ID: 954286025

View in Genome Browser
Species Human (GRCh38)
Location 3:49619905-49619927
Sequence CCACAGTGCCTGGCACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1391
Summary {0: 1, 1: 1, 2: 26, 3: 236, 4: 1127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954286025_954286034 13 Left 954286025 3:49619905-49619927 CCAGTTTGTGCCAGGCACTGTGG 0: 1
1: 1
2: 26
3: 236
4: 1127
Right 954286034 3:49619941-49619963 ACAGCTGTGAGGAAAGCACACGG 0: 1
1: 0
2: 1
3: 33
4: 341
954286025_954286031 2 Left 954286025 3:49619905-49619927 CCAGTTTGTGCCAGGCACTGTGG 0: 1
1: 1
2: 26
3: 236
4: 1127
Right 954286031 3:49619930-49619952 GGCCCTGGGACACAGCTGTGAGG 0: 1
1: 1
2: 7
3: 52
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954286025 Original CRISPR CCACAGTGCCTGGCACAAAC TGG (reversed) Intronic
900168856 1:1256536-1256558 CGACAGTGCCTGGGACAAGGTGG + Intronic
900594982 1:3476562-3476584 CCCTAGTCCCTGCCACAAACGGG + Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900757802 1:4449328-4449350 GCACAGTGCCTCGCACAAGGTGG - Intergenic
900807897 1:4779855-4779877 CCACCGTGCCTGGCCTAAAACGG - Intronic
901096900 1:6688901-6688923 GCACAGTGCCAGGCACATAATGG - Intronic
901471420 1:9459360-9459382 CCACTGTGCTTGGCCCAAAATGG - Intergenic
901634586 1:10664687-10664709 GCACAGTACCTGGCACAAGAGGG - Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
901694791 1:10998912-10998934 CCACCGTGCCTGGCACACTGGGG - Intergenic
901789853 1:11648417-11648439 GCACAGTGCTTGCCACAAAGTGG - Exonic
902025397 1:13379686-13379708 CCACAGTGCCTGGCCTCAAATGG - Intergenic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902275335 1:15335624-15335646 GCACAGTGGCTGGCACACAGGGG - Intronic
902342375 1:15792375-15792397 CCACCGTGCCTGGCCCAGGCTGG - Intergenic
902490918 1:16779818-16779840 GCACAGTGGCTGGCACAGAGTGG + Intronic
902603176 1:17553848-17553870 GCACAGTGCCTGGCACCCAGTGG - Intronic
902617293 1:17630765-17630787 CCTCAGTGCCTGGCACACCCTGG + Intronic
902796570 1:18804329-18804351 GCACAGGGCCTGGCACACATAGG - Intergenic
902815079 1:18911824-18911846 CCACTGCGCCTGGCCCAAAGGGG + Intronic
902916219 1:19641257-19641279 GCATAATGCCTGGCACAAAATGG + Intronic
902997524 1:20238416-20238438 CCACTGTGCCTGGCCCACCCTGG - Intergenic
903022547 1:20404290-20404312 AAACAGTGCCTGGCACATAGTGG - Intergenic
903175320 1:21576944-21576966 GCATAGTGCCTGGCACAAGTAGG + Intronic
903385571 1:22924138-22924160 CCCCAGTTCCTGGACCAAACTGG + Intergenic
903640502 1:24856723-24856745 CCACCGTGCCCGGCCCAAACTGG + Intergenic
903710168 1:25317447-25317469 CCCCAGTGCCTGGCTCATAGTGG - Intronic
903716948 1:25374959-25374981 CCCCAGTGCCTGGCTCATAGTGG + Intronic
903781267 1:25821336-25821358 GCACAGAGCCTGGCACACAGAGG + Intronic
903834409 1:26193607-26193629 GCACAGTGCCTGGCACGCACAGG + Intronic
903851577 1:26310086-26310108 CCACTGTGCCCGGCCCAAAAAGG + Intronic
904053802 1:27657072-27657094 CCACAGGCCCTGGCCCAAAATGG - Intergenic
904121086 1:28198277-28198299 CAACAGTGTCTGGCACAGAAGGG - Intergenic
904208159 1:28868439-28868461 CCAAAGTGCCTGGCACATAGTGG + Intergenic
904258045 1:29269457-29269479 TCACAGTGCCCAGCACAAAGTGG - Intronic
904272369 1:29358569-29358591 GCACAGAGCCTGGCACAGAGTGG - Intergenic
904330468 1:29755082-29755104 GCACAGTGCCTGGTACACAGTGG + Intergenic
904339879 1:29827879-29827901 GCACAGTGCCTGGTACACAGTGG + Intergenic
904415349 1:30358075-30358097 CGAAAGTGTCTGGTACAAACTGG + Intergenic
904441242 1:30533360-30533382 GCACAGTGCCTGGTGCATACAGG + Intergenic
904447580 1:30587437-30587459 GCACAGTGGCTGGCACACAGTGG - Intergenic
904699026 1:32347357-32347379 CCACAGTGCCTGGCCCATAGGGG + Intergenic
904707693 1:32403823-32403845 CAACAGTGCCTAGCACACAAAGG - Intergenic
904812229 1:33170907-33170929 GCACAGAGCCTGGCACACCCTGG + Intronic
904894075 1:33800918-33800940 GCACAGGGCCTGGCACAGAGAGG + Intronic
904940892 1:34164497-34164519 CCAGCGTGCCTGGCAGAATCAGG + Intronic
905092315 1:35439443-35439465 GCACAGGGCCTGGCACATAGTGG + Intronic
905541356 1:38763014-38763036 ACACAGGGCCTGGCATAAAGTGG + Intergenic
905595154 1:39200409-39200431 CCACTGTGCCTGGCCCAGGCTGG - Intronic
905696776 1:39980477-39980499 ACACAATGCCTAGCACAAAGTGG + Intergenic
905788269 1:40775221-40775243 GCACAGAGCCTGGCACCAAGGGG + Intergenic
906260546 1:44385370-44385392 CCACTGTGCCTGGCAAGAAGAGG - Intergenic
906554099 1:46693782-46693804 GCAAAGTGCCTGGTACATACTGG + Intronic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
906811594 1:48832536-48832558 GCTCAGAGCCTGGCACAAAGAGG + Intronic
907294427 1:53440377-53440399 GCACAGGGCCTAGCACAAAGTGG - Intergenic
907372363 1:54011677-54011699 CCCCAGTGCCTAGCACAGAGGGG - Intronic
907447379 1:54517329-54517351 ACACAGTGCTTGGCACAAAGTGG + Intergenic
907502082 1:54887936-54887958 CAACACTGCCTGGCACAGAGCGG - Intergenic
907882973 1:58568583-58568605 GCACAGTGCCTGGAGCATACTGG - Intergenic
908218259 1:61977375-61977397 CCACTGTGCCCAGCCCAAACTGG + Intronic
908391748 1:63689405-63689427 GCACAGTGCCTGGCCACAACAGG + Intergenic
908754179 1:67452889-67452911 ACACAGTGCCTGGCATATACTGG - Intergenic
908758688 1:67492323-67492345 CCACTGCGCCCGGCAGAAACTGG - Intergenic
909061746 1:70886762-70886784 GCACAGATCCTGGCACACACTGG + Intronic
909116283 1:71541250-71541272 GCACAGTGACTGGCATATACAGG + Intronic
909554884 1:76942513-76942535 ACACAGTGTCTGGCACATACAGG - Intronic
909613417 1:77577904-77577926 CCACCGTGCCCGGCCGAAACTGG + Intronic
909768492 1:79388791-79388813 GCACAGTGCCTAGAACAAATAGG - Intergenic
909853397 1:80498180-80498202 CCACTGTGCCTGGCCCAACACGG - Intergenic
910225461 1:84931736-84931758 CCACTGTGCCTGGCCCAGAGGGG - Intronic
910252885 1:85216660-85216682 CCACTGTGCCTGGCCCAGATTGG - Intergenic
910436193 1:87208564-87208586 ATACAGTGCCTGGCACACACCGG + Intergenic
910520112 1:88111225-88111247 CCACAATGCCAGACACAAAATGG + Intergenic
910551437 1:88480074-88480096 GCACTGTTCCTGGCACAAGCGGG + Intergenic
910779537 1:90913844-90913866 CCACTGCGCCTGGCCCAGACTGG + Intergenic
911282824 1:95952505-95952527 CCACTGTGCCTGGCCCATTCTGG + Intergenic
911616691 1:100020619-100020641 CCACAGTGCCTAGCATATATAGG - Intronic
911692631 1:100851663-100851685 TCACAATGCCTGGCACATAGTGG - Intergenic
912200139 1:107447971-107447993 GCACAATGTCTGGCACATACTGG - Intronic
912369496 1:109163009-109163031 GCTCAGTGACTGGCACAGACTGG - Intronic
912489969 1:110057348-110057370 CCACAGGGCCTGGCCCCAACAGG - Intronic
912558365 1:110532344-110532366 GCACAGTGCCAGGCACACAGGGG - Intergenic
912570409 1:110617189-110617211 CCCCAGTGCCTGGAGCACACTGG + Intronic
912696783 1:111848075-111848097 CCTCAGTGCCTAGGACACACAGG - Intronic
912713471 1:111965896-111965918 GCAGAGTGCCTGGCACACAGAGG - Intronic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
912956828 1:114159982-114160004 CCCATGTGCCTGGCACAGACTGG - Intergenic
913001464 1:114584660-114584682 CCACAGTGCATGGCACATGGTGG + Exonic
913086860 1:115446945-115446967 TCAGAGTGCCTGGCACAGGCAGG - Intergenic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
913963351 1:143355334-143355356 CCTCAGGGCCTGGCACAAGTGGG + Intergenic
914057707 1:144180920-144180942 CCTCAGGGCCTGGCACAAGTGGG + Intergenic
914121439 1:144785446-144785468 CCTCAGGGCCTGGCACAAGTGGG - Intergenic
914357281 1:146897943-146897965 CCACAGTGCCTGGCCACAATGGG - Intergenic
914898810 1:151700381-151700403 CTACAGTGTCTGGCACATAACGG - Intergenic
914914544 1:151811041-151811063 CCACAGTGCCTTGTACAAGCAGG + Intronic
915185419 1:154100883-154100905 CCACTGTGCCTGGCCCAAGATGG - Intronic
915287236 1:154860822-154860844 CCACAGAGCCAGCCACACACTGG - Intronic
915464721 1:156090111-156090133 GCACAGTGCCTGGCACAGAGAGG - Intronic
915625852 1:157113653-157113675 TCTCAGTGCCTGGCACATAATGG + Intergenic
916040556 1:160957609-160957631 GCACAATGCCTGGCACACAGTGG + Intergenic
916087855 1:161284231-161284253 CCACAGAGTCTGGCACAAGGTGG + Intronic
916100797 1:161391531-161391553 CCACTGTGCCTGGCCCGAAGTGG + Intergenic
916247461 1:162703623-162703645 ACACAGTGCCTTCCACAGACAGG - Intronic
916324655 1:163543285-163543307 ACACAGTGCCTGACACATACGGG - Intergenic
916561191 1:165935184-165935206 GCGCAGTCCCTGGCACAAATGGG + Intergenic
916577643 1:166081712-166081734 CCCCAGAGCCTGGCATAAGCAGG - Intronic
916628227 1:166582884-166582906 GAACAGTTCCTGCCACAAACTGG + Intergenic
916682457 1:167116969-167116991 CCACAGTGCCCAGTACAAAGTGG - Intronic
916715994 1:167447025-167447047 ACAAAGTGCCTGGCACACAGTGG + Intronic
916753957 1:167750487-167750509 CCACCGTGCCTGGCCCACCCAGG + Intronic
916894195 1:169144668-169144690 GAACAGTGAATGGCACAAACAGG + Intronic
917143299 1:171859580-171859602 AGACAGTGCCTGGCACACAGTGG - Intronic
917203786 1:172546619-172546641 CCACTGTGCCTGGCCTATACAGG - Intronic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
917977084 1:180246885-180246907 GCACGGTGCCTGGCACACAAGGG - Intronic
918118463 1:181517021-181517043 ACACAGTACCTGGCACACAGTGG - Intronic
918122806 1:181554617-181554639 GCTCAGTGCCTGGCACAGGCTGG - Intronic
918272117 1:182912152-182912174 CCACCGTGCCTGGCGGAATCTGG - Intronic
918557202 1:185817007-185817029 GAACAGTGCCTGGCACATAGTGG + Intronic
919102225 1:193108836-193108858 CTACAGTGCTTGGCACATAGTGG - Intergenic
919353396 1:196489275-196489297 CCCCAGAGCCTGGCACAAAGTGG - Intronic
919503050 1:198362246-198362268 GCACAGTGTCTGGCACTAATAGG - Intergenic
919777400 1:201203187-201203209 AAACAGTGCCTGGCACACAGTGG + Intronic
919824506 1:201493901-201493923 ACACAGCACCTGGCACAAAGTGG - Intronic
920067579 1:203279905-203279927 CCATGGTGCCTGGCACACATGGG + Intergenic
920179997 1:204126723-204126745 CAACAGTGCCTGGCACGTAGTGG - Exonic
920332858 1:205223680-205223702 CCACGGCGCCTGGCCCAAACTGG - Intergenic
920442774 1:205992412-205992434 ACACTGTGCCTGGCACATAGTGG + Intronic
920500822 1:206484276-206484298 CCACTGTGCCAGGCCTAAACTGG + Intronic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920914587 1:210249927-210249949 CCATCGTGCCTGGCCTAAACAGG - Intergenic
921034927 1:211367843-211367865 GGACAGTGCCTGGCACAGAGAGG - Intronic
921075874 1:211699612-211699634 GCACAGTGCCTGGCACATCAAGG - Intergenic
921183643 1:212651912-212651934 CAACAGTGCCTGCCACAATCAGG - Intergenic
921207394 1:212859947-212859969 GCACAGTTCCTGGCACATAAGGG + Intronic
921294688 1:213690816-213690838 GCACAGTGGCTTGCACAAAGTGG + Intergenic
921315336 1:213885125-213885147 GCTCAGTGCCTGGCACACAGTGG - Intergenic
921334602 1:214073765-214073787 CCACAATGACAGGCACCAACAGG + Intergenic
921527639 1:216237703-216237725 TCACAGAGCCTGGCACACAGCGG + Intronic
921971095 1:221150053-221150075 ACACAGTTCCTGGTACAAAGTGG - Intergenic
922296592 1:224255154-224255176 CCAATGTGCCTGGCCCAAAATGG + Intronic
922440276 1:225650561-225650583 CCACGGTGCCTGGCCGAAAGTGG - Intronic
922483010 1:225952146-225952168 CCACAGTGCCCGGCAGTATCAGG - Intergenic
922606056 1:226890642-226890664 GCACAGTGCCTGTCACAAAATGG - Intronic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
922739008 1:228005346-228005368 CCGCAGTGCCTGGGAGAAGCGGG + Intergenic
922788355 1:228294967-228294989 CCCCAGTGTCTGCCACAGACAGG - Exonic
923223944 1:231922099-231922121 CCAAAGTGCATGGCAGAATCAGG - Intronic
923529527 1:234802718-234802740 GCACAGTGGCTGGCACAGACTGG - Intergenic
924469081 1:244323931-244323953 CCACAGCACCTGGCCCATACTGG + Intergenic
924668729 1:246101398-246101420 GCAGAGTGTCTGGCACAAAATGG + Intronic
924691295 1:246353802-246353824 ATACAGTGCCTGGCACACAGTGG + Intronic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
924761049 1:246986353-246986375 CCACCGTGCCTGGCACCAAAAGG + Exonic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063980033 10:11445383-11445405 GCACAGTGCCTGGCATACAGGGG + Intergenic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065375872 10:25040655-25040677 CCACAGCGCCTGGCCCTAAATGG + Intronic
1066245286 10:33577335-33577357 TCACCGTGCCTGGCCCAAAGTGG - Intergenic
