ID: 954287613

View in Genome Browser
Species Human (GRCh38)
Location 3:49629979-49630001
Sequence CAGGGTGGGCGGCGTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 725
Summary {0: 1, 1: 0, 2: 4, 3: 68, 4: 652}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954287597_954287613 22 Left 954287597 3:49629934-49629956 CCCCAACTCCTACCCAATGGCAA 0: 1
1: 0
2: 1
3: 25
4: 210
Right 954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG 0: 1
1: 0
2: 4
3: 68
4: 652
954287598_954287613 21 Left 954287598 3:49629935-49629957 CCCAACTCCTACCCAATGGCAAA 0: 1
1: 0
2: 4
3: 17
4: 198
Right 954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG 0: 1
1: 0
2: 4
3: 68
4: 652
954287600_954287613 14 Left 954287600 3:49629942-49629964 CCTACCCAATGGCAAACCATGAG 0: 1
1: 0
2: 0
3: 6
4: 156
Right 954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG 0: 1
1: 0
2: 4
3: 68
4: 652
954287601_954287613 10 Left 954287601 3:49629946-49629968 CCCAATGGCAAACCATGAGCCTA 0: 1
1: 0
2: 0
3: 3
4: 88
Right 954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG 0: 1
1: 0
2: 4
3: 68
4: 652
954287599_954287613 20 Left 954287599 3:49629936-49629958 CCAACTCCTACCCAATGGCAAAC 0: 1
1: 0
2: 1
3: 17
4: 138
Right 954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG 0: 1
1: 0
2: 4
3: 68
4: 652
954287603_954287613 -2 Left 954287603 3:49629958-49629980 CCATGAGCCTACGCAGTTTCCCA 0: 1
1: 0
2: 0
3: 11
4: 101
Right 954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG 0: 1
1: 0
2: 4
3: 68
4: 652
954287602_954287613 9 Left 954287602 3:49629947-49629969 CCAATGGCAAACCATGAGCCTAC 0: 1
1: 0
2: 0
3: 1
4: 85
Right 954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG 0: 1
1: 0
2: 4
3: 68
4: 652
954287607_954287613 -9 Left 954287607 3:49629965-49629987 CCTACGCAGTTTCCCAGGGTGGG 0: 1
1: 0
2: 1
3: 9
4: 172
Right 954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG 0: 1
1: 0
2: 4
3: 68
4: 652
954287595_954287613 26 Left 954287595 3:49629930-49629952 CCATCCCCAACTCCTACCCAATG 0: 1
1: 0
2: 5
3: 57
4: 472
Right 954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG 0: 1
1: 0
2: 4
3: 68
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954287613 Original CRISPR CAGGGTGGGCGGCGTGGAGA AGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900987012 1:6078976-6078998 CAGGGTGGGCACCGTGGAGGTGG + Intronic
901399271 1:9004893-9004915 CAGGATGGGTGGGGCGGAGAAGG + Intronic
901657729 1:10779985-10780007 CAGGGTGGGCGGGGTGTTGGTGG - Intronic
901676457 1:10888718-10888740 CAGGGCGGGCCGGGTGGGGAGGG - Intergenic
901690133 1:10967432-10967454 CAGGGTGGGCTTCATGGAGAAGG - Intronic
901880201 1:12189218-12189240 CAGGGAGGGCTGCCTGGAGGAGG + Intronic
902407082 1:16190283-16190305 CAGGGTGGGCTTCCTGGAGGTGG - Intergenic
903153501 1:21429267-21429289 GCGGGCGGGCGGCGTGGAGGTGG + Intergenic
903173195 1:21566078-21566100 CAGGGTGGGCTGGGAGAAGAAGG - Intronic
903231601 1:21925713-21925735 CTGGGAGGGCTGTGTGGAGAAGG - Intronic
903269648 1:22179282-22179304 CAGAGGGGGCGGGGTGGAAAAGG + Intergenic
903377662 1:22876715-22876737 CAGGGTGGGCGGTGGGCAGCAGG + Intronic
903480929 1:23652728-23652750 CAGGGTGGGAAGGGTGGAGAGGG - Intergenic
903647187 1:24902596-24902618 GAGGGTTGGCAGCGTGGGGAAGG + Exonic
903687237 1:25140660-25140682 CAGGAGAGGCTGCGTGGAGAAGG - Intergenic
903823859 1:26127898-26127920 CTGTGAGGGCGGCGTGGAGCAGG + Intergenic
903953551 1:27010416-27010438 CAGGGATGGGGGCGGGGAGAGGG - Intronic
904463768 1:30695837-30695859 CAGGCTGGGCGGGCTGCAGATGG + Intergenic
904467885 1:30718843-30718865 CGGAGTGGGCAGCGTGGACAAGG - Exonic
904566542 1:31431805-31431827 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566566 1:31431877-31431899 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566614 1:31432021-31432043 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566617 1:31432030-31432052 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566620 1:31432039-31432061 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566623 1:31432048-31432070 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566626 1:31432057-31432079 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566638 1:31432093-31432115 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566653 1:31432138-31432160 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566656 1:31432147-31432169 CAGGGTGGACAGGGTGGATAGGG + Intronic
904601970 1:31678186-31678208 CAGGGTGGCGGGGGTGGGGAGGG + Intronic
905249021 1:36636274-36636296 CAGGGAGGGCGGGGAGGAGGTGG - Intergenic
906322815 1:44827383-44827405 CAGGGTGAGAGGCGAGGAGACGG - Exonic
906488308 1:46248093-46248115 CAGACTGGGCGGAGTGGAGTGGG - Exonic
906811948 1:48836099-48836121 CAGGGTGGTGGCAGTGGAGATGG + Intronic
907453182 1:54560261-54560283 CAGGGTGGGCTCCCTGGAGGAGG + Intronic
907526929 1:55059194-55059216 CAGAGTGGGTGGAGTGGAGCTGG + Intronic
907731235 1:57068045-57068067 CAGTGGGGGCGGGGTGGGGAGGG - Intronic
908497854 1:64712984-64713006 CAGCGTGGGCTTCATGGAGAAGG + Intergenic
908789795 1:67770272-67770294 CAAGGTGGGTGGAATGGAGAGGG + Intronic
908917176 1:69142197-69142219 CAGGGTGGGGGGCTAGGGGAGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
910324656 1:85992063-85992085 TGGGGTGGGGGGAGTGGAGAGGG - Intronic
911336343 1:96585140-96585162 GAGGGTGGGCCTCTTGGAGAGGG + Intergenic
911852449 1:102836432-102836454 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
912117665 1:106426640-106426662 TGGGGTGGGGGGAGTGGAGAGGG + Intergenic
912178569 1:107190567-107190589 TGGGGTGGGGGGAGTGGAGAGGG - Intronic
912447970 1:109751883-109751905 CAAGGTGGGTGGCCTAGAGAGGG - Intronic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
914319460 1:146545078-146545100 CAGGGTGGCGGGGGTGGAGGTGG + Intergenic
915462116 1:156076527-156076549 CAGGGTGGGCCCAGTGGAGTGGG + Exonic
915515279 1:156409167-156409189 CAGGGAGGGCTGTGTTGAGAGGG - Intronic
915961962 1:160274519-160274541 CAGGGTTGGGGGTGTTGAGAGGG + Intergenic
916694435 1:167221434-167221456 CGGGGTGGGGGGCGTGAAGGGGG + Intronic
917148506 1:171919297-171919319 GAGGGTGGGGGGCCAGGAGAGGG - Intronic
