29270945 TTGTTCCTCTTGGTGATTCAGGG + Intronic
949196594 3:1317018-1317040 ATGTTCCTCTTGCTTATCATTGG - Intronic
950118588 3:10467190-10467212 ATATTACTCTGTCTGATCCAAGG - Intronic
951295968 3:20935066-20935088 ATGTTCCTCCCTCTGCTCCAAGG + Intergenic
953882701 3:46699900-46699922 CTGTTTCTGTTTCTTATCCATGG - Intergenic
954283612 3:49602169-49602191 ATGTTCCTCTTTCTGATCCAAGG - Intronic
954919625 3:54178793-54178815 ATTTTCCTCCTTTGGATCCAGGG + Intronic
955363385 3:58292162-58292184 CTGTTCCTTTTCCTGGTCCAGGG + Intronic
955566032 3:60247350-60247372 TTCTTCTTCTTTCTGATGCAAGG - Intronic
958039703 3:88211839-88211861 ATGTTTCTCTTTGTAATTCAGGG - Intergenic
958619544 3:96538923-96538945 ATGTTCCTTTTTCTGTTCCAGGG - Intergenic
960601328 3:119461903-119461925 ATGTTAGTCTTACTGATCAAAGG + Intronic
960992597 3:123321768-123321790 ATGTTCCTCTCCATGAGCCAGGG + Intronic
962358389 3:134714515-134714537 ATGTGCCTCTTTCTGAGCCCTGG - Intronic
962964470 3:140340739-140340761 AATGTCCTTTTTCTGATCCAGGG + Intronic
964443108 3:156732333-156732355 ATGCTTCTCTTTCTGACCCTTGG - Intergenic
968209089 3:196832927-196832949 ATGTTTCTCTATCAGACCCAGGG + Intergenic
969050563 4:4369998-4370020 AGGATCATCTTTCTGTTCCAAGG - Intronic
969851486 4:9960535-9960557 ATGTACCCCTATCTGATCAAAGG + Intronic
969927505 4:10598890-10598912 ATTTGCCTCTTTCTGGTCCTTGG + Intronic
971076393 4:23153928-23153950 ACATTCCTTTTTTTGATCCAAGG + Intergenic
971937437 4:33170319-33170341 ATCTTCCTCTTTCTAATCCCAGG - Intergenic
972237881 4:37155091-37155113 ATGTTCTTCTTTCTTTTCCCAGG - Intergenic
972466561 4:39362708-39362730 AAGTTTCTCTTGCTAATCCAAGG - Intronic
974338221 4:60579230-60579252 ATGTCCTCATTTCTGATCCAGGG - Intergenic
974715115 4:65659381-65659403 ATTTTCCTCTTTCCAATTCACGG - Intronic
975155127 4:71063024-71063046 TTGTTTCTCTTTCTTTTCCAAGG - Intergenic
975223317 4:71839757-71839779 ATTTGCCTCTGTCTTATCCAGGG - Intergenic
975717350 4:77217641-77217663 TTGTTCCCCTTTGGGATCCAAGG - Intronic
976494774 4:85714879-85714901 ATGTTCCTCTTTCTAATCAATGG - Intronic
978925577 4:114238965-114238987 ATATTACTTATTCTGATCCATGG + Intergenic
980056877 4:128086334-128086356 ATGTTCCTTTTTTTGAGACAGGG + Intronic
981292102 4:143088332-143088354 AGGATCCTCTACCTGATCCAAGG + Intergenic
981574215 4:146187310-146187332 ATATTCTTCTGTCTGCTCCAGGG - Exonic
983877791 4:172897054-172897076 ATGTTTGCCTTTCTGAACCAAGG - Intronic
987597037 5:20015159-20015181 ATGTGTCTGTTTCTGAACCAAGG - Intronic
987664974 5:20925206-20925228 ATGTTCCTCCTTATGCCCCATGG - Intergenic
990564040 5:57011148-57011170 AATTTCCTTTTTCTGCTCCAGGG - Intergenic
990646205 5:57847204-57847226 ATGTTCATCATTGTGATCAATGG - Intergenic
991193226 5:63900614-63900636 ATGTTCTTCTTTCTGTTTGATGG - Intergenic
992175176 5:74142819-74142841 ATTTTCCCCTTTCCAATCCATGG - Intergenic
995167135 5:109057039-109057061 ATATTAAGCTTTCTGATCCATGG + Intronic
997154980 5:131545969-131545991 CTATTGCTCTTTCTGATCCCAGG + Intronic
997842249 5:137252573-137252595 TTCTTCCTCTTTCTCTTCCAGGG + Intronic
999353238 5:150898109-150898131 ATGTCTCCCTTTATGATCCATGG + Exonic
999356768 5:150942238-150942260 ATGTGTCTCTTTATGATCCATGG + Intergenic
1001160552 5:169308881-169308903 ATGTGCCTCATTCTGACCAAAGG + Intergenic
1003950117 6:11108984-11109006 ATGTTCCTCTATCTGATAGAAGG - Intronic
1004033526 6:11898227-11898249 ATCTACCTATTTCTGATCTAAGG + Intergenic
1004700266 6:18072254-18072276 ATTTTCGTCTTTCATATCCATGG + Intergenic
1005771554 6:29077904-29077926 AATTTCCTCCTTGTGATCCAAGG - Intergenic
1006965502 6:37980058-37980080 ATGTTCCCTTCTCTGTTCCATGG + Intronic
1007466661 6:42057039-42057061 TTGTTCCTTTTTGTTATCCAAGG + Intronic
1007498205 6:42276365-42276387 ATTTTCCTTTTTCTGACCCCGGG + Intronic