1066379840 10:34891913-34891935 CTACAGTGCCTGGCACATTGTGG - Intergenic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066395315 10:35014999-35015021 CCACTGTGCCTGGCCAAAATAGG - Intronic
1066442513 10:35451698-35451720 CCATAGTGCCTGGGCCACACGGG + Intronic
1066656002 10:37700662-37700684 CAACAGTGCCTGACTCACACTGG - Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067148904 10:43713448-43713470 CTCCAGTGCCTGGCACACAGAGG + Intergenic
1067410585 10:46060784-46060806 CCACAGTGCCTGGGCCAAAGTGG + Intergenic
1067721839 10:48733345-48733367 GCAAAGTGCCTGACACAAATTGG - Intronic
1067775950 10:49164995-49165017 GCACAGTGCCAGGGACAAAGTGG - Intronic
1068761466 10:60715317-60715339 ACAAAATGCCTGGCACAAAGAGG + Intronic
1068941269 10:62683541-62683563 GCACAGTGTCTGGCATAAAGTGG + Intergenic
1069479945 10:68772603-68772625 CCACTGTGCCTGGCTTAAAATGG - Intronic
1069908300 10:71745117-71745139 CTCCAGTGCCTGGCACATAGTGG - Intronic
1070275672 10:75004272-75004294 GCACAGTGCCTAGCACATAGAGG + Intronic
1070287815 10:75096287-75096309 CCACAGTGCCTGGCCTGAAAAGG - Intronic
1070507900 10:77131675-77131697 CCACCGTGCCTGGCAACAGCTGG - Intronic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1071792983 10:88975687-88975709 AAACAGTGCCTGGCACATATTGG + Intronic
1071852831 10:89592701-89592723 CCAGAGTCCCAGGCACAAAAAGG - Intronic
1071943567 10:90615208-90615230 CCACCATGCCTGGCACCAGCTGG - Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072415180 10:95241343-95241365 CCACTGTGCCTGGCAACAAGGGG + Intronic
1072449063 10:95524814-95524836 GCATAGTGCCTGGCACATAATGG + Intronic
1072650871 10:97294284-97294306 CCACAGTTTCTGGCACATAATGG + Intergenic
1072905498 10:99449511-99449533 GAACAGTGCCTGGCACATAGTGG + Intergenic
1073237158 10:102026944-102026966 CCACAGTACCTGGCATATAGGGG + Intronic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073493678 10:103872498-103872520 CCACACAGCCTGGCAGGAACAGG + Intergenic
1073543979 10:104333919-104333941 GCACCGTGCCTGGCGCAGACTGG - Intronic
1074052663 10:109894242-109894264 CCACTGTGCCTGGCTGAAAGGGG - Intronic
1074099524 10:110343403-110343425 CGACTGTCTCTGGCACAAACTGG - Intergenic
1074144006 10:110700726-110700748 CCACCGTGCCTGGCCCAAAGAGG - Intronic
1074256775 10:111810934-111810956 CCACAATGCCTGGCACTTAGTGG + Intergenic
1074338993 10:112607506-112607528 GCACAGTGCCTGGCCTAAAATGG + Intronic
1074373350 10:112918716-112918738 CGACACTGCCTGGCACAGAGGGG - Intergenic
1074480895 10:113819689-113819711 GAACAGTGCCTGGCACATAGTGG - Intergenic
1074873758 10:117597996-117598018 CCACTGTACCTGGCCCACACTGG + Intergenic
1074943042 10:118253793-118253815 CCCCAGTGCATGGCAGCAACGGG - Intergenic
1075049885 10:119175680-119175702 CCACAGTGCCTGGCTGAGATGGG + Intronic
1075652122 10:124134368-124134390 CCACAGGGCATGGCACATCCAGG + Intergenic
1075702570 10:124478760-124478782 CCACCGCGCCTGGCCCAAACTGG - Intronic
1075880872 10:125849635-125849657 CCGCAGTGCCTGACACCTACCGG - Intronic
1075933125 10:126316258-126316280 GCACAGGGCCTGGCACATAAAGG + Intronic
1075960762 10:126566316-126566338 GCACAGTGCCTGACACATAGGGG - Intronic
1076461159 10:130648594-130648616 CCAGATCGCCTGGCCCAAACAGG - Intergenic
1077537396 11:3131005-3131027 CCACACTGCCTGGGACATTCCGG - Intronic
1077704228 11:4468566-4468588 CCACAGTGTTTGGCACAGAAAGG - Intergenic
1078018680 11:7637392-7637414 CCACAGGGCCTAGCACACAGCGG - Intronic
1078066494 11:8082302-8082324 CCACAGTGCCTGGCAGCAGAGGG - Intronic
1078269974 11:9786146-9786168 CCACTGCGCCTGGCAGACACTGG + Intronic
1078362464 11:10679984-10680006 CCACTGTGCCTGGCCCAGAGTGG - Intronic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1078773650 11:14374369-14374391 GCTCAGTGCCTGGCACATAGAGG + Intergenic
1078851539 11:15168579-15168601 GCACACTGCATGGCACAAAAGGG - Intronic
1079005019 11:16785448-16785470 GCACAGGGCCTGGCACACAGTGG - Intronic
1079391967 11:20029637-20029659 GCACAGTGCCTGGCACACAGGGG + Intronic
1079639629 11:22788995-22789017 CCACAATTCCTGGCACATAGAGG - Intronic
1080127606 11:28755480-28755502 GCACAGTGCCTGGTACACAGAGG + Intergenic
1080173536 11:29335057-29335079 CCACAGAGACTGGCAGATACAGG + Intergenic
1080445031 11:32330916-32330938 GCACAATGCCTGGCACACAGTGG - Intergenic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1080565032 11:33500352-33500374 AAAAAGTGCCTGGCACATACGGG + Intergenic
1080932839 11:36830741-36830763 CCTAAGTGCCTGGAACATACTGG - Intergenic
1081330185 11:41792078-41792100 CCATAGTTCATGGCATAAACAGG + Intergenic
1081618438 11:44604235-44604257 GCACAGTGCCTGGCATGAAGTGG + Intronic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1081738352 11:45420928-45420950 CAACAGTGGCTGGCACAAAGAGG - Intergenic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1081866727 11:46364346-46364368 GCACAGTGCCTGACACATAGGGG + Intronic
1081890736 11:46540117-46540139 CCACCGTGCCCGGCAGTAACTGG + Intronic
1082026285 11:47574925-47574947 CCACTGTGCCTGGCCTAACCTGG - Intronic
1082275696 11:50219084-50219106 CCACTGTGCCTGGCCCACAGAGG - Intergenic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1083167978 11:60903207-60903229 GCACAGTGCCTGACACAACGAGG - Intronic
1083174230 11:60939277-60939299 CCCCAGTGCCTGTCACATAGGGG + Intronic
1083275188 11:61593026-61593048 CCACCGTGCCTGGCCCACAATGG + Intergenic
1083444344 11:62697498-62697520 CCACTGTGCCGGGCCCAAAGCGG - Intronic
1083636848 11:64125402-64125424 GCACAGTGCCTGGCACACAGGGG + Intronic
1083686912 11:64382032-64382054 CCACCGTGCCCGGCACCCACAGG + Intergenic
1083737459 11:64689854-64689876 CCCCAGTGCTTGGCACCCACTGG + Intronic
1083921813 11:65785422-65785444 CAGCTGTGCCTGGCACAAAGTGG - Intergenic
1083937291 11:65876565-65876587 CCACTGTGGCTGGCACAGAGTGG - Intergenic
1084025280 11:66444454-66444476 CCACTGTGCCTGGCCCAGATAGG - Intronic
1084053295 11:66615212-66615234 CCACCGGGCCTGGCCCATACTGG + Intergenic
1084097282 11:66920001-66920023 CCATGGTGCCTAGCACAAAACGG + Intronic
1084281398 11:68097345-68097367 CCACCGTGCCCGGCCCACACGGG - Intronic
1084299224 11:68235449-68235471 CCACCGTGCCTGGCCCACAGCGG - Intergenic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1084433083 11:69122347-69122369 ACCCAGTGCCTGGCACACAGCGG + Intergenic
1084925781 11:72510403-72510425 CCACAGTTACTGGCACATGCAGG - Intergenic
1085045457 11:73350276-73350298 GAACAGTGCCTGGCACATAGTGG - Intronic
1085063788 11:73473449-73473471 CCACAGTACCTGGCACCTGCTGG + Intronic
1085137190 11:74102318-74102340 ACACATTGCCTGGCACATACTGG - Intronic
1085215105 11:74822881-74822903 ACACAGTGCCTGGCATACAGTGG - Intronic
1085226011 11:74921825-74921847 GCACAGTGCTTGGCACACAGTGG + Intronic
1085300037 11:75452583-75452605 ACGCAGTGCCTGGCACACACAGG + Intronic
1085478107 11:76800350-76800372 GTACGGTGCCTGGCACAAAATGG + Intergenic
1085621470 11:78041057-78041079 CCAGAGTGCCTGGGTCAACCTGG - Intronic
1085831262 11:79903358-79903380 CCACAGTGCTTGGCCCACACTGG + Intergenic
1085835630 11:79953330-79953352 CCATAGTGCCTGACACATAGAGG + Intergenic
1085957204 11:81413927-81413949 TTACAGTGCCTGGCACAGAGAGG - Intergenic
1087084407 11:94202035-94202057 GCACAGTCCCTGGCACACAGTGG - Intergenic
1087703920 11:101467410-101467432 CAACAGGGCCTGGCACATAGTGG - Intronic
1087760709 11:102101771-102101793 CCACTGCGCCCGGCACAATCTGG - Intergenic
1088214122 11:107489290-107489312 GCACAATGCCTGGCACACAGTGG + Intergenic
1088288313 11:108209600-108209622 CCACCGTGCCTGGCCCAATGTGG - Intronic
1088533148 11:110832192-110832214 ACACAGTGCCCAGCACAGACAGG - Intergenic
1088646976 11:111925375-111925397 GCACAGAGCCTGGCACACAATGG + Intronic
1088684376 11:112272619-112272641 CCACAATGCCTGCCACATATTGG - Intergenic
1088705938 11:112464833-112464855 CCACAGTGAATGGGACAAAGGGG - Intergenic
1088851182 11:113704814-113704836 GCACAGAGCCTGGCACAAAGTGG + Intronic
1089274614 11:117326196-117326218 CCACTGTGCCTGGCTCAAGTAGG + Intronic
1089316211 11:117593051-117593073 GCACAGTTCCTGGCACTTACGGG + Intronic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1089590186 11:119535113-119535135 CCACCGCGCCTGGCCCAGACTGG + Intergenic
1089680366 11:120115877-120115899 CCACAGTGCTTGGCACAAGTGGG - Intronic
1089751357 11:120653713-120653735 CCTCAGTGCCTAGCACAGGCTGG - Exonic
1089812523 11:121143625-121143647 GCACAGTGCCTGGCACTCAGTGG + Intronic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090199528 11:124844357-124844379 CCACTGTGCCTGGCCCAGAGAGG + Intergenic
1090210659 11:124919273-124919295 GCAGAGTGCCTAGCACATACTGG - Exonic
1090470580 11:126977621-126977643 GCACAATGCCTGGCACATAGTGG + Intronic
1091054758 11:132407449-132407471 CGACAGTGCCTGGCACAGGGTGG - Intergenic
1091067609 11:132530783-132530805 ACACAGTACATGGCACACACTGG + Intronic
1091655410 12:2342522-2342544 GCACAGTGCCTGGCACACTGAGG + Intronic
1091717964 12:2793604-2793626 GCACAGTGCCGGGCACATAACGG + Intergenic
1091743628 12:2977064-2977086 GCACAGAGCCTGGCCCAAAAAGG - Intronic
1092265319 12:6976435-6976457 CCACCGTGCCCGGCCCAAAGGGG - Exonic
1092393279 12:8100696-8100718 CCATTGTGCCTGGCCCAAAGAGG + Intergenic
1092735820 12:11581511-11581533 CCACAGTGCCTGACACATGCTGG + Intergenic
1093394745 12:18667648-18667670 GCACAATGCCTTGTACAAACTGG - Intergenic
1093405114 12:18795487-18795509 CCACAGTGGAGGGCACAAATGGG + Intergenic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1093895470 12:24570184-24570206 GCACAGTCCCTGGCACAACTAGG - Intergenic
1094365375 12:29674311-29674333 CCACAGTGCCCAGCACATAAAGG + Intronic
1094601604 12:31913710-31913732 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1094711921 12:32973064-32973086 GCACAGTGTCTAGCACAAAGTGG - Intergenic
1095598967 12:43993329-43993351 GCACAGTGCCTGGCACATAATGG + Intronic
1095941568 12:47730661-47730683 TCACAGTGTCTGGCACACAGTGG - Intergenic
1095959985 12:47828418-47828440 CTACAGTGCCTGGCACACATTGG + Intronic
1096168827 12:49449499-49449521 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1096412098 12:51384402-51384424 CCACTGTGCCTGGTCCTAACTGG - Intronic
1096486960 12:51989570-51989592 CCACTGTGCCTGGCCTAAATTGG + Intronic
1096738995 12:53677783-53677805 CCACAGTGCCTGGCACCACTTGG - Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1097202511 12:57291364-57291386 CCACTGTGCCTGGCAAAAGATGG - Intronic
1097400479 12:59122479-59122501 GCACAGTGCCTTGCACATAATGG + Intergenic
1097585478 12:61510658-61510680 ACACAGTGCTTGGCACATATGGG + Intergenic
1097689097 12:62717124-62717146 CCACTGTGCTTGGCCTAAACTGG + Intronic
1097709941 12:62907250-62907272 CTGCAGTGCCTGGCACATGCTGG - Intronic
1098231585 12:68376518-68376540 ACACATTGCCTGGCAGAAGCAGG + Intergenic
1098286708 12:68914371-68914393 GCACAGTGCATGGCACATAAAGG + Intronic
1098391586 12:69975312-69975334 CCACAGGGCCTGGCAAATTCTGG - Intergenic
1099296867 12:80838908-80838930 GCAAAGTGCCTGGTGCAAACTGG + Intronic
1099334068 12:81330883-81330905 ACACAGTGCCTGGCTCATAAAGG + Intronic
1099733683 12:86538892-86538914 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1099856673 12:88177036-88177058 CTACTGTGTCTGGCCCAAACTGG - Intronic
1100289195 12:93197997-93198019 GCAAGGTGCCTGGCACAAACTGG - Intergenic
1100406764 12:94278708-94278730 CCACTGTGCCCGGCCCAAAGAGG - Intronic
1100438565 12:94594378-94594400 CCACCGTGTCTGGCAGAACCAGG + Intronic
1100573317 12:95863560-95863582 TCACAGTGCCAGGCACATAATGG - Intronic
1100658736 12:96674795-96674817 GCACTGTGCCTGGCACCAAAGGG - Intronic
1100700342 12:97140539-97140561 CCACAGTGCCTGGTCAAAAGAGG - Intergenic
1100858971 12:98784469-98784491 CCACAGTGGCTGGCTCACACAGG + Intronic
1101001205 12:100359784-100359806 GCCCAGAGCCTGGCACATACTGG + Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101334670 12:103785849-103785871 CCAGAGGGCCTGGCACACACAGG - Intronic
1101598611 12:106189199-106189221 AGACAGTGCCTGGCACAGCCCGG - Intergenic
1101711766 12:107274159-107274181 CCACAGTGCCAAGCACAAAGAGG + Intergenic
1101740604 12:107497081-107497103 GAACAGTGCCTGGCACATAGTGG + Intronic
1101857789 12:108458281-108458303 CAACAGTGCCTGGCCCAGAGTGG + Intergenic