917579600 1:176361827-176361849 CAGGTTGGGGGGTGGGGAGAGGG + Intergenic
917839100 1:178963191-178963213 CAGGGTGGGCCCCATTGAGAAGG + Intergenic
919944103 1:202307371-202307393 CAGGGAGTGCAGGGTGGAGAAGG - Exonic
919989975 1:202702898-202702920 CAAGGAGGGGGGCCTGGAGAGGG - Intronic
920067646 1:203280368-203280390 CAGGGAGGGCCTCATGGAGAAGG - Intergenic
920371292 1:205481050-205481072 CAGGGTGGGTGGGGAGAAGATGG - Intergenic
920750813 1:208674771-208674793 GAGCGTGGGCGGAGTGGTGACGG - Intergenic
921010274 1:211134108-211134130 CAGGGAGGGAGGCGCGAAGAGGG - Intronic
921030112 1:211328970-211328992 CAGGGTGAGGGGCCTGGAGCAGG - Intronic
921732071 1:218589793-218589815 CAGGGTGGGCAGCATCGAGCAGG - Intergenic
922162561 1:223089200-223089222 CAGGGTGGGTGGGTTGGAGGTGG - Intergenic
922205192 1:223440270-223440292 CAGGGAGGGTGGAGTAGAGATGG + Intergenic
923160981 1:231314352-231314374 CAGTGTGGCCTGAGTGGAGATGG + Intergenic
923747421 1:236715298-236715320 CAGGGTGGGGGGAGGGGGGAGGG - Intronic
1062760429 10:12969-12991 CAGGGTGGGCGCTGTGCAGTGGG - Intergenic
1062836753 10:640729-640751 GAGGGTGGGCGCCGGGAAGAGGG + Intronic
1062836760 10:640747-640769 GAGGGTGGGCGCCGGGAAGAGGG + Intronic
1062836767 10:640765-640787 GAGGGTGGGCGCCGGGAAGAGGG + Intronic
1062895619 10:1101126-1101148 CAGGGAGGGCGGCCTGGAGCAGG - Intronic
1063665184 10:8056356-8056378 GCGGGTGGGCGGGGTGGAGGGGG + Intronic
1064479509 10:15725417-15725439 AAGGGTGGGGGGTGGGGAGAGGG + Intergenic
1065083176 10:22147409-22147431 CATGGTGGACGACGTAGAGATGG - Intergenic
1065099667 10:22321040-22321062 CTGGGGGGGCGGCGGGGGGAGGG + Intronic
1065861634 10:29877071-29877093 CAGGGTGGGCCGATTGGAGCGGG + Intergenic
1066273527 10:33846416-33846438 CAGGGTGGGGCTGGTGGAGAAGG - Intergenic
1066690216 10:38019126-38019148 CGGGGTGGGGGGAGTGGGGAGGG - Intronic
1067533944 10:47094426-47094448 CAGTGTTGGGGCCGTGGAGAGGG + Intergenic
1068017573 10:51536791-51536813 CAGGGTGGGGGGAGGGGTGAGGG - Intronic
1068685210 10:59863557-59863579 AAGGGTGGGTGGTGGGGAGAGGG + Intronic
1069196327 10:65555598-65555620 CAGGGTGGGGGCTGGGGAGATGG - Intergenic
1069430798 10:68332383-68332405 CAGGGAGGGCGGCTTGCCGATGG + Intronic
1069569447 10:69485536-69485558 GAGGGTAGGTGGGGTGGAGAGGG + Intronic
1069776095 10:70928116-70928138 GAGGGTGGGCTGCCTGGAGGAGG + Intergenic
1070327095 10:75396339-75396361 CAGGGTCGGGGGTGTGGAGACGG + Intergenic
1070758083 10:79005883-79005905 CAGGGTGGGAGATGAGGAGAGGG - Intergenic
1071075151 10:81740904-81740926 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1071531407 10:86392491-86392513 CAGGGTGGGAGTAGAGGAGAAGG + Intergenic
1071963439 10:90829511-90829533 CAGGGTGGGGGGCTAGGGGAGGG - Intronic
1072369838 10:94754988-94755010 TGGGGTGGGGGGCGTGGGGAGGG - Intronic
1073288703 10:102402950-102402972 CAGGGTGGGCGGGGGCGGGAGGG - Exonic
1073475122 10:103747513-103747535 CAGTGTGGGGGGCTTGGCGAGGG + Intronic
1073911156 10:108346285-108346307 GAGGGTGGGTGGAGTGGAGCTGG + Intergenic
1074097949 10:110330427-110330449 CAGGGTTGGAGCAGTGGAGATGG + Intergenic
1074544152 10:114389354-114389376 CAGGGTGGGAAGTGGGGAGAGGG + Intronic
1074815584 10:117139380-117139402 TGGGGAGAGCGGCGTGGAGAGGG - Intergenic
1075587049 10:123665880-123665902 CAGCGCGGGGGGCGGGGAGAGGG + Intergenic
1075611377 10:123857543-123857565 GATGGAAGGCGGCGTGGAGATGG + Intronic
1075611381 10:123857561-123857583 GATGGAAGGCGGCGTGGAGATGG + Intronic
1075611385 10:123857579-123857601 GATGGAAGGCGGCGTGGAGATGG + Intronic
1075611389 10:123857597-123857619 GATGGAAGGCGGCGTGGAGATGG + Intronic
1075611393 10:123857615-123857637 GATGGAAGGCGGCGTGGAGATGG + Intronic
1075611397 10:123857633-123857655 GATGGAAGGCGGCGTGGAGATGG + Intronic
1075611401 10:123857651-123857673 GATGGAAGGCGGCGTGGAGATGG + Intronic
1075627324 10:123972502-123972524 CAGGGATGGAGGGGTGGAGAGGG + Intergenic
1075797995 10:125134839-125134861 CAGGGTAGGTGGAGTGGGGAGGG - Intronic
1075916573 10:126173106-126173128 CAGGGTGGGAGGCTAGGGGAGGG + Intronic
1076553316 10:131302768-131302790 CGGGGTGGGGGGCTAGGAGAGGG - Intronic
1076578323 10:131488003-131488025 CAGGGGGCGCTGCGTGGAGGAGG - Intergenic
1076686249 10:132199679-132199701 CAGGGTGGGGGGCGGGGTGGTGG + Intronic
1076786601 10:132752693-132752715 GAGGGGGTGCGGCGTGGAGGCGG + Intronic
1077032742 11:477015-477037 CTGGGTGGGGGGCAGGGAGAAGG + Intronic
1077130932 11:972190-972212 CAGCGTGGGCAGCCGGGAGATGG + Exonic
1077657074 11:4029568-4029590 GAGGGTGGGCGGGGTGGGGGTGG + Intronic
1078191009 11:9092173-9092195 TGGGGTGGGCAGTGTGGAGAAGG - Intronic
1078550704 11:12278693-12278715 CAGGATGGGAGCAGTGGAGATGG + Intronic
1078621164 11:12909524-12909546 CGGGGTGGGGGGCGAGGGGAGGG + Intronic
1079496800 11:21053261-21053283 CAGGGTGGGGGGCTAGGGGAGGG - Intronic
1079893169 11:26083669-26083691 CAGGGTGGGAGGCTAGGGGAGGG + Intergenic
1080660544 11:34292742-34292764 CAGGGAGGGCTGCCTGGAGGAGG + Intronic
1081606668 11:44531436-44531458 CAGGGTGGGGGGCGTGCTGGAGG - Intergenic
1081786853 11:45753810-45753832 GAGGGTGGACGGAGGGGAGAGGG + Intergenic
1081802261 11:45868071-45868093 CAGGGTGAGAGGCATGGAGAGGG + Intronic
1082789513 11:57337671-57337693 CGGGGTGGGCGGAGTGGGGAGGG + Intergenic
1083128721 11:60601115-60601137 CGGGGTGGGGGGAGTGGGGAGGG - Intergenic
1083171837 11:60927805-60927827 CAGGGTGTGTGGCATGGAGCCGG - Exonic
1083329699 11:61891701-61891723 CAGGGAGGGCGGCGTCGAGGCGG + Intronic
1083491763 11:63019154-63019176 CAGGGTGGGCTGCCTGGAGAAGG + Intergenic
1083502639 11:63124953-63124975 CGGGGTGGGGGGAGTGGGGAGGG + Intronic
1083714881 11:64569494-64569516 CTGGGTGGGCTCCGTGGAGGAGG + Intronic
1083726549 11:64631340-64631362 CAGGGACGGAGGCCTGGAGAAGG + Intronic
1084219369 11:67667897-67667919 CAGGGTGGGCGTCCAGGAGGGGG - Intronic
1084422516 11:69067394-69067416 CAGGCTGGGCGGCGGGTGGATGG + Intronic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1085270583 11:75267590-75267612 GCGGGTGGGCGGGGTGGAGGGGG - Intronic
1086265511 11:84993262-84993284 GAGGGTGGGGGGCAAGGAGAGGG + Intronic
1087078167 11:94144690-94144712 GAGGCTGGGTGGAGTGGAGAAGG - Intronic
1087675932 11:101161561-101161583 CGGGGTGGGGGGAGTGGGGAGGG - Intergenic