1008382707 6:50851974-50851996 ATGTTATTCTCTCTGATACATGG + Intergenic
1008894308 6:56534896-56534918 ATGTTCATCTTTTTTATTCAAGG + Intronic
1010388859 6:75313199-75313221 TTTTCCCTCTTTCTCATCCATGG + Exonic
1011854550 6:91673035-91673057 ATGTTCCTAATTCAAATCCAAGG + Intergenic
1011937574 6:92800175-92800197 ATGTTACTCTTCTTGATCAAAGG + Intergenic
1014427014 6:121320270-121320292 ATTTTCCACTTTATGAACCATGG - Intronic
1016259001 6:142145266-142145288 ATGTTCCTCTTCCTGGTAGAAGG - Intergenic
1016578098 6:145594075-145594097 ATGTTGTTATTACTGATCCATGG + Intronic
1018048365 6:159985381-159985403 AAGTTCCTCATTCTGAGCCTTGG + Intronic
1018292509 6:162307081-162307103 TTGTTGCTGTTTCAGATCCATGG - Intronic
1020469414 7:8518782-8518804 AAGTAGCTCTTTCTAATCCATGG + Intronic
1020637769 7:10716782-10716804 AATGTCCTTTTTCTGATCCAAGG - Intergenic
1020706983 7:11557695-11557717 AAGTTCCTCTTTGTTATCAATGG - Intronic
1022314148 7:29228974-29228996 ATGCTCTCCTTTCTGGTCCATGG + Intronic
1025550180 7:62236600-62236622 ATCTTCCTTTTTTTTATCCAGGG - Intergenic
1026129266 7:67606776-67606798 ATGTTCTTATTTCTGAACCTGGG + Intergenic
1026636331 7:72085074-72085096 ATGATCCTCTTTCTGACTTACGG + Intronic
1027440551 7:78214988-78215010 AGGTTCCTCTTGGTGATCCGTGG - Intronic
1027913588 7:84284787-84284809 ATGTTCCTTTTTTTGATTGATGG + Intronic
1027967893 7:85037363-85037385 ATATTCCTCTTTATCCTCCAGGG - Intronic
1030957196 7:115868745-115868767 ATTTTCCTCTATCTCATACATGG - Intergenic
1031487932 7:122352088-122352110 ATCTTGCTATTTCTGATCTACGG + Intronic
1032903548 7:136338248-136338270 TTCTTCCTCCTCCTGATCCAGGG + Intergenic
1034391841 7:150793314-150793336 ATGACCCTCTTTCTCTTCCAGGG - Exonic
1037771214 8:21801211-21801233 ATATTCCTGGGTCTGATCCAAGG - Intronic
1038353122 8:26799265-26799287 ATGTTACTCTTTCTCCTTCAGGG + Intronic
1040075993 8:43231338-43231360 ATTTACTTCTTGCTGATCCATGG + Intergenic
1043603568 8:81971516-81971538 TTGTTCCCATTTCTGATCCATGG + Intergenic
1043708297 8:83380402-83380424 ATGTTCCCATTCCTGATCCCTGG + Intergenic
1044002160 8:86896405-86896427 ATATTAATTTTTCTGATCCAGGG + Intronic
1044962515 8:97544651-97544673 ATGCTCTGCTCTCTGATCCATGG - Intergenic
1045017770 8:98013619-98013641 CTGTTTCTGTTTCTGATTCAGGG - Intronic
1045030423 8:98129988-98130010 ATGTTCTTTTTTCTGATGTACGG - Exonic
1045227948 8:100268894-100268916 ATTTTCTTCTTTCGGCTCCAGGG + Exonic
1045320463 8:101078215-101078237 ATGTTGCTTTATCTGAGCCACGG + Intergenic
1046551644 8:115725081-115725103 TTGTTCCTCTATATGATACATGG - Intronic
1047608712 8:126499856-126499878 ATGTTCATCTTTATAATGCAGGG + Intergenic
1047683439 8:127278343-127278365 ATGTTCCTTTTTTTGGTCCCTGG - Intergenic
1048086244 8:131183680-131183702 ATGTAAATCTTTCTGGTCCAGGG - Intergenic
1048249996 8:132857048-132857070 ATGTTCCTCTTTCTGTTCCAGGG - Intergenic
1052396673 9:27947368-27947390 TTTTTCCTCTCTCTGACCCAAGG - Intergenic
1052683111 9:31719944-31719966 ATGTTCTTCCTTTTGCTCCATGG + Intergenic
1053195555 9:36115560-36115582 ATATTCCTGTTTCTCATCCCTGG + Intronic
1055352736 9:75405979-75406001 ATCTTCCTCTTGCTGATCTTTGG - Intergenic
1057445605 9:95112384-95112406 ATGTTCCTCTGCCTGGCCCATGG + Intronic
1185755837 X:2652272-2652294 ATTTTCCTCTTGCTGGTCCAGGG + Intergenic
1191697327 X:64003528-64003550 ATGTTCCCCTTTCTGACCTATGG - Intergenic
1194034168 X:88850989-88851011 ATGTTTCTCTTTCTGTGCCTGGG - Intergenic
1196285630 X:113876436-113876458 AAGGTCCTCCTTCTGTTCCAGGG + Intergenic
1197730426 X:129805022-129805044 GTTTTCCTCTTTCTAAGCCAGGG - Exonic
1198189696 X:134289649-134289671 ATGTTTCTTCTTCTGATTCATGG + Intergenic
1202604886 Y:26630573-26630595 ATGTTCCTATTTCTTAGCCTTGG + Intergenic