1101877213 12:108603717-108603739 GCACAGTTCCTGGCACACACAGG - Intergenic
1101981092 12:109407372-109407394 GCACAGTGCCTGGCACACATGGG + Intronic
1101993112 12:109503955-109503977 CCTCAGTGCCTGGCACACAGGGG - Intronic
1102055129 12:109890864-109890886 CCACATTGCCTGGCAAAGCCTGG - Intergenic
1102091407 12:110191881-110191903 CCACCGTGCCTGGCCTGAACAGG - Intronic
1102221426 12:111197455-111197477 GAACAGTGCCTGGCACAGAGGGG + Intronic
1102289042 12:111684211-111684233 CCACAGTGCCGAGCACACAGAGG + Intronic
1102353868 12:112215918-112215940 CCACTGTGCCTGGCCCAATAAGG + Intronic
1102797060 12:115697931-115697953 CCACAACTCCTGGCACAAAGTGG + Intergenic
1103139888 12:118539404-118539426 GCACAGTGCCTGGCACGTGCTGG + Intergenic
1103450327 12:121024327-121024349 CCACTGTGCCTGGCCCAGATAGG - Intronic
1103469476 12:121168554-121168576 CCACTGTGCCTGGCCCAAGGAGG + Intronic
1103518414 12:121522142-121522164 CCACTGTGCCTGGCACAAGGTGG - Intronic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1104553640 12:129780218-129780240 CCACAGTGCCCAGCACACAGCGG - Intronic
1104788619 12:131467993-131468015 CCACTGTGCCTGGCCCAGGCAGG + Intergenic
1104867413 12:131966192-131966214 CCACAGTGCCTGGCCCAGGTTGG - Intronic
1104939961 12:132390420-132390442 CCACGCTCCCTGGCACAAAAGGG + Intergenic
1104945667 12:132413948-132413970 CCTCAGCGCCCGGCACAGACAGG - Intergenic
1105283409 13:18983521-18983543 GCACAGTGCCTGACACAGAGTGG - Intergenic
1106229026 13:27807591-27807613 CCCCAGGGCCTGGCACACAGTGG + Intergenic
1106259082 13:28049041-28049063 ACACAGAGCCTGACACAAAATGG - Intronic
1106302476 13:28481599-28481621 GTACAGTGCCTGGCACATAATGG - Intronic
1106548916 13:30754744-30754766 GCATAGTGCCTGGCACATAGGGG - Intronic
1106647114 13:31648023-31648045 TCACAGTGCCTGGAACATAGTGG + Intergenic
1106798752 13:33234018-33234040 CCACAGTGCCTGGGACAGTGAGG - Intronic
1107054028 13:36083741-36083763 CCACAGTGGATGTCACAAAGTGG - Intronic
1107114138 13:36728205-36728227 ACACAGTGCCTGGTACAGAGTGG + Intergenic
1107169444 13:37322584-37322606 CCACAGAGACTGGCACAGAGGGG - Intergenic
1107445743 13:40469148-40469170 GCACAGTGCCTGCCACATATAGG - Intergenic
1107831989 13:44382778-44382800 GCACAGTGCCAGGCACAGAGGGG - Intronic
1107928986 13:45290857-45290879 CCCCTGTGCCTGGCACACAGTGG - Intergenic
1107959450 13:45545203-45545225 CCTTAGTTCCTGGCACACACAGG + Intronic
1108293699 13:48990035-48990057 CCACCGTGCCTGGCCCATAAAGG + Intronic
1108364559 13:49696920-49696942 CCACAGCGCCTGGCCTAAATTGG - Intergenic
1108681866 13:52787471-52787493 GCACAGAGCCTGGCACACAGTGG + Intergenic
1109190028 13:59313059-59313081 CCTCAGTGCCTTGGACAAGCTGG - Intergenic
1110559359 13:76893990-76894012 CCACAATGTCTGGCACATAACGG + Intergenic
1110702292 13:78562801-78562823 ACACAGTGCCTGGCACATGGTGG + Intergenic
1111762542 13:92483838-92483860 CCACAGTGCCTGGCAAGACTAGG - Intronic
1111836745 13:93397632-93397654 GCACAGTACCTGGCACATAAAGG - Intronic
1111968634 13:94886895-94886917 GCACATTGCCTGGCACATAGGGG + Intergenic
1112124486 13:96449247-96449269 CCACTGTGCCTGGCATAATCTGG + Intronic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1112497164 13:99914481-99914503 CCACTGTGCCCGGCCAAAACTGG - Intergenic
1112657659 13:101469392-101469414 CCACAGCGCCTGGCAACAACTGG - Intronic
1113385352 13:109843070-109843092 CCACAGGGCCTGCCACAATGTGG + Intergenic
1113662126 13:112114818-112114840 CCTCTGTGCCTGGAACAAGCTGG + Intergenic
1113922327 13:113920069-113920091 ACTCAGGGCCTGGCACACACAGG - Intergenic
1114234295 14:20811327-20811349 CCACCGTGCCTGGCCCTGACTGG - Intergenic
1115607652 14:35020743-35020765 GGACAGTGCCTGGCACAGAATGG - Intronic
1115658058 14:35462872-35462894 CCACTGTGCCTGGCTCTAATGGG + Intergenic
1115750180 14:36481619-36481641 GCACAATGCCTGGCACACAGTGG + Intronic
1116876295 14:50115436-50115458 CCACCGCGCCCGGCCCAAACTGG + Intronic
1117272463 14:54158882-54158904 CCACAGTGACTGGCATAGAGAGG - Intergenic
1117319896 14:54611587-54611609 CCACTGCGCCTGGCCCCAACTGG - Intronic
1117528479 14:56635727-56635749 ACACAGTCCCTGGCTCAGACTGG - Intronic
1117789807 14:59328515-59328537 GCACAGTGCCTGACACATACAGG - Intronic
1117968092 14:61226202-61226224 ACACAGTGCCTGGCTCAGAGTGG - Intronic
1118166834 14:63344952-63344974 CGCCAGTGCCTGGCACATAGCGG + Intergenic
1118600200 14:67466703-67466725 CCACTGTGCCTGGCCCAGGCTGG - Intronic
1118633782 14:67729177-67729199 CCCCGGTGCCTGGGACAAAGAGG - Exonic
1118799723 14:69178560-69178582 CCAAAGAGTCTGGTACAAACCGG + Intergenic
1118901845 14:69992837-69992859 ACACAGTGCCAGGCACAGAGTGG - Intronic
1118988086 14:70774166-70774188 GCACAGTGCCTGATACATACAGG - Intronic
1118994908 14:70826930-70826952 CCACCGTGCCTGGCCCAATTTGG - Intergenic
1119112609 14:71989111-71989133 GCCCAATGCCTGGCACAAAGTGG - Intronic
1119634116 14:76260299-76260321 ACACAGTGCATGGCACAGAGTGG - Intergenic
1119643982 14:76335322-76335344 ACACAGTGCCTGGTATATACTGG - Intronic
1119672295 14:76528939-76528961 CCACTGTGCCCGGCCGAAACAGG + Intergenic
1119892756 14:78195206-78195228 GCACAGTGCCTGGTTCATACTGG - Intergenic
1120014557 14:79456309-79456331 TCACAGTGCCTGGAACACATAGG - Intronic
1120104490 14:80479016-80479038 CCTCAGAACCTGGCACACACAGG - Intronic
1120176294 14:81297058-81297080 CCAAAGTGCCTGACACACTCCGG - Intronic
1120179676 14:81330338-81330360 GCTCAGTGCCTGGCACACAAAGG - Intronic
1120644062 14:87050947-87050969 ACACAGTCCCTGGCACAAGGTGG + Intergenic
1120668063 14:87330858-87330880 ACACAGTGTCTGGCAAAAAAGGG + Intergenic
1120927264 14:89810168-89810190 GCACAGTGTCTGGCACACAGTGG + Intronic
1121033764 14:90682348-90682370 CCACCTTGCCTGCCACAAATAGG - Intronic
1121138385 14:91519259-91519281 CCACTGTGCCTGGCCTAAAATGG + Intergenic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121263027 14:92580428-92580450 GAACAGTGCCTGGCACAGAGTGG - Intronic
1121346222 14:93137746-93137768 CAACAGTGCCTGGCAATGACTGG - Intergenic
1121382556 14:93486367-93486389 CCACTGTGCCTGGCCCCAAGAGG - Intronic
1121456557 14:94042419-94042441 CCCCAGTGCCTGGCACAGAGGGG + Intronic
1121843875 14:97156320-97156342 GAACAGTGCCTGGCACAGAGCGG - Intergenic
1122007288 14:98716036-98716058 CCACAGTGCCTGCAACAGGCTGG + Intronic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122301687 14:100734689-100734711 CCACAGTGCCCAGCACCACCAGG - Exonic
1122493561 14:102136279-102136301 CCACCGCGCCCGGCCCAAACCGG - Intronic
1122493616 14:102136598-102136620 CCACCGCGCCCGGCCCAAACCGG - Intronic
1122565749 14:102654351-102654373 CCCAAGTGCCTGGCTCAAAATGG - Intronic
1122652387 14:103232692-103232714 CCACTGGGCCTGGCACAGGCAGG - Intergenic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1123415732 15:20093759-20093781 CCACAGGGACTGGCACATAATGG + Intergenic
1123525071 15:21100873-21100895 CCACAGGGACTGGCACATAATGG + Intergenic
1124427333 15:29572699-29572721 CTTCAGTGCCTGGCACATAGTGG - Intergenic
1124794141 15:32760447-32760469 CCACCGTGCCTGGCCCATCCTGG + Intergenic
1124915156 15:33963207-33963229 GCACAGTGCCTGGCACAGAGAGG - Intronic
1125350454 15:38761717-38761739 GCACAGTGCCTGACACATAGTGG - Intergenic
1125731304 15:41894087-41894109 CCACAGGGCGTGGCCCAGACAGG + Intergenic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126347727 15:47714879-47714901 CCACAGTGCCTGGCATTTAATGG - Intronic
1126387938 15:48113019-48113041 ACACAGTGCCAGGCACATGCTGG - Intergenic
1126609188 15:50511707-50511729 CCACAGTGCCTGGCCTATTCTGG - Exonic
1126693653 15:51307971-51307993 GCACAGTGCCTGGCACAGTCAGG + Intronic
1126782619 15:52151352-52151374 ACACAGTGGGTGGCACACACAGG - Intronic
1127072190 15:55297913-55297935 CCACTGTGCCTGGCCACAACTGG - Intronic
1127716149 15:61651125-61651147 GCACAGTGCCTGGCACCAACAGG + Intergenic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1127911988 15:63424154-63424176 CCACTGTGCCTGGCCTAAAGTGG + Intergenic
1127918323 15:63473525-63473547 TCAGAGTGCCTGGCACAAAGTGG - Intergenic
1127974185 15:63985084-63985106 GCACAGATCCTGGCACAGACTGG - Intronic
1128159251 15:65412539-65412561 GCACAGTGCCTGACACAGAATGG + Intronic
1128216793 15:65940007-65940029 GCACAGTGTCTGACACATACTGG - Intronic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128657148 15:69470632-69470654 CCACTGTGCCCGGCCCAGACTGG + Intergenic
1129106317 15:73309782-73309804 CCTCAGTGCCTGGCATATAGTGG - Intergenic
1129120301 15:73392354-73392376 CCACTGTGCCCGGCCCACACTGG - Intergenic
1129238379 15:74237252-74237274 GAACAGTGCCTGGCACATAGTGG + Intronic
1129570342 15:76676110-76676132 CCACTGTGCCCGGCTGAAACTGG + Intronic
1129583802 15:76841357-76841379 CCACTGTGCCTGGCCCTGACTGG - Intronic
1129677029 15:77637210-77637232 CCACAGTGGCTGGCCCAAGTTGG + Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129991887 15:79972505-79972527 CCACCGTGCCTGGCCCAAAGAGG - Intergenic
1130136865 15:81188809-81188831 GCATAGTACCTGACACAAACTGG - Intronic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1130673543 15:85933178-85933200 GCACAGCGCCTGGCACAAAGTGG + Intergenic
1130726032 15:86440531-86440553 GCACATTGCCTGGAATAAACTGG - Intronic
1130875858 15:88013712-88013734 CCACAGTGCCTGGCCAAGTCAGG - Intronic
1130915667 15:88302666-88302688 GCACGGTGCCTGGCAAAAGCAGG + Intergenic
1131036485 15:89225895-89225917 CCACTGTGCTGGGCACAGACAGG - Intergenic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131373856 15:91907491-91907513 CCACTGTGCCTGGCCCAAGGAGG + Intronic
1131619980 15:94057905-94057927 CCACAGTGCGTGGGACACACTGG + Intergenic
1131676490 15:94675358-94675380 GCACAGTGCCTGGTACCCACAGG - Intergenic
1131951914 15:97690364-97690386 CCACAGTACCTAGCACACAGTGG + Intergenic
1132177400 15:99726429-99726451 CCACTGTGCCTGGCCCCAAGTGG + Intronic
1132323102 15:100941833-100941855 CCAGGCTGCCTGGCACAAGCTGG + Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132533317 16:464606-464628 CCACTGTGCCTGGCCCATAATGG - Intronic
1132573279 16:653327-653349 CCACAGGGCCTGGCACAAGGGGG - Exonic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1133064392 16:3195781-3195803 CCCCAGTGCCTGGCACACAGAGG + Intergenic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133193176 16:4149689-4149711 CCACCGTGCTTGGCCCAAAGCGG - Intergenic
1133293200 16:4736301-4736323 ACACAGTGCCTGGCACTAACAGG + Intronic
1133513086 16:6479760-6479782 CCACCGTGCCTGGCCTAGACTGG - Intronic
1133603509 16:7363543-7363565 GCAAAGTGCCTGGCATAAAATGG + Intronic
1133807029 16:9133507-9133529 CCACTGTGCCTGGCCAAAAGAGG + Intergenic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134241602 16:12510867-12510889 CCACGGTGCTTGGCACAGGCTGG - Intronic
1134406387 16:13962777-13962799 CCACTGTGCCTGGCCTAAAATGG - Intergenic
1134415941 16:14043444-14043466 CCACAGTGCATGCCAGACACAGG - Intergenic
1134537171 16:15035324-15035346 CCACTGAGCCTGCCACAGACTGG - Intronic
1134551306 16:15139970-15139992 CCAGAGTGGCTGGCACTAACAGG - Intergenic
1134586486 16:15416046-15416068 GGACAGTGCCTGGCACATAGTGG + Intronic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134617827 16:15665217-15665239 TCACACTGCCTGGCACATATAGG - Intronic
1134780921 16:16894977-16894999 GCACAGTGCCTGGCACAGCAAGG + Intergenic
1134796220 16:17039461-17039483 CAACAGTGCCTGGCACAGAGAGG + Intergenic
1135234810 16:20745296-20745318 CCACCGTGCCTGGCCCCAAGTGG - Intronic
1135246489 16:20861502-20861524 TCACAGTGCCTGGCACATGCTGG + Intronic
1135406308 16:22200570-22200592 CCACTGTGCCCAGCCCAAACTGG - Intergenic
1135520120 16:23170108-23170130 GAACAGTGCCTGGCACACAATGG - Intergenic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1135877129 16:26213078-26213100 GCACAGGGCCTGGCACTTACAGG - Intergenic
1136020270 16:27435739-27435761 CCACCATGCCAGGCCCAAACAGG + Intronic
1137411253 16:48230210-48230232 GCACAGTGCCTGGCACATGTAGG + Intronic
1137463326 16:48685811-48685833 CCACTGCGCCTGGCCCAAATAGG - Intergenic
1137519722 16:49181918-49181940 TCCCAGTGCCTGGCACTAAGGGG - Intergenic
1137640328 16:50023433-50023455 CCACTGTGCCTGGCCTAAAGAGG + Intergenic