1088187811 11:107193140-107193162 CAGGGTGGGCAGACTGGTGAAGG - Intergenic
1088516341 11:110638850-110638872 CGGGGTGGGAGGAGTGGGGAGGG + Intronic
1089279494 11:117363356-117363378 CAGGGTGAGGGGTGTGCAGAGGG - Intronic
1089295272 11:117463641-117463663 CAGGGTGGGAGGGATGGAGAGGG + Intronic
1089973194 11:122710857-122710879 CAGGGTGGTGGGGGTGGAGATGG + Intronic
1090044224 11:123316866-123316888 CAGGGAGGAAGGCGGGGAGAGGG + Intergenic
1092664876 12:10784941-10784963 TAGGGTGGGGGGAGTGGGGAGGG - Intergenic
1092725381 12:11480447-11480469 CAGAGTGGGGGTGGTGGAGAAGG - Intronic
1096657163 12:53098804-53098826 CATGGGGGGCAGCGGGGAGATGG + Intronic
1096700727 12:53380760-53380782 CGGGGTGAGGGGCGTGGAAAGGG - Intronic
1096981882 12:55732800-55732822 GAGGGTGGGAGGCATGGGGAAGG + Intergenic
1097041470 12:56158459-56158481 ACGGGTGGGGGGCGAGGAGAAGG + Intronic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1098199669 12:68041373-68041395 GAGGGTGGGAGCAGTGGAGATGG - Intergenic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1099809528 12:87563045-87563067 TGGGGTGGGGGGAGTGGAGAGGG - Intergenic
1100051284 12:90451444-90451466 TGGGGTGGGGGGAGTGGAGAGGG - Intergenic
1100869472 12:98895076-98895098 CGGGGTGGGCGGCGAGGCGGGGG + Intronic
1101509801 12:105382736-105382758 CAGGGTGGGTGGCGTGAACAGGG + Intronic
1101787203 12:107894559-107894581 CAGGGAGGGGGAAGTGGAGATGG - Intergenic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1103595567 12:122022644-122022666 CGGGGTGCGCGGGGAGGAGACGG - Intronic
1104322640 12:127766024-127766046 CAGGGAGGGCTGCCTGGAGGAGG + Intergenic
1104566884 12:129893395-129893417 CAGGGTGGGTAGGGTGGGGAGGG - Intronic
1104657058 12:130581276-130581298 CAGGGTGGGGGGCGTGGATCTGG + Intronic
1104893711 12:132151979-132152001 CAGAGTGGGCGGGGTCGGGACGG - Intronic
1104909868 12:132235556-132235578 CAGGGTGGTCAGCATGGAGTTGG + Intronic
1106299915 13:28454029-28454051 CTGGGTGGGGGGAGTGGGGAAGG + Intronic
1106350366 13:28923927-28923949 CACGGTGGGGAGGGTGGAGAAGG - Intronic
1107548773 13:41457050-41457072 GTGGGCGGGCGGAGTGGAGAGGG - Intergenic
1107648704 13:42522278-42522300 TAGGGTGGGCGGCTAGGGGAGGG + Intergenic
1107713534 13:43174606-43174628 CAGGGTGGGGGGCAAGGAGAGGG - Intergenic
1107747340 13:43524484-43524506 CAGGGTGGAGGGCGTGAGGAGGG - Intronic
1109114011 13:58357803-58357825 AAGGGTGGAGGGAGTGGAGATGG - Intergenic
1111352336 13:87047291-87047313 CAGGGTGAGGGGCTAGGAGAGGG + Intergenic
1111387431 13:87544978-87545000 CAGGGTTGGAGGAGTGGGGAGGG + Intergenic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1113200761 13:107866204-107866226 CAGGGTGGGGGACGAGGAGGCGG + Exonic
1113784904 13:112997325-112997347 CAGGGTGGGAGCCGAGGAGCTGG + Intronic
1113940322 13:114015404-114015426 CAGGGAGGGGCGCGTGGGGAGGG + Intronic
1113941009 13:114018633-114018655 CAGGCTGGGAGGCGTGGGAAAGG + Intronic
1114059297 14:19004738-19004760 CAGCGTGGGGGGCTAGGAGAGGG - Intergenic
1114103249 14:19397013-19397035 CAGCGTGGGGGGCTAGGAGAGGG + Intergenic
1114132973 14:19814812-19814834 CAGGGTGGGGGGCTAGGGGAAGG - Intronic
1114409957 14:22491412-22491434 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
1114568246 14:23647887-23647909 CAGAGTGGGCAGCCTGGATATGG - Intergenic
1116092148 14:40322537-40322559 CAGGGTGGGGGACATGGGGAGGG + Intergenic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1116969013 14:51045417-51045439 CAGGATGGGCTGCCTGAAGAGGG + Intronic
1117057038 14:51922882-51922904 CAGGGTGGGGGCAGAGGAGAAGG + Intronic
1119103620 14:71903631-71903653 GAGGGTGGGAGGCCTGGAGCTGG + Intergenic
1119626193 14:76178425-76178447 CCGGGTTGGGGGCGTGGTGAGGG + Intronic
1120339548 14:83202030-83202052 TGGGGTGGGCGGAGTGGGGAGGG - Intergenic
1120409116 14:84129255-84129277 CAGGGAGGGCTGCAGGGAGAAGG + Intergenic
1121131036 14:91447595-91447617 CGGGGTGGGGAGGGTGGAGATGG + Intergenic
1121255572 14:92528041-92528063 CAGGGAGGGGGGCGTGGAAGGGG + Intronic
1121299445 14:92858814-92858836 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1121485351 14:94310409-94310431 CAGGCTGGCAGGGGTGGAGATGG - Intronic
1121958348 14:98235714-98235736 CAGGGAGGGAGGCGAGGGGAGGG + Intergenic
1122206934 14:100152309-100152331 CAGGGTGGGCATCATGGAGAAGG + Intronic
1122400339 14:101463302-101463324 CAGGGTGGAGGACGTGGAGGTGG - Intergenic
1122769176 14:104090224-104090246 CAGAGTGGTAGGCGTGGATATGG - Intronic
1122835080 14:104426925-104426947 GAGGGTGGGCGGGGAGGAGAGGG - Intergenic
1122983290 14:105201130-105201152 GAGGGTGGGCTGTGTGGGGATGG + Intergenic
1122985241 14:105208840-105208862 CAGGATGGGGGGCTTGGAGAAGG - Intergenic
1202836755 14_GL000009v2_random:83753-83775 CAGGGTGGGGGGCTAGGAGAGGG - Intergenic
1123576063 15:21670624-21670646 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1123612684 15:22113098-22113120 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1123980399 15:25596895-25596917 CAGGCAGGGCGGCGTGTAAACGG + Intergenic
1124513579 15:30347972-30347994 CAGGGTGGGCAGGGTGGCGGTGG - Intergenic
1124613073 15:31222378-31222400 TAGGGTGGGGGCAGTGGAGAAGG - Intergenic
1124729342 15:32182793-32182815 CAGGGTGGGCAGGGTGGCGGTGG + Intergenic
1125249137 15:37679232-37679254 GGGGGTGGGGGGAGTGGAGAGGG + Intergenic
1126919314 15:53503146-53503168 CAGGGTGCGGGGCATGGGGAGGG + Intergenic
1128210633 15:65898638-65898660 CAAGGTGGGGTGAGTGGAGAGGG + Intronic
1129160668 15:73746030-73746052 CAGGGTGGGGGGTGTGGTGGGGG - Intronic
1129910941 15:79225764-79225786 CAGGGTTGGGGGCGTGGGGCAGG + Intergenic
1130043888 15:80429438-80429460 CAAGGTGGGGCGCCTGGAGAGGG + Intronic
1130559439 15:84946827-84946849 CAGGGCAGGCGGCAGGGAGATGG - Intergenic
1131980720 15:97992062-97992084 CAGGGTGAGAGATGTGGAGAGGG + Intergenic
1132028437 15:98421547-98421569 CAGCGTGCGGGGCGTGGAGAGGG + Intergenic
1132196702 15:99919059-99919081 AAGGTTGGGGGGCTTGGAGAGGG + Intergenic
1202984931 15_KI270727v1_random:404869-404891 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1132579245 16:677572-677594 CCCGGTGGGGGGCGTGGGGAGGG + Intronic
1132599515 16:767609-767631 GAGCGTGGGGGGCGTGGAGGAGG + Intronic
1132599536 16:767662-767684 GAGCGTGGGGGGCGTGGAGGAGG + Intronic