1137730379 16:50685273-50685295 GCACAGTGCCTGCCACATAGTGG + Intergenic
1137932678 16:52603677-52603699 TCACTGTGCCTGGCCCAAAATGG + Intergenic
1138070868 16:53991914-53991936 CTACAGTTCCTGGCAGCAACTGG - Intronic
1138084024 16:54117265-54117287 CCACAGTACCTGACATATACTGG + Exonic
1138265151 16:55655307-55655329 GAACAGTGCCTGGCACACAGCGG + Intergenic
1138489732 16:57369736-57369758 CCACATTGCCTGGCACACACCGG + Intergenic
1139367125 16:66440416-66440438 CCACAGTGCCTGGCCCCTGCTGG + Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1139740493 16:69031298-69031320 TCACAGTGCTTGGCACATAGTGG + Intronic
1140217761 16:73022207-73022229 CAACAGTGTCTGGCACACATGGG + Intronic
1140516981 16:75550331-75550353 CCACTGTGGATGCCACAAACAGG - Intronic
1141361538 16:83399818-83399840 GCACAGTGCCTCACACAAGCAGG + Intronic
1141686077 16:85570749-85570771 CTCCAGGGCCTGGCACCAACAGG - Intergenic
1142437531 16:90071414-90071436 CCACTGTGCCTGGCCCAGAGTGG + Intronic
1142897713 17:2992681-2992703 GCCCAGTGCCTGGCACACAGCGG + Intronic
1143019463 17:3909353-3909375 GCACAGTGCCTGGCACTCAGTGG + Intronic
1143094363 17:4469372-4469394 CCACTGTGCCTGGCCTCAACTGG + Intronic
1143274383 17:5699471-5699493 GCACAGTGCCTGGCACTGATAGG + Intergenic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1144337972 17:14288562-14288584 CCACAGTGCCTGGCTGAACATGG + Intergenic
1144803030 17:17944198-17944220 TCATGGTGCCTGGCACAAAGTGG + Intronic
1145779278 17:27551713-27551735 CCACAGGGCCTTGCCCACACAGG - Intronic
1145824071 17:27863368-27863390 CCTCAGTGCCTGGCCCAGACTGG + Intronic
1145889975 17:28407473-28407495 GCACAGTGCCTGGCACGTAAGGG - Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1146061584 17:29610466-29610488 CCTCAATGCCTGGCACATAAAGG + Intronic
1146184960 17:30718767-30718789 GCACAGTGCCTGGCACAAGCAGG - Intergenic
1146265854 17:31452236-31452258 GCACAGTGCCTGGCATAGAGAGG + Intronic
1146412402 17:32598084-32598106 CCACTGTGCCTGGCCCTAACAGG - Intronic
1146455182 17:33004239-33004261 GCATAGTGCCTGGCACAGAGTGG + Intergenic
1146568465 17:33933385-33933407 CCGCAGTGCCTGGCACATACTGG + Intronic
1146725196 17:35150459-35150481 CCACTGTGCCTGGCCCCATCTGG - Intronic
1146787949 17:35734715-35734737 CCACAGAGCCTGGGACAAGACGG - Intronic
1147243282 17:39104851-39104873 CAACAGTGCCTGGAACATAGTGG + Intronic
1147320088 17:39640726-39640748 TCACAGGGCCTGGCACAAGGGGG + Intronic
1147487961 17:40836568-40836590 CCACTGTGCCTGGCTAAAATGGG + Intergenic
1147497200 17:40928041-40928063 GCACAATGCCTGGCACCATCGGG + Intronic
1147538718 17:41338134-41338156 CCACAGTCCCAGGCACAAAGTGG - Intergenic
1147854381 17:43467802-43467824 CCACAGCACCTCGCACATACTGG + Intergenic
1147930356 17:43976890-43976912 CACCAGTGCCTGGCACAGAAGGG + Intronic
1147988069 17:44317917-44317939 GCACGGTGCCTGGCACAGGCAGG + Intronic
1148340643 17:46871566-46871588 CCACAGTGCCTGGGACAAGCAGG - Intronic
1148492126 17:48029996-48030018 CCACTGTGCCTGGCCTAAAAGGG - Intronic
1148506300 17:48130157-48130179 CCTCACTGCCTGCCACTAACTGG - Intergenic
1148639712 17:49177706-49177728 CCACTGTGCCCGGCAGAATCTGG - Intergenic
1148678661 17:49460079-49460101 GCACAGTGCCTGGCCCACAGAGG + Intronic
1148682477 17:49482714-49482736 CCTCAGTGCCAGGCACAGGCTGG + Intergenic
1148751624 17:49948703-49948725 CCTCAGTGCCTGGCACAGGCTGG + Intergenic
1148865330 17:50625394-50625416 CGCCAGTGCCTGGCACACAGAGG - Intronic
1148987681 17:51637852-51637874 ACACTGTGCCTAGCACAAAGAGG - Intronic
1148995452 17:51705474-51705496 AAACAGTGCTTGGCACATACAGG + Intronic
1149265993 17:54928264-54928286 CCACAGTGTCTGGCATACAGAGG - Intronic
1149266731 17:54935003-54935025 CCACAGTGCCTGGCTGAACTAGG + Intronic
1149463563 17:56854998-56855020 CGACAGTGCCTGGCACCAGATGG - Intronic
1149537805 17:57445947-57445969 GAACAGTGCCTGGCAGAGACAGG - Intronic
1149981162 17:61312482-61312504 CCACTGTGGCTGGCACAAACAGG + Intronic
1150412556 17:64958237-64958259 ACACAGTGTCTGTCAAAAACAGG + Intergenic
1150526594 17:65929710-65929732 TCACAGTGCCTGGCACATACAGG + Intronic
1150774622 17:68069484-68069506 CCACCGTGCCTGGCTCAACCTGG + Intergenic
1150926181 17:69534495-69534517 CAGCATTGCCTGGAACAAACTGG + Intronic
1151026219 17:70679990-70680012 CAACAGGGCCTGGCATAAAATGG - Intergenic
1151177426 17:72300330-72300352 CCACTCTGCCTGGCCCAAAATGG - Intergenic
1151209468 17:72533575-72533597 CCACTGTGCCTGGCCCAAAATGG - Intergenic
1151693045 17:75698903-75698925 CCACTGTGCCTGGCCCACAATGG - Intronic
1151713387 17:75819202-75819224 CCACAGGACCTGGCACAAAGCGG - Intronic
1151788985 17:76291923-76291945 CCACATGGCCTGGTACAACCTGG - Exonic
1151889881 17:76945791-76945813 GCACAGTGCCTGGCATACAGTGG - Intronic
1151907706 17:77059735-77059757 CCACCGTGCCTGGCCCAAGAGGG + Intergenic
1152019160 17:77771524-77771546 GCACAGAGCCTGGCACATGCCGG + Intergenic
1152257343 17:79247939-79247961 GCACAGTGCCTGGCCCACAATGG + Intronic
1152257353 17:79247983-79248005 GCACAGTGCCTGGCCCACAATGG + Intronic
1152348278 17:79768257-79768279 GCACAGGGCCTGGCACACAGTGG + Intergenic
1152774968 17:82195356-82195378 CAGCAGTTCCTGGAACAAACAGG + Exonic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153208387 18:2730455-2730477 CCACCGTGCCTGGCCCACAAAGG + Intronic
1153340383 18:3967250-3967272 CCACAGTGCCTGGCAGTGCCTGG - Intronic
1153807494 18:8721880-8721902 GAACAGTGCCTGGCACATGCTGG + Intronic
1154078860 18:11234628-11234650 CCACTGGGCCTGGCACTACCTGG - Intergenic
1155436763 18:25820631-25820653 TCACAGTGCCTGGCATGAAGAGG - Intergenic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156332710 18:36139524-36139546 CCACAGAGCCTTGCACAGAATGG - Exonic
1156448127 18:37251838-37251860 GCCCAGTGCCTGGCACAAGAAGG + Intronic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1156744839 18:40377333-40377355 CCACAGTGCCTCCCTCAAACTGG + Intergenic
1156746459 18:40397645-40397667 CCATTGTGCCTGGCACATTCTGG - Intergenic
1157069380 18:44388027-44388049 CCACAGTTCCTGGCACAACTAGG + Intergenic
1157135658 18:45052092-45052114 GTACAGTGCCTGGCACAAACTGG + Intronic
1157221968 18:45834710-45834732 CCCCAGTGCCTGGCATAAAGTGG + Intronic
1157232814 18:45935142-45935164 GAACAGTCCCTGGCACAGACTGG - Intronic
1157526848 18:48389812-48389834 GTACAGTGCCTGGCACGAAGAGG + Intronic
1157750352 18:50172974-50172996 CCACTGCGCCTGGCCCACACTGG - Intronic
1157873575 18:51251688-51251710 CTACAGTGCCTGGCCCCATCTGG + Intergenic
1157916240 18:51666647-51666669 CAACAGTGCCTCGCACAAGCAGG - Intergenic
1158028999 18:52939591-52939613 GCAAAGTGCCTGGCACATAATGG - Intronic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1158132170 18:54164171-54164193 CCACTGTGTCTGGCAGAAAGAGG + Intronic
1158254817 18:55533897-55533919 CCTCAGTGCCTGGCACAGGGTGG - Intronic
1158334989 18:56406488-56406510 CCACAGTGTCTTGCACATAGTGG - Intergenic
1159334136 18:67041953-67041975 GCACAGTGCCTGCCTCAAATTGG - Intergenic
1160114608 18:76065531-76065553 GCACAGTGCCTGGCACAGGGTGG + Intergenic
1160769858 19:825747-825769 CCACAGGCCCAGACACAAACTGG + Intronic
1161271057 19:3389542-3389564 CCACACTGCCTGGAGCACACAGG - Intronic
1161286332 19:3470233-3470255 CCCCTGTGCCTGGCACAGAGTGG - Intergenic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161631797 19:5360668-5360690 ACACAGGGTCTGGCACACACAGG - Intergenic
1161881172 19:6954045-6954067 AAACAGTGCCTGGCACATAGCGG + Intergenic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162306895 19:9880304-9880326 GAACAGTGCCTGGCACATAGTGG - Intronic
1162326119 19:10000717-10000739 GCACAGTGCCTGACACAAGCAGG + Intronic
1162347053 19:10125125-10125147 CCACTGTGCCCAGCAGAAACAGG - Intergenic
1162603546 19:11689299-11689321 CCACCGCGCCTGGCCCAGACTGG - Intergenic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162706141 19:12555979-12556001 CCACCGTGCCTGGCCTACACAGG - Intronic
1162852218 19:13439696-13439718 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1162873250 19:13601499-13601521 GCACAGGGCCAGGCACAAATTGG - Intronic
1162973815 19:14196922-14196944 GCACAGCGCCTGGCACAAGCAGG + Intronic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163332463 19:16649288-16649310 CCACTGCGCCTGGCTGAAACAGG - Intronic
1163735803 19:18979835-18979857 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1164225668 19:23243633-23243655 CCACCGCGCCCGGCCCAAACAGG - Intronic
1164616055 19:29667382-29667404 GCACAGTGTCTGGCACACAGTGG + Intronic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1165133286 19:33646788-33646810 CCCAAGTACCTGGGACAAACAGG - Intronic
1165507465 19:36243319-36243341 CCACTGTGCCAGGCCCAAACTGG + Intronic
1166057564 19:40301870-40301892 CCACTGTGCCTGGCCCAGATTGG - Intergenic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166658329 19:44628330-44628352 CCTCAGTGCCTGGCACAGAGCGG - Intronic
1166946229 19:46398269-46398291 CCACTGTGCCTGGCTGACACTGG - Intergenic
1166985215 19:46655745-46655767 GAACAGTGCCTGGCACAAAGTGG + Intronic
1167094395 19:47366566-47366588 CCACTGTGCCTGGCTGACACTGG + Intronic
1167124390 19:47539213-47539235 GCACAGGGCCTGGCACAGAGGGG + Intronic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167531546 19:50020797-50020819 CCCTAGTGGCTGGCATAAACAGG - Intronic
1167540366 19:50082750-50082772 CCACTGCGCCTGGCCCAAAACGG - Intergenic
1167703106 19:51062526-51062548 ACACAGCGCCTGGCACACAATGG + Intronic
1167747736 19:51362595-51362617 GAACAGTGCCTGGCACACAGTGG - Intronic
1167899616 19:52609777-52609799 CCACTGTGCCTGGTCCAAAAAGG - Intronic
1168309705 19:55454342-55454364 CCACAGTGGCTGGCACAGAGTGG + Intronic
1168314894 19:55480706-55480728 CCACAGTGCCTGGCCCCATGAGG + Intronic
1168333209 19:55581199-55581221 ACACAGTGCCTGGCACAGACAGG - Intergenic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168459319 19:56540054-56540076 GCTCAGTGGCTGGCACAAAGTGG - Intronic
1202697190 1_KI270712v1_random:133593-133615 CCTCAGGGCCTGGCACAAGTGGG + Intergenic
925384434 2:3452300-3452322 CCACAGTGCCTTGCACGGCCGGG + Intronic
926035855 2:9635101-9635123 CCACTGTGCCTGGCCTAAATCGG + Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926187554 2:10703014-10703036 CCACCGTGCCTGGCCCGAAAAGG + Intergenic
926340129 2:11898514-11898536 CCGCAGTGCCTGGTGCAGACAGG - Intergenic
926356494 2:12045502-12045524 GCACAGGGCCTGGCACATACTGG - Intergenic
926566648 2:14482880-14482902 CCACAGTGCATGGCACACTGTGG - Intergenic
926684323 2:15687106-15687128 CCACTGTGCCTGGCCCCAAGTGG - Intergenic
926789786 2:16558722-16558744 ACACAGTACCTGGCACATAGTGG - Intronic
926979450 2:18552374-18552396 GCAAAGTGTCTGGCACATACAGG - Intergenic
927050268 2:19321331-19321353 CCACCGCGCCTGGCCCACACGGG - Intergenic
927466422 2:23340215-23340237 GCACATAGCCTGGCACACACTGG - Intergenic
927498496 2:23566003-23566025 CCAAAGAGCCTGGCAGAAGCCGG - Intronic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927859205 2:26549984-26550006 TCCCAGTGCCTGGCACAGAATGG - Intronic
928023847 2:27723912-27723934 CAACAGTGTCTGGCACACAGTGG - Intergenic
928098805 2:28422951-28422973 GAACAGTGCCTAGCACAAATAGG - Intergenic
928124251 2:28604970-28604992 GCACAGTGCCTGGCACTAGTAGG - Intronic
928151634 2:28835563-28835585 GAACAGTGCCTGGCACATAGTGG + Intronic
928216661 2:29367152-29367174 GCACAGAGCCTGGCACATACTGG - Intronic
928216667 2:29367193-29367215 GCACAGAGCCTGGCACACACTGG - Intronic
929533259 2:42765137-42765159 CCACTGTGCCTGGGACACAGAGG - Intergenic
929555722 2:42924569-42924591 GCACAATGCCTGGCACAGAGTGG + Intergenic
929691849 2:44081503-44081525 CCAGAGTGCATCACACAAACAGG - Intergenic
929936246 2:46296704-46296726 CCAAACCGCCTGGCACAAGCCGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930758171 2:55000538-55000560 GCACAGTGCCTTGCTCAGACTGG - Intronic
931216857 2:60253290-60253312 GAACAGTGCCTGGCACACAGTGG - Intergenic
931264769 2:60650844-60650866 CTACATTGCCTGGCATGAACAGG + Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
931483330 2:62665808-62665830 CCTCAGGGCCTGGCACAAAGTGG - Intergenic
931544273 2:63363886-63363908 ACACTGTGCCTGGCAAAAATTGG - Intronic
931633855 2:64324808-64324830 GCACAGTGGCTGGCACACAGCGG - Intergenic
932180069 2:69638934-69638956 ATACAGTGCCTGCCACAAAGAGG + Intronic
932263995 2:70351113-70351135 CCACCGTGCCTGGCTCCTACTGG + Intergenic
932319408 2:70810329-70810351 CCACTGTGCCTGGCCTAAAATGG - Intronic
932740104 2:74284712-74284734 CCCCAGTGCCTGTGACAAAGGGG - Intronic
933369904 2:81401309-81401331 CTAAAGTGACTGGCACAAAATGG - Intergenic
933885141 2:86712177-86712199 CCACAGTGCCTGGCCTCAAAAGG + Intronic
933925033 2:87084507-87084529 CCACAGTGCCTGGCCTCAAAAGG - Intergenic
934697180 2:96408262-96408284 CCACTGTGCCTGGCCCGAAATGG + Intergenic
934762524 2:96864460-96864482 AGGCAGGGCCTGGCACAAACTGG + Intronic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
934964918 2:98712872-98712894 CCACTGTGCCTGGCCCAAAAGGG - Intronic
935622483 2:105142186-105142208 GTACAGTGTCTGGCACAAAATGG - Intergenic
935710746 2:105896177-105896199 CCATCGTGCCTGGCTTAAACAGG - Intergenic
936074333 2:109392101-109392123 CCACTGTGCCTAGCCCAAAAAGG + Intronic
936466278 2:112754023-112754045 GCACAGTGCCTAGCACACATAGG + Intronic
936938709 2:117861074-117861096 GCATAGTGGCTGGCACACACTGG + Intergenic
937085596 2:119169804-119169826 TCAAAGTGCCTGGCACAAGCCGG + Intergenic
937205097 2:120231284-120231306 CCCCAGGGCCTGGCACCTACCGG - Intergenic
937228154 2:120381614-120381636 CCCCAGAGCCTGGCACCAAGTGG - Intergenic
937246353 2:120496599-120496621 CCCCAGTGTCTGGCACTAAATGG - Intergenic
937299470 2:120830335-120830357 GCATAGTGCCTGGCACATAGGGG + Intronic
937333482 2:121046208-121046230 GCACAGTCCCTGGCACATTCAGG + Intergenic
937408744 2:121654236-121654258 CCACCCTGCCTGGCCCAAAATGG - Intergenic
937577796 2:123445154-123445176 CCTCAATGCTTGGCACAAAAGGG - Intergenic
937880428 2:126860259-126860281 TCACAATGCCTGGCACACACTGG + Intergenic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
938289894 2:130143570-130143592 CCACACTGCCAGGCAGAACCTGG + Intronic
938407309 2:131039747-131039769 CCTCTGTGCCGGGCACAAGCAGG + Intronic
938972569 2:136445946-136445968 CCCCAATGCCTGGCACAGAATGG - Intergenic
939072634 2:137561468-137561490 CCAAAGTGCTTTGTACAAACAGG - Intronic
939438018 2:142203796-142203818 CCACTGCGCCTGGCCCAAAAAGG - Intergenic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
940464679 2:154013467-154013489 CCACAGTGACTGGCAAGCACAGG - Intronic
941014457 2:160338891-160338913 GGCCAGTGCCTGGCACAAATAGG - Intronic
941362657 2:164571631-164571653 GCTCAGTGCCTGGCACATAATGG - Intronic
941790911 2:169550792-169550814 GCCCAGTGCCTGACACAACCAGG + Intronic
942154052 2:173108416-173108438 CCACCGCGCCCGGCATAAACTGG + Intronic
942255296 2:174091075-174091097 GCACAATGCCTGGCACATAGTGG + Intronic
942398723 2:175578902-175578924 GCACAGTGCCTGGCACTTAGTGG - Intergenic
942781633 2:179650032-179650054 GCACAGAGCCTGGCACAAGGCGG + Intronic
942947838 2:181688745-181688767 GCACAGTGCCTGGCACATAATGG - Intergenic
943613082 2:190057900-190057922 CCAGATTGCCTGGCACATAATGG + Intronic
943704212 2:191017912-191017934 CCACTGTGCCTGGCCTCAACTGG + Intronic
944318317 2:198307115-198307137 GCCCAGTGCCTGGCACACAGTGG - Intronic
944483147 2:200177794-200177816 GCACAGTGCCTGGCATATATTGG + Intergenic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
945854707 2:215055163-215055185 CCACAATTCCTGGCACATACTGG - Intronic
946095888 2:217273785-217273807 GCACAATGCCTGGCACAAGTGGG + Intergenic
946131553 2:217610693-217610715 ACCCAGTGCCTGGCACAGAGCGG + Intronic
946260135 2:218482385-218482407 GCCCAATGCCTGGCACTAACAGG - Intronic
946667266 2:222064089-222064111 CCACAGTGTCTGGCACATAGAGG - Intergenic
946735519 2:222750780-222750802 CCACAGTGCCTTGCATACAGCGG - Intergenic
947180668 2:227408526-227408548 CCACCGTGCCTAGCAAAAATAGG - Intergenic
947195707 2:227565061-227565083 CCACAGTGCCTTGAAGGAACTGG + Intergenic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
947635344 2:231677903-231677925 TCCCAGGACCTGGCACAAACGGG - Intergenic
947697160 2:232201060-232201082 CCACCGTGCCTGGCCCCAAAAGG + Intronic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
948353345 2:237358774-237358796 CTCCAGTGCCTGGCACAAAGTGG - Intronic
948634143 2:239323542-239323564 GCACAGTGCCTTCCACACACAGG - Intronic
1168794572 20:602921-602943 GCACAGTGCCTGCCACACAGAGG + Intergenic
1168862039 20:1052538-1052560 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1169086732 20:2830639-2830661 CCACCATGCCTGGCCCAAGCAGG + Intergenic
1169126433 20:3130942-3130964 CCACTGCGCCTGGCCCAAAGAGG - Intronic
1169556002 20:6750684-6750706 AAACAGTGCCTGGCACATAGTGG - Intergenic
1169591765 20:7150788-7150810 CCACAGTGCCTGGCCAAAAAAGG + Intergenic
1169918361 20:10706397-10706419 TCACAGTGCCTAGCACAGAGTGG - Intergenic
1169918679 20:10709630-10709652 CCACTGTGCCTAGCCCAAAGAGG + Intergenic
1170094274 20:12628997-12629019 CCACTGTGCCTGGCATCAATAGG + Intergenic
1170141517 20:13129287-13129309 CCACTGTGCCTGTCTTAAACAGG + Intronic
1170333030 20:15236510-15236532 ACACAGTGCCTGGCACCAAGTGG - Intronic
1170735197 20:19008262-19008284 CCACAGTGTCTGGCTCAACAGGG - Intergenic
1170813021 20:19689543-19689565 CAGCAGTGCCTGGCACAAAATGG + Intronic
1171017003 20:21551154-21551176 GCACAGTGCATGGCACACAGAGG - Intergenic
1171023643 20:21609344-21609366 GCACAGTGACTAGCACACACAGG - Intergenic
1171414344 20:24967486-24967508 CAACAGTGCCTGGCACATGTAGG - Intronic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172019077 20:31900045-31900067 CCACTGTGCCTGGCCGAATCTGG + Intronic
1172140043 20:32716326-32716348 CCACTGCGCCCGGCCCAAACTGG - Intronic
1172164515 20:32890884-32890906 GCATAGTGCCTGGCACATAGTGG + Intronic
1172165402 20:32895856-32895878 CCACCGTGCCTGGCCCAGGCTGG + Intronic
1172494863 20:35373389-35373411 CCACTGTGCCTGGCCCATTCTGG - Intronic
1172601110 20:36183548-36183570 GCCCAGTGTCTGGCACAAACAGG - Intronic
1172763662 20:37339268-37339290 CCACAGTGCCTGGCCTAGTCTGG + Intergenic
1172888706 20:38248578-38248600 GCACAGGACCAGGCACAAACAGG + Intronic
1172945126 20:38681457-38681479 GTGCAGTGCCTGGCACACACAGG - Intergenic
1172990471 20:39032457-39032479 CCACTGTGCCTGGCCCAGATTGG + Intronic
1173065131 20:39703402-39703424 CCACAGTGCCTGGCCCAACTTGG - Intergenic
1173161637 20:40657211-40657233 GCACAGTGCCTGGCACAAGGTGG - Intergenic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173345975 20:42200366-42200388 GCACAGTGCCTCGCACATAGTGG + Intronic
1173419900 20:42891762-42891784 ATACAGTGCCTGGCACACAGTGG - Intronic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1173812127 20:45962373-45962395 GCACAGAGCCTGGCACAGAGTGG - Intronic
1174200611 20:48804192-48804214 GAACAGTGCCTGGCACATAGTGG - Intronic
1174202929 20:48819806-48819828 GCACAGTGCCTGGCACACAGTGG + Intronic
1174327510 20:49791055-49791077 CCACCGTGCCTGGCCCACAAAGG + Intergenic
1175243146 20:57564439-57564461 CGTGAGTGCCTGGCTCAAACAGG - Intronic
1175587869 20:60159848-60159870 CCACAGAGCCTGGAACATGCTGG - Intergenic
1175615056 20:60390716-60390738 CAACTGTGCCTGGCACATAAAGG - Intergenic
1176305187 21:5119505-5119527 GCACAGTGCCTGGCACACAGGGG - Intronic
1176727059 21:10446480-10446502 CCACTGTGCCTGGCATAGATGGG + Intergenic
1176951913 21:15057863-15057885 GCACAATGTCTGGCACAAAACGG + Intronic
1177156377 21:17505521-17505543 CCACAGTGCCTGGCCTAAGAGGG - Intergenic
1178049480 21:28732329-28732351 TCACAGTGCCTGGCACACAGTGG - Intergenic
1178437357 21:32571964-32571986 CCACTGCGCCCGGCCCAAACTGG + Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178628260 21:34236591-34236613 CCACCGTGCCTGGCCCAGATAGG - Intergenic
1178751634 21:35309767-35309789 GCACAGTTCCAGGCACAAAATGG + Intronic
1178848973 21:36197497-36197519 GCACAGTGCCTAGAACAAAGCGG - Intronic
1178854574 21:36239703-36239725 CCACGGTGCCTGGCGCACAGGGG + Intronic
1178993243 21:37373047-37373069 CTCCAGTGCCTGGCACATAGGGG + Intronic
1179388578 21:40966433-40966455 TCAGAGTGCCTGGCACACATGGG - Intergenic
1179417905 21:41213113-41213135 CCACAGTGCCTGCAACTAATAGG - Intronic
1179561858 21:42220291-42220313 CCACAGTGCATGGCACGCTCCGG + Intronic
1179851867 21:44142525-44142547 GCACAGTGCCTGGCACACAGGGG + Intronic
1179939771 21:44629812-44629834 CCCCAGTGCCTGGCTCATAAGGG + Intronic
1179985369 21:44918021-44918043 CCATTCTGCTTGGCACAAACTGG - Intronic
1180002377 21:45001231-45001253 CCACAGGCCCTGGCCCAAGCTGG - Intergenic
1180252420 21:46597991-46598013 CCACACTGCCTGGGACAGGCAGG + Intergenic
1180287327 22:10760564-10760586 CCACTGTGCCTGGCATAGATGGG - Intergenic
1180605662 22:17057259-17057281 TCACAGTGCCTGCCCCAGACAGG + Intergenic
1180712595 22:17849620-17849642 CCACTGTGCCTGGCCCAGAATGG + Intronic
1180854680 22:19038451-19038473 CCACTGTGCCTGTCCCAGACTGG + Exonic
1181035303 22:20167062-20167084 CCACCGTGCCTGGCCCCATCAGG - Intergenic
1181439843 22:22930135-22930157 CCAGAGTCAGTGGCACAAACTGG - Intergenic
1181784891 22:25219871-25219893 GCACAGTGCCTGGCACACAGTGG + Intronic
1181898362 22:26131138-26131160 GCACAGTGCCTGGCACATAAAGG + Intergenic
1182007962 22:26977232-26977254 TCACAGTGCCTGGCACAGAGTGG + Intergenic
1182114334 22:27746689-27746711 GCACAGTGCCAGGCACAGAGGGG - Intergenic
1182129688 22:27841932-27841954 CTCCAGTGCCTGGCACACAGTGG - Intergenic
1182196923 22:28528440-28528462 CCACTGTGCCTGGCCTACACTGG - Intronic
1182544353 22:31065720-31065742 CCACAGGGACTGGCACATAATGG - Intronic
1182794324 22:32979696-32979718 GAACAGTACCTGGCACATACTGG - Intronic
1182889837 22:33808466-33808488 CCAAGGTGCTTGGCACAAATAGG + Intronic
1182949124 22:34354998-34355020 CCCCAGTGCCAGGCCAAAACCGG - Intergenic
1182958641 22:34451513-34451535 TCACAGAGCCTGGCACAACGTGG - Intergenic
1182966716 22:34528499-34528521 ATACAGTGCTTGGCACACACAGG - Intergenic
1183040885 22:35177090-35177112 ACACAGTGCCTGGCACAGACAGG + Intergenic
1183167644 22:36159792-36159814 CCACAGGGCCTGGCTCAAGTAGG + Intronic
1183173338 22:36204092-36204114 CCACAGGGCCTGGCACAAGTAGG + Intronic
1183178079 22:36238902-36238924 CCACAGGGCCTGGCACAAGTAGG + Intronic
1183180021 22:36253701-36253723 CCACAGGGCCTGGCACAAGTTGG - Intronic
1183251982 22:36736849-36736871 GCACAGTGCCTGGCACCAAAAGG + Intergenic
1183262696 22:36806088-36806110 GCACAGTGCCTGGCACACAGTGG + Intronic
1183325427 22:37188754-37188776 CCCATGTGCCTGGCACAAAGGGG - Intronic
1183480194 22:38059640-38059662 GTACAGTGCCTGGCACATAGTGG + Intronic
1183494394 22:38134272-38134294 CCACCGTGCCTGGCCTAAAGGGG - Intronic
1183637629 22:39074359-39074381 CCACTGCGCCTGGCACAAATGGG - Intronic
1183788774 22:40047846-40047868 GCACAGTGCTTGGCACATAGTGG + Intronic
1183910971 22:41078901-41078923 ACACAGTGCCTGCCACATAGAGG + Intergenic
1183967703 22:41452601-41452623 CCACGGTGCCCGGCCTAAACTGG - Intergenic
1184310212 22:43636409-43636431 ACACAGTGCCTGGCACACACGGG - Intronic
1184349873 22:43936487-43936509 GGACAGGGCCTGGCACATACTGG + Intronic
1184451342 22:44584494-44584516 GAACAGTGCCTGGCACCAAGTGG + Intergenic
1184607682 22:45583495-45583517 CAGCAGTGCCTGGCACACAGTGG + Intronic
1184632748 22:45796784-45796806 CCACTGTGCCTGGCCTATACTGG + Intronic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
949410812 3:3762140-3762162 CCACAGTGCCTGAAACAGAGTGG - Intronic
949547418 3:5083878-5083900 CCACTGTGCCTGGCCCAAATGGG - Intergenic
949779660 3:7671785-7671807 ACACAGTCCCTGTCACATACTGG - Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
950026742 3:9825438-9825460 TCACAATGCCTGGCACATAGTGG + Intronic
950121483 3:10484973-10484995 GCACAGTGCCTGGCACTGACAGG + Intronic
950233952 3:11302077-11302099 CCACAGTGCCTTGCACACTGAGG - Intronic
950528610 3:13539541-13539563 GCACAGTACCTGGCACAGAGTGG + Intergenic
950689631 3:14645755-14645777 CCAGAGTCCCTGGCACACAGTGG + Intergenic
951176379 3:19605774-19605796 CCACAGTGCCCGGCAGAAGCAGG - Intergenic
951464811 3:22990358-22990380 CCCGAGTGCCTGGCGCCAACAGG + Intergenic
951882089 3:27489380-27489402 CCAGAGTGCCTGGCACATAGTGG + Intergenic