1132599587 16:767781-767803 GAGCGTGGGGGGCGTGGAGGAGG + Intronic
1132663315 16:1071041-1071063 CAGGGTGGCCGATGTGGGGAGGG + Intergenic
1132682447 16:1148619-1148641 AAGGGTGAGCGGCGTCTAGACGG + Intergenic
1132685266 16:1159444-1159466 CAGGGTGGGCCGTGGGGAGGAGG + Intronic
1132736310 16:1387816-1387838 CAGGGTGGGCTGCCAAGAGATGG - Intronic
1132765839 16:1533807-1533829 CAGGGTGGCCGGTGTGGAGCGGG - Exonic
1133437123 16:5789291-5789313 CAGGGAGGGAGGTGTGGTGAAGG + Intergenic
1135326080 16:21526619-21526641 CAGAGTGGGCTGCCAGGAGAGGG + Intergenic
1135510814 16:23081497-23081519 CAGGGTGGGCTGCTAGTAGATGG - Intronic
1135522596 16:23188962-23188984 CAGAGTGAGCTGGGTGGAGAAGG + Intronic
1135668969 16:24359056-24359078 CACGGTGGGTGGCGGGGAGTGGG - Intronic
1137406793 16:48195399-48195421 CATGGTGGACGGGGTGGGGACGG + Intronic
1137543630 16:49382264-49382286 TGGGGTGGGGGGAGTGGAGAGGG + Intronic
1137868202 16:51923356-51923378 GAGGGTGGGGGGCTAGGAGAGGG - Intergenic
1138436251 16:57001872-57001894 CAGGGTGGGGGAGGTGGGGATGG - Intronic
1138534202 16:57651342-57651364 CAGGGTGGGCTGCAGGGAAAGGG - Exonic
1139520755 16:67481415-67481437 CAGGGCGGGCGGGGTAAAGAAGG + Intergenic
1139527276 16:67524788-67524810 CAGGGTAGGGGCCGTGGGGATGG - Intronic
1139632218 16:68237595-68237617 CCGGGTGGGCGGTCCGGAGATGG - Intronic
1139719337 16:68840307-68840329 CAGGGTGGGGGGCATGGTGGAGG - Intergenic
1139964268 16:70736899-70736921 CAGGGAGGGCGGGCTGGACAGGG + Intronic
1140014063 16:71165003-71165025 CAGGGTGGCGGGGGTGGAGGTGG - Intronic
1140165810 16:72549528-72549550 CCGGGTGGGGGGCTAGGAGAGGG + Intergenic
1141322348 16:83023305-83023327 CTGGGAGGGCGGGGTGGAGTCGG - Intronic
1142006514 16:87691890-87691912 CAGGGTGGGAGGTGTAGGGACGG + Intronic
1142039118 16:87881344-87881366 CAGAGTGGGCTGCCAGGAGAGGG + Intergenic
1142688912 17:1593064-1593086 CCGGGTGGGGGTGGTGGAGAGGG + Intronic
1142717284 17:1754216-1754238 CAGCGAGGTCGGCGTGGAGGCGG + Exonic
1142847958 17:2691144-2691166 CAGGATGGGAAGCGTGGGGAGGG + Intronic
1143030398 17:3964282-3964304 CCGGGCGGGCGGCATGGAGGCGG - Exonic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143849208 17:9797091-9797113 CAGGGTGGAGGGCAAGGAGAGGG - Intronic
1143903090 17:10189292-10189314 CAGGGTGGTGGAAGTGGAGATGG - Intronic
1145019114 17:19416097-19416119 CACAGTGGGCTGCATGGAGAAGG + Exonic
1145987603 17:29057639-29057661 CAGGGTGGGTGGAGGGGTGAGGG + Intergenic
1146012779 17:29208871-29208893 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1146181743 17:30702868-30702890 CATGGTGGGAGGCCAGGAGAGGG - Intergenic
1146367090 17:32237607-32237629 CTGGGTGGTAGGAGTGGAGATGG - Intronic
1146750368 17:35373411-35373433 CAGGGTGTGGGGTGTGGGGAGGG - Intronic
1147159865 17:38563557-38563579 CCTGGAGGGCGGCGTGGAGACGG - Intronic
1147250789 17:39151540-39151562 AGGGGCGGGCGGCGAGGAGACGG + Exonic
1147423657 17:40334923-40334945 CAGGGTGGGAGCCCTAGAGATGG + Intronic
1147566679 17:41540636-41540658 CAGGGAGGGCGCCCTGGAGGAGG + Intergenic
1147604625 17:41767529-41767551 CAGGTTGTGCAGCGTGGTGATGG + Exonic
1148101411 17:45094134-45094156 CTGGGTGGCCGGGGTGGAAAGGG - Intronic
1148603201 17:48909077-48909099 GAGGGTGGCCGGAATGGAGACGG - Intronic
1149498175 17:57132360-57132382 GAGGGTGGGCGGGCTGGAGGGGG + Intergenic
1149498211 17:57132456-57132478 GAGGGTGGGCGGGCTGGAGGGGG + Intergenic
1149544733 17:57495052-57495074 CAGGCTGGGCTGCAGGGAGAGGG + Intronic
1149598925 17:57880869-57880891 CAGGTTGGGCTGTGTGGTGAGGG - Intronic
1149655687 17:58308608-58308630 CAGGCTGGGAGGCGTGGGTAGGG + Exonic
1150698502 17:67426608-67426630 GAGGGTGGGGGGCGAGGGGAGGG + Intronic
1150802185 17:68291294-68291316 CGGGGTGGGGGGCGGGGGGAGGG - Intronic
1151042815 17:70883237-70883259 CAGGGTGAGTGGGGTAGAGATGG + Intergenic
1151932465 17:77241292-77241314 CAGGGGGTGCGGCGGGGGGAGGG + Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152705953 17:81843785-81843807 CAGGGTGGGCTGCCTGGAGATGG + Exonic
1152725143 17:81941451-81941473 CAGGGTGGCCAGCATGGCGAAGG + Exonic
1152759047 17:82098737-82098759 CAGCGACGGCGGCGTGGAGTCGG - Intergenic
1152953337 18:13323-13345 CAGGGTGGGCGCTGTGCAGTGGG - Intergenic
1152970796 18:158929-158951 ATGGGTGGGGGGAGTGGAGATGG + Intronic
1153493767 18:5676610-5676632 CAGGATGGGTGGAGTGGAAATGG + Intergenic
1154458996 18:14560704-14560726 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1155012681 18:21796391-21796413 CAGGGTGGGGGGCAAGGGGAGGG + Intronic
1155427556 18:25722455-25722477 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
1156575825 18:38313932-38313954 CAGGGTGGGAGGAGGGGTGATGG - Intergenic
1156937378 18:42726623-42726645 CATGGTGGGGGGCAAGGAGAGGG + Intergenic
1157125146 18:44949856-44949878 AAGGGTGGGTGGAGTGGAGAGGG - Intronic
1157442847 18:47723525-47723547 CTGGGGGGGCGCCATGGAGAAGG - Intergenic
1157447423 18:47755871-47755893 CAGGGAGGGCTTCCTGGAGAGGG - Intergenic
1157492776 18:48136072-48136094 CGGGGTGGGCGGCGGGCAGGGGG + Intronic
1157544998 18:48540611-48540633 CGGGGTGTGCGGCGTGTAGAGGG + Intronic
1157807915 18:50672147-50672169 CAGGGTGCAGGGAGTGGAGAAGG + Intronic
1158122910 18:54070100-54070122 TAGGGTGGGAGGGGTGGAGGGGG - Intergenic
1158147661 18:54334202-54334224 AAGGGTGGTAGACGTGGAGAGGG - Intronic
1159051096 18:63422152-63422174 GCGGGTGGGGGGCGGGGAGAAGG - Intronic
1160051837 18:75440955-75440977 CAGGGTGGGAGGTGTGGTGAGGG + Intergenic
1160453203 18:78979323-78979345 CGGGTTGGGGGGCGGGGAGAGGG + Intergenic
1160800149 19:963909-963931 CGTGGTGTGTGGCGTGGAGAAGG + Intronic
1160881871 19:1324684-1324706 CAGGGAGGGCTGCCTGGAGGCGG + Intergenic
1160919836 19:1514119-1514141 CAGGGTGGGCTTCCTGGAGGAGG - Intergenic
1160922418 19:1527092-1527114 CAGGGTGGGGCGCGTGGAACAGG + Intronic
1160928777 19:1559976-1559998 CAGGGTGGGCTTCCTGGAGGAGG - Intronic
1160952008 19:1672190-1672212 CAGGGTGGGCTCCGTGGGGTGGG - Intergenic
1161080733 19:2308680-2308702 CAGGGTAGGTGGGGTGCAGACGG - Intronic
1161285230 19:3464930-3464952 CAGGGTGGGGGTCGTGGAGTGGG + Intronic
1161302078 19:3547625-3547647 CAGGGTGGGCGCCCTGCAGCTGG + Intronic
1161452263 19:4353026-4353048 CCGGGTGAGAGGCGTGGGGAGGG + Exonic