952933486 3:38377386-38377408 GCACAATGCCTGGCACCAAATGG - Intronic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953134594 3:40171773-40171795 GCACAGTGCCTTGCACATAGTGG - Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
953375461 3:42424475-42424497 CTACAGTGCCTGGCACATGGTGG - Intergenic
953481496 3:43256120-43256142 TCACAGTGCCTGGCACAGAGGGG - Intergenic
953982269 3:47418737-47418759 CCGCAGTGCCTGGCCCCCACCGG - Exonic
954114122 3:48455148-48455170 CCACTGTGCCTGGCGCAGCCTGG + Intronic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954398300 3:50304689-50304711 ACACAGTGCCTTTCAGAAACAGG - Intronic
955046626 3:55367113-55367135 GAACAGTGCCTATCACAAACTGG + Intergenic
955065112 3:55527070-55527092 GCACAGTGCCTGGCACTAGGAGG + Intronic
955145770 3:56317658-56317680 CCCCAGTGCCTGGCACATAGGGG - Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
955481296 3:59393245-59393267 GTACAGTGCCTGGCACACAGTGG - Intergenic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
955672058 3:61412370-61412392 CCACTGTGACTGGCACAGAATGG - Intergenic
955676377 3:61453195-61453217 GCACTGTCCCTGGCACAAAGTGG + Intergenic
956052588 3:65264522-65264544 TCACAGTGCCTGCCACATAGAGG + Intergenic
956052602 3:65264671-65264693 TCACAGTGCCTGCCACATAGAGG + Intergenic
956052647 3:65265140-65265162 TCACAGTGCCTGCCACATAGAGG + Intergenic
956052650 3:65265169-65265191 TCACAGTGCCTGCCACATAAAGG + Intergenic
956193940 3:66633474-66633496 TCACAGTGTCTGTCACAAAGAGG + Intergenic
956213460 3:66825259-66825281 CCACTGTGCCTGGCCCAAGCAGG + Intergenic
956246990 3:67194835-67194857 CAACAGTGTCTAGCACAAACCGG + Intergenic
956516934 3:70060186-70060208 GCACAGTGCCTGGCATGAAGTGG - Intergenic
956662053 3:71608662-71608684 ACACAGTGCCTGGCACTGAGTGG + Intergenic
956681763 3:71787610-71787632 TCACAGTGCCTGGAACAGACTGG + Intergenic
956684426 3:71811118-71811140 CCGCAGTGCTTGGCCCAAAGTGG + Intergenic
956904533 3:73752165-73752187 GGACAGTGCCTGGCACAAAAAGG + Intergenic
956906002 3:73766060-73766082 GCACAGAGCTTGGCACACACAGG - Intergenic
957069849 3:75559108-75559130 CCAAAGTGCCTGGGTCAAAGTGG - Intergenic
957170893 3:76735472-76735494 ACACTGTGCCTGGCCCCAACAGG - Intronic
957573182 3:81975337-81975359 GCGCAGTGCCTGGCACAGAGTGG - Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
958124463 3:89337834-89337856 CCACAGTGACTTAAACAAACAGG + Intronic
958446763 3:94225178-94225200 CCATGGTGCCTGGCAACAACAGG + Intergenic
958928275 3:100182238-100182260 ACACAGTGCTTGGCACAGAGTGG - Intergenic
959903196 3:111682983-111683005 ACACAGTACCTGGCACAAAAGGG - Intronic
959914134 3:111796798-111796820 CCACTGTGCCTGGCCCAAGAGGG + Intronic
959983765 3:112549519-112549541 CCACCGCGCCTGGCTGAAACAGG - Intronic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960642733 3:119843453-119843475 CCACTGCGCCCGGCATAAACTGG - Intronic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
960696044 3:120397484-120397506 CAACAGTGCCTGGCACAAAATGG + Intronic
960915894 3:122694496-122694518 GCACAGTGCCTGGCACATCGTGG + Intronic
960926430 3:122799114-122799136 CCCCAGTGCGTGGAACACACTGG - Intronic
960986585 3:123284955-123284977 TCACAGTGCCTGGCACGAGCAGG - Intronic
961607929 3:128111308-128111330 ACACAGTTCCTGGCACATAGTGG - Intronic
961831944 3:129627408-129627430 CCTCAGTGCCTGGCCCAGAGCGG - Intergenic
961967542 3:130921367-130921389 CCACTGTGCCTGGCCCAAAAGGG + Intronic
962149642 3:132879350-132879372 GCACAGTGCCTGGCACACAGAGG + Intergenic
962167026 3:133060090-133060112 ACACAGTGCCTGGCACAAAAGGG - Intronic
962198593 3:133383446-133383468 GCACAGTGTCTGGCACACAATGG - Intronic
962222600 3:133576000-133576022 CCACTGTGCCTCGCACTCACTGG - Intronic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
962325366 3:134427907-134427929 CCACAGTACCTGGCACGGAGTGG - Intergenic
962331837 3:134485493-134485515 GCACAGAGCATGGCACCAACTGG + Exonic
962468728 3:135686390-135686412 GCACAGTGTCTGGCACAAGCAGG - Intergenic
962650273 3:137481478-137481500 TCACAGTGCCTGGCATACAGTGG + Intergenic
962883932 3:139605556-139605578 GCACAGAGCCTGGCACATTCTGG - Intronic
962886409 3:139632101-139632123 GCACTGTGCCTGGCACCAATAGG + Intronic
962986856 3:140544131-140544153 GCACTGTGCCTGGCACATAGCGG - Intronic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
963138740 3:141930791-141930813 GCACAGTGCCTAGCACACAGTGG - Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963227532 3:142877519-142877541 GCACAGTGCTTGGCACAAGCAGG - Intronic
963715317 3:148796210-148796232 CCACTGTGCCTGGCCCTTACTGG - Intronic
963900481 3:150728157-150728179 GCCCAGGGCCTGGCACAAATGGG - Intergenic
964502996 3:157369014-157369036 GCACAGTGCTTGGCACACACAGG + Intronic
964529329 3:157650242-157650264 CCTCAGTGCCTGGCACATCGTGG - Intronic
964714531 3:159708083-159708105 GAACAGTGCCTGACACAAAGTGG + Intronic
965600002 3:170445217-170445239 CCACCGTGCCTGGCCTGAACTGG - Intronic
966152901 3:176884356-176884378 GCACAGTGCCTGGCATACAGTGG - Intergenic
966552435 3:181219944-181219966 GAACAGTGCCTGGCACATAGTGG + Intergenic
966812989 3:183865016-183865038 CCACTGTGCCTGGCCCCAAGAGG - Intronic
966896872 3:184451637-184451659 CCACAGTGCCTGGCCAACAGTGG + Intronic
967017417 3:185494820-185494842 GAACAGTGCCTGGCACCAGCAGG - Intronic
967036162 3:185649642-185649664 CCACACTCCCTGGGACACACAGG + Intronic
968083056 3:195860194-195860216 CTTCAGTGCCTGGGACAAGCCGG + Intergenic
968245572 3:197143541-197143563 CCACCGTGCCTGGCAACAGCTGG + Intronic
968273928 3:197425451-197425473 GCACTGTGCCTGGCACAAGTGGG + Intergenic
968347136 3:198018359-198018381 ACTCAGTGCCTGGCACATGCAGG - Intronic
968641054 4:1715153-1715175 TCACAGGGCCTGGCACAGTCAGG + Intergenic
968668580 4:1835155-1835177 CCACTGTGCCCGGCCCACACGGG - Intronic
968793507 4:2686360-2686382 GCACAGGGCCTGGCACATATTGG - Intronic
968907521 4:3461611-3461633 CCACACAGCCTGGAACACACAGG - Intergenic
969032398 4:4225732-4225754 CCTCAGGGCCTGGCACGAAGTGG - Intronic
969296323 4:6272236-6272258 GCACAGTGCTTGGCACAAGATGG + Intronic
969667235 4:8566823-8566845 CCACAGTGCCCGGCCCTAAAGGG - Intronic
969925203 4:10578937-10578959 ATAAAGTGCCAGGCACAAACTGG + Intronic
970204280 4:13640538-13640560 ACACAGGGCCTGAAACAAACAGG + Intergenic
970341977 4:15116899-15116921 GCACAGTGCCTGGCACCCAGTGG + Intergenic
970372603 4:15423344-15423366 GCACAGTGCCTGGCACACACAGG + Intronic
970603651 4:17659771-17659793 CCACCGTGCCTGGCTGCAACAGG + Intronic
970649536 4:18161038-18161060 CCACTGTGCCCGGCCCAAAAAGG + Intergenic
971105087 4:23515888-23515910 CCACCGTGCCTGGCGTAAAATGG - Intergenic
971288097 4:25309411-25309433 CCACCGCGCCTGGGCCAAACTGG - Intergenic
971291847 4:25349947-25349969 AAACAGTGCCTGGCACACAGTGG - Intronic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
971455044 4:26836306-26836328 GCACAGTGCCTGGCACAGAGGGG + Intergenic
971477755 4:27088330-27088352 GAACAGTGCCTGGCACATAGTGG + Intergenic
972299633 4:37772613-37772635 GCACAGTGCCTGGCACAAGATGG - Intergenic
972414500 4:38825082-38825104 CCAACGTGCCTGGCCGAAACTGG + Exonic
972487430 4:39555518-39555540 CCACAGTGCCTGGCCAACAGAGG + Intronic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
972645998 4:40967863-40967885 GCACAGTGCCTGGGACATAATGG + Intronic
973101109 4:46272457-46272479 CCACAGTGCTCAGCACAAAGTGG - Intronic
973543657 4:51959158-51959180 CAACAGTGTCTGGCACTAAGAGG - Intergenic
973553387 4:52057528-52057550 GCCCAGTGCCTGGTACATACTGG - Intronic
973587133 4:52404640-52404662 CCCCAGTGTCTGGCACATAGGGG + Intergenic
973812359 4:54583923-54583945 GCACAGTGCTTGGCACACAGTGG + Intergenic
973934297 4:55827536-55827558 ACACAGTGCTTGGTACAAAAAGG + Intergenic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974185245 4:58437085-58437107 TAAGAGTGCTTGGCACAAACTGG + Intergenic
976038394 4:80852906-80852928 GCACAGTGCCTGGTACATACTGG - Intronic
976513467 4:85936925-85936947 CCACAGTGCCTGGCACACAATGG + Intronic
976521212 4:86029441-86029463 GCAGAGAGCCTGGCACAAATAGG + Intronic
976871924 4:89804912-89804934 TCCCAGAGCCTGGCACAAAAGGG - Intronic
977466469 4:97388005-97388027 GCACAGTTCCTGACACATACTGG + Intronic
977696031 4:99967475-99967497 CCACTGTGCCTGGCCCACATTGG + Intergenic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978534644 4:109748290-109748312 ACACAGTGCCTGGTACATATAGG - Intronic
979412633 4:120397249-120397271 CCACAGGGCCTTGTACACACTGG - Intergenic
979625495 4:122840400-122840422 GCACAGTTCCTGCCACAAATAGG - Intronic
979683282 4:123484245-123484267 CCACCGTGCCTGGCCCCATCTGG + Intergenic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
981029969 4:140114334-140114356 CAACAGTACCTGGCACAGAGGGG + Intronic
981177035 4:141693440-141693462 CCATAGTGCCTGACACATACGGG + Intronic
981697472 4:147573460-147573482 GCACAGTGCCTAGCACAAAGTGG - Intergenic
982051424 4:151506193-151506215 CCACTGTGCCTGGCCTAAATGGG + Intronic
982227635 4:153180900-153180922 GGACAATGCCTGGCACAAGCAGG - Intronic
982707275 4:158723755-158723777 GTACAATGCCTGGCATAAACTGG + Intergenic
982764176 4:159324313-159324335 CCACCATGCCTGGCACCAATAGG + Intronic
982790315 4:159584572-159584594 CCACTGCGCCTGGCACACATGGG + Intergenic
982846874 4:160264262-160264284 CAACAGTCCCTGGAAAAAACAGG + Intergenic
982880796 4:160712200-160712222 CCACAGTGCCTGGCCTTAATAGG + Intergenic
983239047 4:165210227-165210249 GCACAGTGCCAGGCAGAGACAGG - Intronic
983257509 4:165416856-165416878 GGACAGTGCCTGGCACACAGTGG + Intronic
983286323 4:165743775-165743797 CCACATAGCATGTCACAAACAGG - Intergenic
983579178 4:169290591-169290613 CCACAGTGCCTGGCCTAACGTGG + Intergenic
984331548 4:178327149-178327171 ATACAGTGCCTGGCACATACTGG - Intergenic
984559225 4:181249294-181249316 GCACAGTGTCTGGCACAGAAGGG - Intergenic
985038332 4:185863263-185863285 CGACATTGCCTGGCACACACAGG - Intronic
986265297 5:6185305-6185327 CCACAGTGCCCGGCCCACAATGG + Intergenic
986619408 5:9656143-9656165 GCACAGTACCTGGCACATATAGG + Intronic
987824404 5:23009889-23009911 CCACAGTGCCTGGCTGTAAATGG + Intergenic
987982072 5:25098375-25098397 CCACCGTGCCCGGCAGAACCAGG + Intergenic
988327206 5:29785949-29785971 CCACTGTGCCTGGCCTACACTGG - Intergenic
988411560 5:30892543-30892565 CCACAGTGCCCAGCACATAGTGG - Intergenic
988981657 5:36575561-36575583 TCACAGTGCGTTTCACAAACTGG + Intergenic
989101925 5:37831347-37831369 GGACAGTGCCTGGCACAGACAGG + Intronic
989744538 5:44812361-44812383 CCACCATGCATGGCACAAATAGG - Intronic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990548773 5:56851277-56851299 GCACAATGCCTGGCACACAGGGG - Intronic
991019562 5:61965796-61965818 CCACACTGCCTGGGACCCACGGG + Intergenic
991411745 5:66352636-66352658 CCACAGAGCCTGACATAAACAGG + Intergenic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
991725403 5:69530929-69530951 ACACAGTGTCTGGCACAAATCGG - Intronic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
992758270 5:79929646-79929668 GAACAGTGCCTGGCACACAGTGG - Intergenic
993436668 5:87904206-87904228 GCACAGTGCCTGGAACAAAGTGG - Intergenic
994127701 5:96187698-96187720 CCCTAGTGCCTTGCACAAAGTGG + Intergenic
994310241 5:98260719-98260741 TCACAGTGCCTGACACATATAGG - Intergenic
994332040 5:98517776-98517798 ACACTGTACCTGGCACACACAGG + Intergenic
994373590 5:98993910-98993932 CCACAGTGCCTGGCCCAGTTAGG - Intergenic
994522349 5:100856062-100856084 CCACTGTGCCAAGGACAAACTGG + Intronic
996030260 5:118696922-118696944 GAACAGTGCCTGGCACAGAGCGG - Intergenic
997046392 5:130324042-130324064 TCACAGTGCCTGGTACAAGGTGG + Intergenic
997280486 5:132640939-132640961 GCCCAGGGCCTGGCACCAACTGG - Intronic
997291374 5:132737981-132738003 ACACAGAGCCTGGCACAGAGTGG + Intergenic
997835357 5:137187622-137187644 GCACAGTGCCTGGTACACGCTGG - Intronic
997851523 5:137337046-137337068 GAACAGTGCCTGGCACACAGTGG + Intronic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
999046185 5:148472267-148472289 GCACAATGCCTGGCACACAGTGG + Intronic
999099318 5:149009533-149009555 GCTCAGTGCCTGGCACAGACTGG + Intronic