1161499802 19:4607579-4607601 CAGGGTGGGCTTCCTGGAGGAGG + Intergenic
1161612652 19:5251694-5251716 CAGGGTGGGCGGCGAGGAGGGGG - Intronic
1161768038 19:6217497-6217519 CAGGGTGGCCTGCCTGGAGAGGG + Intronic
1162033134 19:7925858-7925880 CCGGGCGCGCGGCGTGGGGACGG + Intronic
1162050421 19:8029201-8029223 CAGGGTGGGGGGCGGGGGGCAGG + Intronic
1162109444 19:8392097-8392119 CACGGTGGGCTGAGTGGAGATGG - Intronic
1162152524 19:8656242-8656264 GAAGATGGGCTGCGTGGAGAAGG - Intergenic
1162186957 19:8913148-8913170 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1162302134 19:9850070-9850092 TGGGGTGGGTGGCGGGGAGATGG + Intergenic
1162327927 19:10009626-10009648 CAGGGAGGGAGGGGAGGAGATGG + Intronic
1162525617 19:11204441-11204463 CAGGGTGGGCTTCCTGGAGGAGG - Intronic
1162850826 19:13429980-13430002 TAGGGTGGGGGGAGTGGGGAGGG + Intronic
1162977090 19:14212937-14212959 CATGGTGGGAGGCCAGGAGAGGG + Intergenic
1163049075 19:14667679-14667701 GGGGGTGGGGGGCGTGGGGAGGG + Intronic
1163173436 19:15548696-15548718 CAGGGAGGGCTGCCTGGAGGAGG + Intronic
1163548936 19:17954524-17954546 CAGGGGGTGCGGGGTGGAGGCGG - Intronic
1164358455 19:27469567-27469589 TGGGGTGGGGGGAGTGGAGAGGG + Intergenic
1164598827 19:29547753-29547775 CAGGGAGGGCTGCCTGGAGGAGG + Intronic
1164670030 19:30067187-30067209 CAGGGTGTGGGGCCTGGAGCTGG + Intergenic
1165261250 19:34620516-34620538 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1165951248 19:39474902-39474924 CAGGGAGGGCTGCCTGGGGAAGG + Intronic
1166345033 19:42160200-42160222 CTGGGTGGGCAGAGTGGAGAAGG + Intronic
1166668531 19:44695989-44696011 GGGGGTGGGCAGCGGGGAGATGG + Intergenic
1166706012 19:44908482-44908504 CACAGTGGGAGGCGGGGAGAAGG - Intronic
1166742767 19:45124204-45124226 CAGGGAGGGCTTCCTGGAGAAGG + Intronic
1167040840 19:47021589-47021611 CTGGGCGGGCGGCGCGGAGGAGG - Intronic
1167245184 19:48368994-48369016 CAGGGCGGGTGGCAAGGAGACGG + Intronic
1167591387 19:50406289-50406311 CATGGTGGGCCGCGTGCAGATGG + Exonic
1167622825 19:50568517-50568539 GAGGGAGGGCAGCGTGGAGAGGG + Intergenic
1167788398 19:51654959-51654981 CAGGTTCTGTGGCGTGGAGATGG + Intergenic
1168095061 19:54109831-54109853 GAGGGAGGGCCGGGTGGAGAGGG - Intronic
1168185826 19:54698696-54698718 CAGGGAGGGCTGGGAGGAGACGG + Intronic
1168341225 19:55624283-55624305 CATGGTGGGCGGGGTGGGGGAGG - Intronic
1168471230 19:56642818-56642840 CGGGGTGGGCGGAAGGGAGAAGG - Intergenic
1168521340 19:57053264-57053286 TAGGGTGGTGGCCGTGGAGAGGG - Intergenic
1202635876 1_KI270706v1_random:43609-43631 CAGGGTGGGGGGCTAGGAGAGGG + Intergenic
1202649452 1_KI270706v1_random:167221-167243 CAGCGTGGGGGGCTAGGAGAGGG - Intergenic
925161489 2:1687238-1687260 CAGGGTGCCCGGGGAGGAGAGGG - Intronic
925310229 2:2876552-2876574 CAGGGAGAGCGGCTGGGAGAAGG - Intergenic
926390249 2:12382705-12382727 GAGGGTGGGGGGCGTGGGGAGGG + Intergenic
926820171 2:16843367-16843389 CGGGGTGGGGGGCGAGGGGAGGG - Intergenic
926933350 2:18062566-18062588 CAGGGTGGGCTGCATGAAGCTGG + Intronic
927128575 2:20036707-20036729 CAAGGAGGGCGTCGTGGAGGTGG - Intronic
927190375 2:20513091-20513113 CAGGGTGGGAGTGGTGGGGAGGG - Intergenic
927714638 2:25343476-25343498 CAGGGTGGGGGTTGGGGAGACGG - Intergenic
927848655 2:26485305-26485327 CAGGGAGGGCTGCATGGAGGAGG - Intronic
928922448 2:36539648-36539670 CAGGGTGGTAGCCGTGGAGGTGG + Intronic
929462078 2:42109858-42109880 CAGGGTGGGCCTCATTGAGAGGG - Intergenic
929548636 2:42875029-42875051 CAGGAGGGGAGGCGTGGAGTGGG + Intergenic
930437603 2:51364770-51364792 TGGGGTGGGGGGAGTGGAGAGGG + Intergenic
931694234 2:64859897-64859919 CAGCGGGGGCGGCGCCGAGAGGG + Intergenic
932337715 2:70940350-70940372 CAGGGTGGGTGGGCTGGATAGGG - Exonic
932400999 2:71481270-71481292 CAGGGAGGGCTGTGGGGAGAAGG - Intronic
932416907 2:71579083-71579105 CAGGGGGTGTGGGGTGGAGAGGG - Intronic
932464492 2:71907599-71907621 CAGGGTGGGAGACTTGGAGAAGG - Intergenic
932608938 2:73184313-73184335 TGGGGTGTGCGGCGTAGAGACGG + Intergenic
934678396 2:96265840-96265862 AACAGTGGGCGGCGTGGGGAGGG - Intronic
935164153 2:100555033-100555055 CAGGGTGAGAGGAGTGGAGGCGG - Intergenic
935310506 2:101778459-101778481 CAGGGTGGACAGCATGCAGAAGG + Intronic
936719994 2:115239743-115239765 GAGGGTGGGGGGCTAGGAGAGGG - Intronic
937295570 2:120807902-120807924 CTGGGTGGGCAGGGTGGGGAGGG + Intronic
938063328 2:128268410-128268432 GCGGGCGGGCGGCGTGGAGGTGG - Exonic
938115117 2:128597268-128597290 AAGGTAGGGCGGCGTGGAGTTGG + Intergenic
938307363 2:130264978-130265000 CAGGGTGGGCGACTGGGAGCTGG + Intergenic
940455017 2:153886353-153886375 CGGGGTGGGGGGAGTGGGGAGGG - Intronic
940701880 2:157055039-157055061 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
941119861 2:161515646-161515668 CAGGGTGGGGGGCTAGGGGAGGG + Intronic
942511503 2:176707847-176707869 CGGGGTGGGGGGAGTGGGGAGGG - Intergenic
942609534 2:177728370-177728392 CAGGGTTGGGGGCGGGGGGAGGG + Intronic
942970829 2:181956039-181956061 CAGGGGTGGCGGCGGGGAGGTGG - Intronic
943139916 2:183969747-183969769 TGGGGTGGGGGGCGGGGAGAGGG - Intergenic
944148983 2:196537305-196537327 CAGGGTGGGAGGTGGGAAGATGG + Intronic
944297268 2:198080522-198080544 CAGGTTGGGAGGAGGGGAGATGG - Intronic
945977672 2:216283419-216283441 CACGGTGGGCGGCGTGGGGCAGG - Intronic
946039186 2:216769342-216769364 AGGGGTGGGGGGCTTGGAGAGGG - Intergenic
946483579 2:220079345-220079367 CAGGGTGGTAGGCATGGGGAGGG + Intergenic
946661339 2:222003250-222003272 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
946673914 2:222136731-222136753 GAGGGAGGGAGGGGTGGAGAGGG + Intergenic
946707223 2:222470115-222470137 CGGGGTGGGGGGCAAGGAGAGGG + Intronic
946993247 2:225359913-225359935 CAGGGTGGGAGGTGTGCAGAGGG - Intergenic
947669856 2:231929265-231929287 CAGGGTGGGCTTCCTGGAGAAGG + Intergenic
947712968 2:232326282-232326304 CAGGGTGGGTGGGGTAGGGAAGG - Intronic
947732651 2:232439738-232439760 CAGGGTGGGTGGGGTAGGGAAGG - Intergenic
947745106 2:232503330-232503352 CTGGGCGGGCGGCGTGGGGGAGG + Intergenic
947831412 2:233144328-233144350 AAGAGTGGGAGGGGTGGAGATGG + Intronic
948367136 2:237464015-237464037 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