999201764 5:149821714-149821736 ACACAGTGCCTGACACATAGGGG - Intronic
999212220 5:149899757-149899779 ACACACTGCCTGACACACACTGG - Intronic
999650975 5:153767196-153767218 ACCCAGTGCCTGGCACAAGAAGG - Intronic
999730259 5:154472023-154472045 CCACAGTGCCTAGCACATGGTGG + Intergenic
999797470 5:155001928-155001950 CCACCGTGCCTGGCCGAAATAGG - Intergenic
1000037864 5:157462363-157462385 CCACCGTGCCTGGCCCTAAGAGG - Intronic
1000092342 5:157940680-157940702 CCACCGTGCCTGGCCCCAAGTGG - Intergenic
1000171675 5:158708398-158708420 GCACACTGCCTGGCACACAGTGG - Intronic
1000365444 5:160486486-160486508 GCACAGTGCTTGGCACATAGTGG - Intergenic
1000369701 5:160522962-160522984 TCACAGAGCCTGGCACATAGGGG - Intergenic
1000507152 5:162135468-162135490 GCACAGTGCCTGGGACATAGAGG - Intronic
1000702281 5:164467392-164467414 TCTCAGTACCTGGCACATACCGG + Intergenic
1001133072 5:169080339-169080361 GCACAGTGCTTGGCACATAAAGG - Intronic
1001270807 5:170310223-170310245 CAGCTGTACCTGGCACAAACTGG + Intergenic
1001445549 5:171779902-171779924 GGATAGTGCCTGGCTCAAACTGG - Intergenic
1001494141 5:172176006-172176028 CCACAGGGCCTGGCACAAGTAGG + Intronic
1001740853 5:174051616-174051638 GCACAGTGCCTGGCTCACAGAGG - Intronic
1001741472 5:174056340-174056362 GCACAGTGCCAGGCACATAGTGG + Intronic
1001930300 5:175668194-175668216 CCACAGTGCTTGGCCCACACTGG - Intronic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002324111 5:178394294-178394316 GAACAGTGCCTGCCACACACTGG + Intronic
1002512080 5:179727179-179727201 TGACAATGCCTGGCACAAAATGG - Intronic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1002548066 5:179965274-179965296 GCACAGTGCCTGGCACACAGTGG + Intronic
1002798130 6:493054-493076 CCACAGTGAGTGGGACACACAGG + Intronic
1002966963 6:1976396-1976418 ACCCAGTGCCTGGCACATAACGG + Intronic
1003377830 6:5595525-5595547 CCATAGTGCCTGGCGCACAGTGG - Intronic
1003430755 6:6035384-6035406 GCACAGTGCTTGGCACAAAGAGG + Intergenic
1003643677 6:7896838-7896860 CCACAGTGCATCCCAGAAACAGG + Intronic
1003790339 6:9539333-9539355 CCACAGTTCATTGCACAGACTGG - Intergenic
1004068896 6:12278602-12278624 CCACCATGCCTGGCCCAAGCTGG - Intergenic
1004382424 6:15144035-15144057 CCACCGCGCCTGGCTCATACTGG - Intergenic
1004384202 6:15158406-15158428 CCACGGTGCCTGGCCCAAAATGG + Intergenic
1004438636 6:15624107-15624129 GCACAGTGCCTGGTACATGCTGG - Intronic
1004615477 6:17283702-17283724 CCACCGCGCCTGGCCCAAAATGG + Intronic
1004621996 6:17338997-17339019 CCACCGTGCCTGGCCCATATTGG - Intergenic
1004703935 6:18105109-18105131 CCACACTGCATGACACAGACTGG - Intergenic
1005341115 6:24844762-24844784 CCACCGCGCCTGGCCCAAAATGG + Intronic
1005621814 6:27627276-27627298 CCACAGTGCCCAGCCCAAATTGG - Intergenic
1005844307 6:29765683-29765705 CCAGTGTGACTGACACAAACAGG - Intergenic
1005856414 6:29866486-29866508 CCAGTGTGACTGACACAAACAGG - Intergenic
1006067392 6:31471815-31471837 CCAGTGTGACTGACACAAACAGG + Intergenic
1006130705 6:31867778-31867800 ACCCAGTGCCTGGCACATAGTGG + Intronic
1006375350 6:33668776-33668798 CCACAGTGCCAGGCACACAGCGG - Intronic
1006489061 6:34370562-34370584 CAACAGTGTCTGTCACACACTGG + Intronic
1006660738 6:35641715-35641737 CCACCGTGCCCGGCCCAAAGGGG - Intronic
1006737189 6:36282620-36282642 ATACAGTGCCTGGCACTCACAGG - Intronic
1006751102 6:36377728-36377750 GCACAGTGACTGACACAAGCTGG - Intronic
1007074622 6:39058547-39058569 CCACGGTGCCTGGGTGAAACTGG - Intronic
1007357135 6:41329169-41329191 CCACTGTGCCTGGCCAAAAAGGG - Intergenic
1007451728 6:41945224-41945246 CCACCGTGCCTGGCCCAGATGGG - Intronic
1007947473 6:45839259-45839281 CAACAGTGACTGGCACATAGTGG + Intergenic
1008014751 6:46505845-46505867 GCTTAGTGCCTGGCACATACAGG + Intergenic
1008545583 6:52580331-52580353 CCACTGTGCCTGGCAAGAAATGG + Intergenic
1008684942 6:53914945-53914967 TCAGAGTGCCTGGCACATAATGG + Intronic
1008951365 6:57163393-57163415 GCACAGTGTTTGGCACAAAATGG + Intronic
1009705108 6:67239419-67239441 CGAGGGTGCCTGGCACATACTGG - Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010257029 6:73770455-73770477 CCACAGTGCCTGGCCCCTGCTGG - Intronic
1010751247 6:79618418-79618440 CCACGGCGCCTGGCCCAACCTGG - Intergenic
1011102208 6:83735321-83735343 CCACCGCGCCTGGCCTAAACTGG + Intergenic
1011522311 6:88222124-88222146 ACACAGTGCCTACCACATACTGG - Intergenic
1011720914 6:90155855-90155877 GAACAATGCCTGGCACAAGCAGG + Intronic
1012020177 6:93908209-93908231 CCACTGTGCCTGGCTGAAATAGG - Intergenic
1012414816 6:99001839-99001861 GCACAATGCCTGGCACATAGTGG - Intergenic
1012491748 6:99789685-99789707 CCAGAGTGCCTGCCTCAAAGTGG + Intergenic
1012664364 6:101948760-101948782 CCACTGTGCCTGGCCTAAAAAGG + Intronic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1012843021 6:104354319-104354341 CCACAGTGACTAGCACACAATGG + Intergenic
1012949457 6:105502804-105502826 ACACAGTGCCTGCCACAGAGTGG - Intergenic
1013268124 6:108520345-108520367 CCTCAGAGCCTGGCACCCACAGG - Intronic
1013548474 6:111183450-111183472 GCGCAGTGCCTAGCACACACTGG + Intronic
1013604456 6:111734857-111734879 GCACAGTGCCTGTCACATAAAGG - Intronic
1013755681 6:113459034-113459056 CCACTGTGCCTGGCCCACCCTGG - Intergenic
1014010207 6:116466822-116466844 CCTCTGGGCCTGGCCCAAACAGG + Intergenic
1014013954 6:116508213-116508235 GCACAGTACCTGGCACACAGTGG + Intronic
1014032829 6:116726087-116726109 GCACAGTGCCTGACACATAATGG + Intronic
1014652655 6:124059575-124059597 CTACAGTTCCTGGCACAGAGTGG + Intronic
1014937805 6:127404434-127404456 GAACAGTGCCTGACACATACAGG + Intergenic
1015183108 6:130382250-130382272 GCACAGTGTGTGGCACAAAGTGG + Intronic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1015402273 6:132799874-132799896 TCATAATGCCTGGCACAAAGTGG - Intergenic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1015777342 6:136827153-136827175 CCACAGTGCCTGGCCCGAGAAGG + Intronic
1015954047 6:138582182-138582204 CCACTGTGCCTGGCCCAAAGTGG + Intronic
1016013918 6:139165043-139165065 GCACAGTACCTGGCACATAAAGG - Intronic
1016386264 6:143533646-143533668 GCACAGTGCCTGGCCCAAAAAGG + Intergenic
1016967859 6:149735342-149735364 CCAATGTGCCTGGCTTAAACTGG + Intronic
1017014634 6:150090134-150090156 GCACAGTGCCTGGCACACGGTGG + Intergenic
1017026245 6:150183791-150183813 CCACCGTGCCCGGCCCAAACTGG + Intronic
1017118956 6:151006040-151006062 ACGCAGTACCTGGCACAAGCAGG - Intronic
1017187041 6:151611994-151612016 CCACTGCGCCTGGCCAAAACTGG + Intronic
1017662782 6:156690190-156690212 CCAAAGTGCTTGGCACATCCTGG + Intergenic
1017919518 6:158859073-158859095 ACACACTGCCTGGCACAAAGTGG + Intergenic
1017943292 6:159072578-159072600 GCACAGTGCCTGACACATAGTGG - Intergenic
1018220771 6:161576549-161576571 TAATAGTGCCTGGCACAAAGTGG - Intronic
1018630742 6:165819774-165819796 CAACAGTGCCTGCCACACAGTGG + Intronic
1018819898 6:167366328-167366350 TCACTGCGCCTGGCCCAAACTGG + Intronic
1019120574 6:169800861-169800883 CTGCAGGGCCTGGCACACACAGG - Intergenic
1019501232 7:1365739-1365761 GAACAGTGCCTGGCACACAGGGG - Intergenic
1019783832 7:2960762-2960784 ACAAAGTGTCTGGCACACACCGG - Intronic
1020060472 7:5147944-5147966 CCACTGTGCCTGGCCCCAAAAGG - Intergenic
1020432181 7:8125705-8125727 TCCCAGTGCCTGGCACACAGTGG + Intronic
1020724917 7:11800259-11800281 CCACCGCGCCTGGCTCAAATAGG - Intronic
1020827284 7:13045302-13045324 GCACCGTGCCTGGCACATATTGG - Intergenic
1021470412 7:20996166-20996188 CCACAGCGCCTGGCTGAGACTGG + Intergenic
1021606348 7:22413128-22413150 GCACAGTGCCTGGCACACAGAGG + Intergenic
1021764443 7:23932727-23932749 GCACAGTGCCTGGCATACAGTGG - Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1022255055 7:28647791-28647813 CCACTATGCCTGGCCCAAATTGG - Intronic
1022820168 7:33951647-33951669 TCACTGTGCCTGGTACAGACTGG + Intronic
1022966786 7:35481567-35481589 GCACAGTGCCTGGCACATGGTGG + Intergenic
1023088934 7:36600128-36600150 TCTCAGTGCCTGGCACATAAGGG - Intronic
1023162224 7:37308649-37308671 GCACAGTACCTGGCACACACTGG + Intronic
1023670732 7:42573553-42573575 ACACAGTGTCAGGCACATACTGG + Intergenic
1024295403 7:47837706-47837728 CCACAGTGTCTGGCACACAGTGG + Intronic
1024332828 7:48173369-48173391 GAACAGTGCCTGGCACACAATGG + Intronic
1024621652 7:51163419-51163441 GCACAGTGCCTAGAACAGACAGG + Intronic
1025171895 7:56766380-56766402 CCACTGTGCCCGGCCAAAACAGG + Intergenic
1025699967 7:63809175-63809197 CCACTGTGCCCGGCCAAAACAGG - Intergenic
1025958043 7:66197679-66197701 CCACCGTGCCTGGCCCATTCTGG + Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026617122 7:71915444-71915466 CCACTGTGCCTGGCCCAGATTGG - Intronic
1026771386 7:73202747-73202769 GCACAGTGCCTGGCACACATGGG + Intergenic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1027012252 7:74756144-74756166 GCACAGTGCCTGGCACACATGGG + Intronic
1027059230 7:75072690-75072712 CCACTGTGCCTGGCTGAAAGAGG - Intronic
1027075788 7:75189910-75189932 GCACAGTGCCTGGCACACATGGG - Intergenic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027173394 7:75888432-75888454 ACACAGAGCCTGGCACATAGAGG - Exonic
1027176715 7:75908628-75908650 CCACCGTGCCTGGCCCAGCCTGG + Intronic
1028649139 7:93131023-93131045 CCGCAGAGCTTGGCACAAAGTGG - Exonic
1028989834 7:97036974-97036996 CCACCGCACCTGGCCCAAACTGG + Intergenic
1029022325 7:97377894-97377916 GCACAGTGCCAGGCAGAATCAGG - Intergenic
1029088599 7:98030974-98030996 CCACAACACCTGGCATAAACAGG + Intergenic
1029260894 7:99302014-99302036 CCACAGTGCCTGGCCCAGGCTGG - Intergenic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1030082414 7:105789281-105789303 GCACAGTGCCTGGCACATTCAGG - Intronic
1030217933 7:107065764-107065786 TCACAGTGCCTGGCAGATAAAGG - Intronic
1031030332 7:116727428-116727450 CCTCAGTGCCTGGCACATTCTGG + Intronic
1031360845 7:120846632-120846654 GCACAGTGCCTGGCAAAGAGTGG - Intronic
1031979381 7:128114959-128114981 GCCCAGTGCCTGGCACACAGTGG + Intergenic
1032102204 7:128990466-128990488 GAACAGTGCCTGGCACATAGTGG + Intronic
1032162576 7:129522091-129522113 GCCCAGTACCTGGCACACACAGG - Intergenic
1032263872 7:130356918-130356940 ACACAGTGGCTGGCACACATTGG + Intronic
1032287775 7:130555537-130555559 CCACCGTGCCTGGCTGACACTGG - Intronic
1032415615 7:131733206-131733228 CCCCTGTGCCTGGCACACAAGGG - Intergenic
1032568766 7:132976473-132976495 CCATAGTGCCTGGCACATAGAGG + Intronic
1032626145 7:133593032-133593054 CCACCGTGCCTGGCCTAAATTGG + Intronic
1032662833 7:134004745-134004767 GCATAGTGTCTGGCACAAATAGG + Intronic
1032710516 7:134456726-134456748 TCACAGTGCCTGGCAAATATAGG - Intronic
1033046037 7:137962809-137962831 ACACAGTACCTGGCACAAAGTGG + Intronic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1033496074 7:141897570-141897592 CCACAGTGCAGGGCACCCACTGG + Intergenic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1033965746 7:146973313-146973335 CCACCGCGCCTGGCCCACACTGG + Intronic
1034259182 7:149743912-149743934 GCATAGTGCCTGGCACATTCTGG - Intergenic
1034475234 7:151277764-151277786 CCACAGTGCCCAGCACAGAGGGG + Intronic
1034929299 7:155148867-155148889 CCACAGTCACTGGCACCCACTGG - Intergenic
1034947873 7:155275426-155275448 CCACCATACCTGGCACAAAAAGG - Intergenic
1035220676 7:157404791-157404813 CCACCGTGCCTGGCCCAGATGGG + Intronic
1035259683 7:157653490-157653512 CCACCCTCCCTGGCACACACAGG - Intronic
1035349343 7:158235047-158235069 CCACCGGGCCTGGCCCAAAATGG + Intronic
1035651746 8:1271356-1271378 GCACAATGCATGGCACACACTGG + Intergenic
1036040391 8:5073137-5073159 GGACAGTGCTTGGAACAAACAGG + Intergenic
1036062675 8:5341919-5341941 GCACAATGCATGGCACATACAGG - Intergenic
1036607405 8:10319819-10319841 CGACAGTGCCAGTCTCAAACTGG - Intronic
1036760123 8:11502932-11502954 CCACAGTGGCTGGCAGCAGCTGG - Intronic
1037643067 8:20765981-20766003 ACATAGTGCCTGGCACAGAGTGG - Intergenic
1037761312 8:21743591-21743613 ACACAATGCCTGGCCCAAAGTGG + Intronic
1037836088 8:22215589-22215611 TCACAGTGCCTGGCAAAAGGGGG + Intergenic
1038110249 8:24488742-24488764 ACACAGTACCTGGCACAAAGTGG - Intronic
1038332251 8:26618225-26618247 GCAAAATGCCTGGCACACACTGG - Intronic