948370460 2:237486431-237486453 CAGGCCGGGCGGACTGGAGACGG + Intronic
1168777770 20:462339-462361 CTGGGACGGCGGCGCGGAGAAGG - Exonic
1169536855 20:6553822-6553844 GAGGGTGGGGGGTGGGGAGAGGG - Intergenic
1169673886 20:8132798-8132820 CAGGGCGGGCGTCGTGGGGGTGG + Intronic
1170732562 20:18987378-18987400 GAGGGAGTGGGGCGTGGAGAAGG - Intergenic
1171756131 20:29111544-29111566 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
1171882033 20:30624674-30624696 CAGGGTGGGGGGCTAGGAGAGGG + Intergenic
1172881430 20:38202356-38202378 CAGGGTGGGCTTCCTGGAGGTGG + Intergenic
1173996686 20:47344049-47344071 CGGGGTGGAGGGGGTGGAGACGG - Intronic
1174468826 20:50739867-50739889 AAGGGTGGGGGGAGGGGAGAAGG + Intronic
1175696309 20:61105688-61105710 CAGGGTGGGGGCTGTGCAGAGGG + Intergenic
1175727940 20:61332241-61332263 CAGGGTGGGCGGAGCGGTGACGG + Intronic
1175891862 20:62319269-62319291 CAGGGTGGGCCAGGCGGAGAGGG - Intronic
1176119164 20:63446325-63446347 CAGGGTGGGCGCCATGGCAACGG - Intronic
1176169469 20:63690458-63690480 CTGGGTGGGCGGTGTGGGGGTGG + Intronic
1176266491 20:64212171-64212193 CAGGGTGGGGGCCGTGGTGGGGG + Intronic
1176266504 20:64212195-64212217 CAGGGTGGGGGCCGTGGTGGGGG + Intronic
1176266517 20:64212219-64212241 CAGGGTGGGGGCCGTGGTGGGGG + Intronic
1176266530 20:64212243-64212265 CAGGGTGGGGGCCGTGGTGGGGG + Intronic
1176602369 21:8805325-8805347 CAGCGTGGGGGGCTAGGAGAGGG + Intergenic
1176988433 21:15464789-15464811 TGGGGTGGGGGGCGAGGAGAGGG + Intergenic
1177348122 21:19900101-19900123 CAGGGAGGCCGGCGGGGGGAAGG - Intergenic
1177544701 21:22541331-22541353 GAGGGTGGAGGGCGAGGAGAAGG + Intergenic
1177555881 21:22687968-22687990 CGGGGTGGCGGGCGGGGAGAGGG + Intergenic
1177648365 21:23928720-23928742 GAGGGTGGGGGGCAAGGAGAGGG + Intergenic
1178422232 21:32451996-32452018 CAGGGTGCCCTGCGTAGAGAAGG - Intronic
1178610754 21:34077044-34077066 CAGGGGGGGCAGGGTGGAGGTGG - Intronic
1179419169 21:41222353-41222375 CAGGGTCAGCTTCGTGGAGAAGG + Intronic
1179481959 21:41684292-41684314 CAGGATGTGCTGCGTGGAAAAGG + Intergenic
1179543706 21:42100773-42100795 CAGGGTTGGTGGGGTGGGGAGGG - Intronic
1180067672 21:45420737-45420759 CAGGGAAGGCAGCCTGGAGAAGG + Intronic
1180344655 22:11696878-11696900 CAGCGTGGGGGGCTAGGAGAGGG + Intergenic
1180364835 22:11929629-11929651 CAGGGTGGGGGGCTAGGAGAGGG - Intergenic
1180477778 22:15727353-15727375 CAGCGTGGGGGGCTAGGAGAGGG - Intergenic
1180559363 22:16602407-16602429 CCGGGCGGGCGGCGCGGAGCGGG - Intergenic
1180637897 22:17275485-17275507 CGGGGAGGGCGGCGTGGGGGCGG - Intergenic
1181467402 22:23117595-23117617 CAGTGGGTGTGGCGTGGAGAGGG + Intronic
1181518498 22:23432040-23432062 CAGGGCGGGGGGCCTGGAGATGG + Intergenic
1181530517 22:23514536-23514558 CTGGGTGGGCAGAGGGGAGAGGG - Intergenic
1181589791 22:23876974-23876996 CAGGCTGGGTGTCGTGGAGTGGG + Intronic
1181673215 22:24435707-24435729 GAGGGTTGGAGGCGTGGGGAGGG + Intronic
1183072902 22:35408655-35408677 CAGGGTGAGTAGGGTGGAGAAGG + Intronic
1183080531 22:35452976-35452998 GAGGCTGGGAGGCATGGAGAGGG + Intergenic
1183528238 22:38336660-38336682 TAGAGTGGGCTGCGAGGAGAAGG - Intronic
1183958942 22:41399348-41399370 CAGGGTTGGGGGTGGGGAGAAGG - Intergenic
1184233676 22:43171745-43171767 CAGTGTGGGCGGGGTGGGGTCGG + Intronic
1184272745 22:43393910-43393932 CAGGGTGGGCTTCTTGGAGGAGG + Intergenic
1184400930 22:44274053-44274075 CAGGGTGGGTGGGGGGGAGGGGG - Intronic
1184445604 22:44545171-44545193 CCGGGTGAGCTGGGTGGAGATGG - Intergenic
1184683642 22:46086120-46086142 AAGCCTGGGCGGCGTGGAGACGG + Intronic
1184760760 22:46542774-46542796 CAGAGTGCACAGCGTGGAGATGG + Intergenic
1185326095 22:50226551-50226573 CAGGGTGGGGGGTGTGGAGTGGG + Intronic
1185338725 22:50282372-50282394 CAGGGTGGGCGGGGACGGGAGGG - Intronic
1185367934 22:50445522-50445544 CAGGGTAGGCGGCGAGAACAAGG - Exonic
949549015 3:5096821-5096843 AAGGGTGGGGGGCGGGGAGGGGG + Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950886499 3:16366992-16367014 CAGGGTGGGAGGCATGGGGAGGG + Intronic
951492294 3:23284998-23285020 TGGGGTGGGGGGAGTGGAGATGG - Intronic
951585358 3:24209675-24209697 TAGGGTGGGCGGAGCGGGGAGGG + Intronic
951611187 3:24494593-24494615 CAGGGTGGGCGGGATGGTGACGG - Intronic
952849930 3:37719545-37719567 CAGGGTGGGTGGAGGGGACATGG - Intronic
953001557 3:38938230-38938252 TGGGGTGGGCGGAGTGGGGAGGG + Intronic
953154198 3:40354030-40354052 CAGGGTGGGAGGAGTAGAGGTGG - Intergenic
953458487 3:43062778-43062800 CAGGGTGGGGGCCGTGGCTAGGG - Intergenic
953532205 3:43748800-43748822 CAGGTTGGGCTGAGTAGAGAAGG - Intergenic
953656896 3:44861603-44861625 CCGGGTGGCCGGGATGGAGACGG + Intronic
953927201 3:46988516-46988538 CAGAGTGGAGGGTGTGGAGAAGG - Intronic
954109339 3:48425427-48425449 CAGGCTGGGCGGTGGGGAGGGGG - Intronic
954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG + Intronic
954615259 3:51966254-51966276 CAGGGTGGGGGGCTGGGAGCAGG - Intronic
954698466 3:52439829-52439851 CAGGGTGGCCAGGCTGGAGAGGG - Intronic
954912734 3:54122517-54122539 CGGGGAGGGCGGAGAGGAGAGGG - Intergenic
955466486 3:59242753-59242775 AAGGGTGGGGGGCCTGGGGAAGG + Intergenic
955837538 3:63073103-63073125 CATGGTGGGCAGGGTGAAGAAGG + Intergenic
956046534 3:65201598-65201620 CGGGGTGGGAGGCTGGGAGAGGG - Intergenic
958008992 3:87850458-87850480 TGGGGTGGGGGGAGTGGAGAGGG + Intergenic
959056695 3:101574340-101574362 CAGGGTGGGGGGAGTGGGGTGGG + Intronic
961563323 3:127746439-127746461 AAGGGAGGGCAGGGTGGAGAAGG - Intronic
961612613 3:128152971-128152993 CGGGGTGGGCGGGGGGAAGACGG - Intronic
964853827 3:161123683-161123705 CAGGGTGGGAGGCAAGGAAAGGG + Intronic
965590210 3:170356071-170356093 GTGGGGGGGCGGGGTGGAGAGGG + Intergenic
965952134 3:174322365-174322387 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
965987880 3:174778619-174778641 CAGGGTGGGGGTCTAGGAGAGGG - Intronic
966098633 3:176239062-176239084 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
966154189 3:176898472-176898494 CAGGCTGGGCCGTGTGGAGGAGG - Intergenic
966862059 3:184236118-184236140 CAGGGAGGGCGGCGTGAGGCCGG - Intronic
966962127 3:184950708-184950730 GAGGGTGGGAGGCGAGGGGAGGG - Intronic
967208665 3:187147577-187147599 CAGGCTGGGGGGCGGGGGGAGGG + Intronic
968066381 3:195761853-195761875 CAGGGGGGGCTGCGGGGAGGCGG - Intronic
968554048 4:1238393-1238415 CACAGTGGGTGGCGTGGAGTGGG - Intronic
968651341 4:1761443-1761465 CGGGGTGGGCGGGGTGGACGGGG - Intergenic
968710558 4:2113236-2113258 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
968949591 4:3683681-3683703 GAGGTGGGGCGGCGAGGAGATGG - Intergenic
969340357 4:6536629-6536651 CAGGGTGGGTGCAGTGGAGAAGG + Intronic
969376727 4:6768130-6768152 CAGGGTGGGGGGAGGGGAGCTGG - Intergenic
969976303 4:11105474-11105496 CGGGGTGGGAGGAGGGGAGAAGG + Intergenic
970181822 4:13406142-13406164 CGGGGTGGGGGGCTAGGAGAGGG - Intronic
970959013 4:21851175-21851197 CAGGGAGGGAGGAGAGGAGAGGG + Intronic
970999929 4:22310471-22310493 TGGGGTGGGCGGAGTGGGGAGGG + Intergenic
971478475 4:27093569-27093591 CAGGGTGGGGGGTGAGGGGAGGG + Intergenic
972260847 4:37407068-37407090 CAGGGTGGGGGGCTAGGGGAAGG + Intronic
973365697 4:49207132-49207154 CAGCGTGGGGGGCTAGGAGAGGG + Intergenic
973394900 4:49585322-49585344 CAGCGTGGGGGGCTAGGAGAGGG - Intergenic
975526390 4:75354883-75354905 TGGGGTGGGGGGAGTGGAGAAGG + Intergenic
976431522 4:84966993-84967015 GAGGGTGAGCGCCGCGGAGAGGG - Intergenic
977184781 4:93923556-93923578 CGGGGTGGGGGGCTAGGAGAGGG - Intergenic
977616603 4:99094078-99094100 TGGGGTGGGAGGCGGGGAGAAGG - Intergenic
978042482 4:104085063-104085085 CAGGGTGTGCGGCTGGGGGAGGG + Intergenic
979180972 4:117726617-117726639 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
981391871 4:144200308-144200330 CAGGGTTGGGGGCAGGGAGAGGG + Intergenic
981535391 4:145794588-145794610 GAGGCTGGGCGGGGTGGGGATGG + Intronic
981737666 4:147969984-147970006 CAGGGTTGGAGGGTTGGAGATGG + Intronic
981993458 4:150952654-150952676 TGGGGTGGGCGGGGTGGAGAGGG + Intronic
982652026 4:158098345-158098367 TGGGGTGGGGGGAGTGGAGAGGG + Intergenic
983158811 4:164384298-164384320 CCGGGTGGGCGCGGTGGGGATGG + Intergenic
984608173 4:181808462-181808484 CAGGTTGGGCAGCCTGGAGAAGG + Intergenic
984844538 4:184098456-184098478 CAGGGTGGGCTGCATGGGAAAGG - Intronic
984850994 4:184152358-184152380 CAGGGAGGGGGCAGTGGAGAGGG - Intronic
985235034 4:187863094-187863116 CAGGGTGGCAGTCGTGAAGACGG + Intergenic
1202763196 4_GL000008v2_random:129476-129498 CAGGGTGGGGGGCTAGGAGAGGG + Intergenic
985662188 5:1162760-1162782 CAGGGTGGGTGACGTGCAAAGGG + Intergenic
985813859 5:2111815-2111837 CGGGGAGGGCGGCGCGGAGGCGG - Intergenic
986715929 5:10523585-10523607 CAGGGTGGGAGACGTGGGAAGGG + Intergenic
986727989 5:10613941-10613963 CAGGGTTGGTGGGGTGGGGAAGG - Intronic
986799845 5:11247372-11247394 ATGGGTGGGAGGCGTGGAGTAGG - Intronic
987050712 5:14144618-14144640 CTGTGTGGGTGGCGTGGAGGTGG + Intronic
987052241 5:14157395-14157417 CAGGGAGGGAGGCGGGGAGGGGG - Intronic
987181013 5:15368483-15368505 CAGGGTGGCCAGTGTGGAGGTGG - Intergenic
987420559 5:17715373-17715395 CAGGGTAGGAGGCAAGGAGAGGG - Intergenic
988116014 5:26892003-26892025 CAAGGTGGGCGGTGTGAACAGGG - Intronic
988493161 5:31722245-31722267 CAGAGTGTGCGGTGTGGTGAGGG - Intronic
989397833 5:40977536-40977558 CAGAGAGGGCTGTGTGGAGATGG + Intronic
991217441 5:64171829-64171851 GTGGGGGGGCGGGGTGGAGAAGG - Intronic
991484356 5:67119199-67119221 GAGGGTGGGAGGAGTGGACAGGG + Intronic
991633564 5:68680771-68680793 CAGGCTGGGAGGAGTGGAGTGGG + Intergenic
991934595 5:71789412-71789434 CAGGGTGGTAGCAGTGGAGATGG + Intergenic
992624685 5:78626494-78626516 CTGGGGGTGGGGCGTGGAGAGGG - Intronic
993809515 5:92458310-92458332 CAGGGTTGGAGGCGTGGCAAGGG + Intergenic
996738442 5:126777652-126777674 CAAGGTGCGCAGCCTGGAGACGG + Exonic
997015413 5:129928187-129928209 CAGGGTGGGGGGTGGGGAGAGGG - Intronic
997114987 5:131117002-131117024 CAGGGTGGGGGGCTGGGGGAGGG - Intergenic
997450691 5:133980686-133980708 CAGGGTGGGAGGGGTGGGGTTGG - Intronic
997463500 5:134071448-134071470 GTGGGTTGGAGGCGTGGAGAAGG - Intergenic
997875519 5:137543265-137543287 TAGGGTGGGGGGAGTGGGGAGGG + Intronic
998908168 5:146929066-146929088 CAGGGTGGGCGTCATTGAGAAGG - Intronic
1001234478 5:170018162-170018184 AAGGGTGGGAGGTGTAGAGAGGG + Intronic
1001845584 5:174918091-174918113 CAGGGTGTGTGGGGTGGGGAGGG + Intergenic
1001998135 5:176178551-176178573 CAGGGTGGGAGGTATGGAGGAGG - Intergenic
1002600382 5:180351407-180351429 CAGGGTGGGGGAAGTGGGGAGGG - Intronic
1003129923 6:3386717-3386739 CAGCGTGGGAGGGGTGGAGGCGG + Intronic
1003321612 6:5057331-5057353 AAGGGTGGGCAGGGAGGAGAGGG - Intergenic
1003341734 6:5227983-5228005 CGGGGTGGGGGGCTAGGAGAGGG + Intronic
1003995586 6:11537418-11537440 GGGGGTGGGGGGCGTGGAGGCGG + Intergenic
1004422931 6:15487803-15487825 CAGGGTGGGTGGGTGGGAGAAGG - Intronic
1005057111 6:21739753-21739775 CAGGGTGGGAGGTGTTGGGAGGG + Intergenic
1006104722 6:31709847-31709869 CAGGGTGAGAGGCCTGGAAAGGG + Intronic
1006118814 6:31791823-31791845 CAGAGTGGGTGGGGTGGGGAAGG - Intronic
1006449217 6:34096364-34096386 CAGGGAGGGCTGCCTGGAGGAGG - Intronic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006902308 6:37511077-37511099 CAGGGAGGGCCTCGTGGAGAAGG - Intergenic
1006909467 6:37554821-37554843 CAGGTGGGGTGGCGGGGAGATGG + Intergenic
1007491216 6:42223590-42223612 GAGGGTGGGGGGGGTGGGGAAGG - Intergenic
1007554801 6:42756914-42756936 GAGGGTGGGGGGGGGGGAGAGGG - Intronic
1007751248 6:44073275-44073297 GAGCGTGCGCGGAGTGGAGAGGG + Intergenic
1008517323 6:52330369-52330391 AGGGGAGGGTGGCGTGGAGAGGG + Intergenic
1008529423 6:52442436-52442458 TAGGGTGGGGGGTGTGGGGAGGG - Intronic
1009341454 6:62559576-62559598 TGGGGTGGGGGGAGTGGAGAGGG + Intergenic
1010898921 6:81401519-81401541 CGGGGTGGGGGGAGTGGGGAGGG + Intergenic
1011335943 6:86259787-86259809 CAGCCTGGGAGGAGTGGAGAGGG - Intergenic
1012228429 6:96731848-96731870 CGGGGTGGGGGGCTAGGAGAGGG + Intergenic
1012543988 6:100395711-100395733 CAGGGTGGGCCTAGTGGTGAGGG - Intronic
1013999573 6:116348963-116348985 CAGGGTGGGGTGGGTGGAGGGGG + Intronic
1014069282 6:117162279-117162301 CAGAGTGGGCAGCGTGGAGACGG - Intergenic
1015244668 6:131062987-131063009 CGGGATGGGGGGCGGGGAGAGGG - Intronic
1016621725 6:146118582-146118604 CAGGGTGGGAGTAGTGGGGAGGG - Intronic