1038529679 8:28308177-28308199 GCATGGTGCCTGGCACTAACAGG + Intergenic
1038628932 8:29222057-29222079 CCACTGTGCCTGGCATATATAGG - Intronic
1038656874 8:29460869-29460891 CCACTGTGCCTGGCCTCAACTGG - Intergenic
1038751713 8:30302157-30302179 GAACAGTGCCTGTCACAGACGGG + Intergenic
1038818843 8:30933522-30933544 CCACCGCGCCTGGCCCAAAGTGG + Intergenic
1038905576 8:31898323-31898345 GCACAGTTCCTGGCACATAGTGG - Intronic
1039053661 8:33516433-33516455 TCCCAGTGCCTGGCACAATTTGG + Intergenic
1039088696 8:33805292-33805314 CCACAGTGCCTGGCCAATGCAGG + Intergenic
1039758876 8:40552542-40552564 ACACAATGCCTGGCACAAGTAGG - Intronic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039963543 8:42268097-42268119 CCACAGTGCCCAGCACATATAGG + Intergenic
1040045081 8:42954670-42954692 CTACAGTGCTTGGTACATACTGG - Intronic
1040048534 8:42988659-42988681 GCACAATGCCTGAGACAAACAGG - Intronic
1040060053 8:43096091-43096113 CCCCAGTGCCTGGCACACAGCGG - Intronic
1040650016 8:49437048-49437070 GCACAGTGCCTGGCACAACGTGG + Intergenic
1040854316 8:51932930-51932952 TCACAGTGCCTGGAACATAGAGG - Intergenic
1041353021 8:56967948-56967970 CCACAATAGCTGGCCCAAACAGG + Intronic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1042221199 8:66476463-66476485 CTATAGTGCCTGGCACATAGGGG - Intronic
1042258369 8:66830141-66830163 CCACTGTGCCTGGCCAAAAATGG + Intronic
1042837408 8:73091128-73091150 GCACAGGGCCTGGCACAAGCAGG + Intronic
1042855915 8:73267138-73267160 CCACAGTTTCAGGCACACACTGG - Intergenic
1042870436 8:73393039-73393061 CCATAGTGCCTGGTAGAAGCAGG + Intergenic
1043458683 8:80437858-80437880 TCACAGGGCCTGGCACATACTGG - Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044112313 8:88290263-88290285 CCACCGTGCCTGGCCCAATAAGG - Intronic
1044574816 8:93756786-93756808 CCACTGTGCCTGGCCTATACAGG - Intronic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1045242301 8:100413226-100413248 CCCCAGTTCCTGGCTCACACTGG + Intergenic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1045632793 8:104146075-104146097 CCACCGAGCCTGGCCCAAAAGGG - Intronic
1045663196 8:104459455-104459477 CCACAATGCCTGGCACTTAGTGG + Intronic
1046089138 8:109478280-109478302 CCAAAATGCCTGGCACATAGTGG - Intronic
1046336070 8:112788664-112788686 TCACAATGCCTGGCACATAGAGG + Intronic
1046402921 8:113730621-113730643 CCACTGCGCCTGGCCCATACTGG + Intergenic
1046523976 8:115360339-115360361 CCACAAGGCCTGGCACAATGTGG + Intergenic
1047226416 8:122958838-122958860 GCACAGGGCCTAGCACAAAGAGG - Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047390468 8:124446517-124446539 CCACAGTGCCTGGCATATTTTGG + Intergenic
1047711859 8:127560534-127560556 TCACAGTGCCTAGCACATAGAGG - Intergenic
1047790969 8:128203234-128203256 ACACAGTGCCTGGCCTAAAATGG + Intergenic
1048026417 8:130591332-130591354 CCATAGTGCCTGACACAAAGTGG + Intergenic
1048131944 8:131707520-131707542 CCACAATGCCTGGCACACTATGG - Intergenic
1048235633 8:132687317-132687339 GAAGAGTGCCTGGCACAAAGTGG - Intronic
1048366826 8:133745606-133745628 GCATGGTGCCTGGCACAGACTGG + Intergenic
1048688572 8:136932858-136932880 GCACAGTGCCTGGTACAAAAGGG + Intergenic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049093692 8:140535305-140535327 CCCCAGCGCCTGGCACAGCCTGG + Intronic
1049155540 8:141064153-141064175 CCACTGTGCCTGGCCCGAATTGG + Intergenic
1049366070 8:142237452-142237474 CCAAAGGGCCTGGCACAAAGGGG + Intronic
1050089408 9:2001507-2001529 GCACAGTGCCAGTCACAAAAGGG + Intergenic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050463430 9:5896273-5896295 GCCCAGTGCCTGGCACAAATTGG + Intronic
1050504451 9:6332859-6332881 GCACATTGCCTGGCACTATCAGG - Intergenic
1050704347 9:8380005-8380027 CCCAAATGGCTGGCACAAACAGG + Intronic
1051051283 9:12934678-12934700 GCACAGTTCCTGGCACAAGTTGG + Intergenic
1051671385 9:19514152-19514174 CCACAGAGCATGGCAATAACAGG - Exonic
1051741229 9:20254359-20254381 GCACAGAGCCTGGCACACAGTGG - Intergenic
1051909555 9:22137908-22137930 ATACAGTGCCTGGCACATATAGG - Intergenic
1051970597 9:22882083-22882105 CCACCATCCCTGGCCCAAACTGG + Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052335257 9:27312643-27312665 GCACGGTGCTTGGCACAAACTGG + Intergenic
1052409516 9:28105333-28105355 GAACAGTGCCTAGCACAAACAGG - Intronic
1052787349 9:32841653-32841675 ACACAGTGCCTGGCACATACAGG + Intergenic
1053061352 9:35034696-35034718 CCACCGTGCCTGGCAACACCTGG - Intergenic
1053140632 9:35680513-35680535 CCACTGTGCCTGGCCCCAAACGG + Intronic
1053162249 9:35821224-35821246 GCACAAGGCCTGGCACAAAATGG + Intronic
1053578809 9:39381700-39381722 TCACAGTGCCAGGGACACACAGG + Intergenic
1054100392 9:60940504-60940526 TCACAGTGCCAGGGACACACAGG + Intergenic
1054121791 9:61216129-61216151 TCACAGTGCCAGGGACACACAGG + Intergenic
1054585953 9:66966382-66966404 TCACAGTGCCAGGGACACACAGG - Intergenic
1054745962 9:68853966-68853988 CCAGCTTGCCTGGCACAAGCCGG - Intronic
1054902497 9:70383804-70383826 CAACAGTGCCTGGCATGAATAGG + Intergenic
1054983580 9:71235444-71235466 CCCCAGTGCCTAGTACATACTGG + Intronic
1055315092 9:75027287-75027309 CCACAGTGCCTAGCACACCAGGG + Intronic
1056532115 9:87497491-87497513 GCACCGTGCCCGGCACAAGCTGG + Intronic
1057196641 9:93119276-93119298 GCACAGGGCCTAGCACATACAGG + Intergenic
1057395265 9:94674434-94674456 CCACTGTGCCTGGCCAAAAGAGG - Intergenic
1057424629 9:94938265-94938287 CCACAGTGCTTGGCACTGAGAGG + Intronic
1057525742 9:95798955-95798977 CCACCTTGCCTGGCCCCAACTGG - Intergenic
1057613773 9:96569873-96569895 CCACCGCGCCTGGCCGAAACAGG + Intronic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1057872420 9:98728470-98728492 GCACAGTGCCTGGCACATGGAGG - Intergenic
1057891874 9:98875739-98875761 GCCCAGTGCCTGGCACACAGAGG - Intergenic
1058103694 9:100946037-100946059 TGACAGTGCCTGGCACAGAGTGG - Intergenic
1058145422 9:101405786-101405808 CCACCGTGCCTGGCCTAAAATGG - Intronic
1058434952 9:104954018-104954040 ACGCAGTGCCTGACACATACAGG - Intergenic
1058778621 9:108310568-108310590 CCAGAGTGCCTGGCACAGAAGGG + Intergenic
1059145912 9:111898916-111898938 GAACAGTGCCTTGCACAAAACGG - Intronic
1059222966 9:112643280-112643302 GCCCAGTGCCTGGCACAGAGAGG + Intronic
1059609849 9:115880672-115880694 GCACAGGGCCAGGCACATACTGG + Intergenic
1059774713 9:117463554-117463576 GCCCAGTGCCTGGCACACAGTGG - Intergenic
1060008051 9:120017935-120017957 CCACACTGCCTTGCAAAAACAGG + Intergenic
1060019767 9:120119002-120119024 GCCCAGTGCCTGGCACAAAGTGG + Intergenic
1060171392 9:121464223-121464245 GCACAGTGCCTGGTACATAGTGG + Intergenic
1060236208 9:121864621-121864643 GCTCAGTGCCTGGCACACATGGG + Intronic
1060302743 9:122384871-122384893 GCACAGTGCCTGGCATAAGACGG - Intronic
1060317138 9:122522731-122522753 GCACACTGCCTGGCACAGACAGG - Intergenic
1060336267 9:122726064-122726086 CCACAGTGCCTGGCCCAAAACGG - Intergenic
1060456056 9:123799195-123799217 TCACAGTGCCTGGCAAATAGTGG - Intronic
1060489481 9:124071990-124072012 CAACAGTGTCTTGCACAGACTGG + Intergenic
1060547976 9:124471749-124471771 GCACAGTGCCTGGCACACACTGG - Intronic
1060817360 9:126642182-126642204 CAACAGGGCCTGGCACACCCGGG + Intronic
1061011307 9:127956210-127956232 GAACAGGGCCTGGCACACACTGG - Intronic
1061017849 9:127992889-127992911 CAACAGTGCCTGGCACGGAGTGG - Intergenic
1061149483 9:128820753-128820775 CCAGAATGCCTGGAACAACCTGG + Exonic
1061206810 9:129168975-129168997 GCACAGTGCCTGGCATATATAGG + Intergenic
1061267057 9:129512393-129512415 GCACAGTGCCTGGCCCACACAGG - Intergenic
1061381020 9:130257691-130257713 CCACTGTGCCTGGCCAAAGCAGG - Intergenic
1061619064 9:131799127-131799149 ACATGGTGCCTGGCACAGACGGG + Intergenic
1061817494 9:133205743-133205765 CCACAGTTCCTGGGACATTCGGG - Intronic
1062083935 9:134638909-134638931 CCACAGTGCCTAGCAGAGAGTGG - Intergenic
1062687541 9:137822605-137822627 CCACTGCGCCCGGCCCAAACTGG - Intronic
1062712377 9:137983533-137983555 CAACAGTGCATGAAACAAACAGG + Intronic
1185494007 X:540558-540580 CCACTGTGCCTGGCCCATGCAGG + Intergenic
1185696613 X:2199650-2199672 CCTCAATCCCTGGCACACACCGG + Intergenic
1185790325 X:2924319-2924341 CCACCGTGCCCGGCCCACACAGG + Intronic
1185866364 X:3627749-3627771 CCACTGTGCCTGGCCAAAAAGGG + Intronic
1185945924 X:4376090-4376112 CCACTGTGCCTGGTCCAAACTGG - Intergenic
1185996758 X:4959916-4959938 GCTCAGTGCTTGGCACAAATAGG + Intergenic
1186443609 X:9607132-9607154 GCCCAGGGCCTGGCACACACAGG - Intronic
1186633519 X:11377205-11377227 GCATAGTGCTTGGCACAAAATGG + Intronic
1186647943 X:11527324-11527346 CCACTGTGCCTGGCAACAATTGG - Intronic
1186912471 X:14183392-14183414 CCACAATGCCTGACACAAATAGG - Intergenic
1187237657 X:17483553-17483575 GCACAATGCCTGACACAAACAGG - Intronic
1187247180 X:17563283-17563305 CCTCAATGCCTGGCACATAGGGG + Intronic
1187544444 X:20234001-20234023 CCAATGTGCCTGGCACATAATGG - Intronic
1188553556 X:31386632-31386654 ACACAGTGCTTGGCACATAATGG + Intronic
1188696894 X:33204682-33204704 GCACAGTACCTGGCACAAAATGG + Intronic
1188704733 X:33313447-33313469 CCATAGTGCCTGACAAAACCTGG - Intronic
1189169423 X:38894742-38894764 GCACAGTGCCTGACACATGCTGG - Intergenic
1189173687 X:38933344-38933366 AGATAGTGCCTGGCACACACTGG - Intergenic
1189222109 X:39381404-39381426 GTACAGTGCCTGGCACACAGTGG - Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1189521140 X:41769659-41769681 CCACTGTGCCTGGCCCAAAGAGG - Intronic
1189995089 X:46630465-46630487 GCACAGTGGCTGGCACATGCAGG - Intronic
1190029614 X:46959426-46959448 ACACGGTGCCTGGTACATACTGG - Intronic
1190236198 X:48617537-48617559 GCACAGTGCCTGGCACATGTAGG - Intergenic
1190242276 X:48666717-48666739 CCACAGTGCCTGGGGAAACCAGG - Intergenic
1190454614 X:50615574-50615596 GCACAGTGCCCGGCACACAGTGG + Intronic
1190549266 X:51562486-51562508 CCACCGTGCCTGGCCTAAAATGG - Intergenic
1190776875 X:53559722-53559744 CCATAGTTCCTGGCACCAAGTGG + Intronic
1190809664 X:53871052-53871074 CCACAGTGCCTGGCCCAGAATGG - Intergenic
1191056474 X:56246412-56246434 CAACAGTACCTGGCACAAAGAGG - Intronic
1191675418 X:63787379-63787401 TCACAATGCCTGGCACACAGGGG - Intergenic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1192270190 X:69571848-69571870 TCACACTGCCTGGCACAAGTGGG + Intergenic
1192270205 X:69571951-69571973 GCACAGGGCCTGGCACACAGTGG + Intergenic
1193186847 X:78523430-78523452 CCACCACGCCCGGCACAAACAGG - Intergenic
1193978112 X:88148903-88148925 CCACAGTGCCTGTCAGAGCCTGG - Intergenic
1194587096 X:95748708-95748730 CCACCGTGCCTGGCCCCAAATGG + Intergenic
1196150430 X:112367651-112367673 CCCCAGTGCCTGGCATATAGTGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1196934967 X:120720467-120720489 GAACAGTGCCTGGCAAAGACGGG + Intergenic
1197105363 X:122707607-122707629 CCACTGTGCCTGGCCCCATCTGG - Intergenic
1197703217 X:129615619-129615641 GCACTGTGCCTGGCACACAATGG - Intergenic
1197865127 X:131009428-131009450 GCACAGTGCCTGGCACAGAGTGG - Intergenic
1198024740 X:132694082-132694104 CCACAGTGCCTGGCACCAGTAGG - Intronic
1198107716 X:133477168-133477190 CCACAGAGTCTGGCCCACACTGG - Intergenic
1198425491 X:136515729-136515751 GAACAGTGCCTGGCACATAGTGG + Intergenic
1198428755 X:136545403-136545425 GCACAGTGCCTAGCACATAGTGG - Intronic
1198511471 X:137356146-137356168 GCAAAGTGCCTGGCACATAGTGG + Intergenic
1198744339 X:139874345-139874367 CCACCGCGCCTGGCACAATCAGG + Intronic
1199513216 X:148646523-148646545 CCAGAGGTCCTGGCAGAAACAGG - Intronic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic
1200238306 X:154479737-154479759 CCACTTTGCCTGGCCTAAACTGG - Intergenic
1200274947 X:154723272-154723294 GCACAGTGTCTGGCACATAGTGG - Intronic
1200424993 Y:3010103-3010125 CCACAGTGGCTGCTCCAAACAGG + Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1201678368 Y:16614175-16614197 GCTCAGTGCTTGGCACCAACAGG - Intergenic
1201733042 Y:17226246-17226268 CCACTGTGCCTGGTCCAAACTGG - Intergenic
1201771836 Y:17623205-17623227 ACACAGTCCATGGCACAAACAGG + Intergenic
1201829719 Y:18282781-18282803 ACACAGTCCATGGCACAAACAGG - Intergenic