1016894876 6:149041792-149041814 AAGGGTGGTCAGCATGGAGAGGG - Intronic
1016985497 6:149891869-149891891 CGGGGTGGGGGGCTAGGAGAGGG - Intronic
1017521772 6:155208966-155208988 CGGGGTGGGCAGCGGGGAGAGGG - Intronic
1018330931 6:162727319-162727341 GAGGGGCGGCGGCGGGGAGAAGG + Intronic
1018429740 6:163713514-163713536 GAGGGTTGGGGGCGAGGAGAGGG - Intergenic
1018926010 6:168207548-168207570 CAGAGAGGGCAGTGTGGAGATGG + Intergenic
1019133262 6:169892650-169892672 CACTGTGAGCGTCGTGGAGAAGG + Intergenic
1019279883 7:194184-194206 CTGGGTGGGCACCTTGGAGAAGG + Intronic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019450095 7:1093129-1093151 CAGGGTTGGCGGGGAGGAGCTGG - Exonic
1019506062 7:1392095-1392117 CAGGGCGGGTGGAGTTGAGAAGG - Intergenic
1019600065 7:1876904-1876926 CAGGGCGGGGGGCCTGGAGATGG - Intronic
1019706620 7:2500016-2500038 CAGGGTGGGTGGGGTGGCCAGGG - Intergenic
1019812470 7:3174808-3174830 CAGGGTGGGGAGGGTGGAGTGGG - Intergenic
1019898386 7:4000564-4000586 CATGGAGAGCGGCGTGGAGACGG - Intronic
1019912157 7:4107111-4107133 CAGGGTGGGGAGGGTGGGGAGGG + Intronic
1020096807 7:5374155-5374177 CGGGGTGGGCGGTGGGGAGGCGG + Exonic
1020107369 7:5428312-5428334 CAGGGTGCGCGGCGTGGCCCGGG - Intergenic
1022088905 7:27095348-27095370 CTTGGTGGCTGGCGTGGAGAGGG + Exonic
1022100193 7:27164826-27164848 CCGGGAGGCCGGCGTGGAGGCGG + Intronic
1022410698 7:30136305-30136327 CGGGGTGGGAGGGGTGGAGTAGG + Intronic
1022715183 7:32891982-32892004 GCGGGAGGGCGGCGTGGCGAGGG - Intronic
1023277712 7:38538420-38538442 CAGGGTGGGAGGTGTGGAACTGG + Intronic
1023759714 7:43453263-43453285 CAGGGTGGGAGCAGTGGAGGTGG + Intronic
1024885251 7:54134892-54134914 GAGGGTGGGGGGCGAGGGGAGGG - Intergenic
1025881052 7:65537128-65537150 GAGGGTGGGGGGCTCGGAGAGGG + Intergenic
1025892387 7:65665487-65665509 GAGGGTGGGGGGCTCGGAGAGGG - Intergenic
1026642409 7:72139344-72139366 CAGGGTGGGCATGGTGGAGGTGG - Intronic
1026882921 7:73919060-73919082 CAGGGTGGGCTTCCTGGAGGAGG + Intergenic
1026960504 7:74404597-74404619 CACGGTGGGAGGTGAGGAGAGGG - Exonic
1026963894 7:74427096-74427118 CAGGGTTGGTGGCGGGGAGGTGG + Intergenic
1027166150 7:75835662-75835684 CAGTGGTGCCGGCGTGGAGACGG + Intergenic
1027403828 7:77836816-77836838 CGGGGTGGGGGGCTTGGGGAAGG + Intronic
1027465946 7:78514903-78514925 CAGGCTTGGGGGCCTGGAGAAGG + Intronic
1028593996 7:92528555-92528577 CAGGATGCGCAGCGGGGAGAGGG - Intergenic
1028629499 7:92919372-92919394 CGGGGTGGGGGGCTAGGAGAGGG - Intergenic
1029139753 7:98401208-98401230 CGGGGTGGGCGGGGAGGAGGCGG + Intergenic
1029588778 7:101493242-101493264 TAGAGTGGGCGGGGTGGGGAGGG - Intronic
1030363156 7:108616446-108616468 TAGGGTGGGGGGAGTGGGGAGGG + Intergenic
1030471865 7:109974711-109974733 CAGGGTGGGGGGCAAGGGGAGGG - Intergenic
1031051501 7:116950333-116950355 GAGGGAGGGAGGCGGGGAGAAGG - Intergenic
1031699594 7:124906489-124906511 TAGGGTGGGGGGAGGGGAGAGGG + Intronic
1032002203 7:128272432-128272454 CAGGGTGGGAGGCGGGGCGATGG + Intergenic
1032214899 7:129950439-129950461 CGGGGTGTGGGGGGTGGAGAGGG - Intronic
1032425579 7:131819929-131819951 CAGAGAGGGCGGTGAGGAGAGGG - Intergenic
1034535240 7:151721947-151721969 CAGGGTGGGCTGCATGGAGGAGG - Intronic
1034617879 7:152435412-152435434 CCGGGCGGGCGGCGCGGAGCGGG + Intronic
1034823042 7:154234781-154234803 CAGTATGGGCTGGGTGGAGATGG + Intronic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035552982 8:544570-544592 GAGGGTGGGCGGCGCGCAGGTGG - Intronic
1035662596 8:1359248-1359270 CAGGGAGGGCAGCGAGGAGAAGG - Intergenic
1037693380 8:21202880-21202902 AAGGGGGTGGGGCGTGGAGAGGG + Intergenic
1038227509 8:25670557-25670579 CCAGGTGGGCGGGGTGGAGGCGG + Intergenic
1038479280 8:27890677-27890699 CAGGGTGGGAGGGGTGGGAAAGG + Intronic
1038761121 8:30384792-30384814 CCGGGAGGGCGACCTGGAGAGGG - Exonic
1039454384 8:37697606-37697628 CGGGGTTGGCGGCGGGGAGCTGG + Exonic
1041664437 8:60429078-60429100 CAGGGTGGTGGCCATGGAGAAGG - Intergenic
1042119339 8:65467367-65467389 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1042134085 8:65617088-65617110 CAGGGTGGCCGCCGGGCAGAGGG - Intronic
1042769740 8:72366557-72366579 CAGGGTGGGCCTCATTGAGAAGG - Intergenic
1042812334 8:72840051-72840073 CAGGGTGGGGGGCTAGGGGAGGG - Intronic
1043028081 8:75096435-75096457 GAGGTTGGGAGGCGGGGAGAGGG - Intergenic
1043480453 8:80647357-80647379 GAGGGTGGGAGGAGAGGAGACGG + Intronic
1045193173 8:99903448-99903470 CAGGGTGGGGGGCTAGGGGAGGG + Intergenic
1046274791 8:111944643-111944665 CGGGGTGGGAGGCTAGGAGAGGG - Intergenic
1047329066 8:123868624-123868646 CAGGGAGGGCTGCTTGGAGAAGG - Intronic
1048040250 8:130720626-130720648 CAGTCTGGGCGGTGTGGAGCAGG - Intergenic
1048993234 8:139773618-139773640 CAGGGTGGGGGCTGTGGGGAAGG - Intronic
1049212547 8:141393352-141393374 GAGGGGGGCCGGCGTGGTGATGG - Intronic
1049291903 8:141807806-141807828 TAGGGTGGGCGTCCTGCAGAGGG + Intergenic
1049455010 8:142682303-142682325 CCGGGTGGGAGTCCTGGAGAGGG - Exonic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049582946 8:143421022-143421044 CAGGGAGGGCGGCGAGGAACTGG - Intronic
1049585204 8:143429806-143429828 GGTGGTGGGCGGCGTGGTGATGG + Exonic
1049691838 8:143964992-143965014 CAGGGTGGGCGGGGGGGTGGGGG - Intronic
1049711067 8:144063581-144063603 CAGGATGTGCGGCGGGGAGAAGG - Intronic
1049758404 8:144320944-144320966 CAGGGAGGGCAGGGTGGAGGGGG - Intronic
1049997780 9:1047811-1047833 GAGGGTGGGGCACGTGGAGATGG + Intergenic
1050184828 9:2962172-2962194 CAAGTGGGGTGGCGTGGAGAAGG - Intergenic
1050653651 9:7799981-7800003 CGGGGGGGGCGGCGGGGAGGAGG - Exonic
1051106620 9:13587844-13587866 CAGGGTGGGAGGAGCGGAGGAGG - Intergenic
1051658985 9:19408797-19408819 CAGGGTGGGGCGCCTGGAGGCGG - Intergenic
1051906138 9:22096879-22096901 CAAGGTGAGCGGGGTGGGGAGGG - Intergenic
1052692749 9:31836099-31836121 CAGGCTGGGAGGTGAGGAGAGGG - Intergenic
1052988865 9:34506884-34506906 CAGGCTGGGAGGGGTGGGGATGG + Intronic
1054991939 9:71337932-71337954 CAGGGTGGGGGGCCAGGGGAGGG + Intronic
1056135126 9:83623375-83623397 CAGGCTGGAGGGCGGGGAGAGGG - Intronic
1056186537 9:84140563-84140585 CGGCGTGGAGGGCGTGGAGACGG - Intergenic
1056332863 9:85536060-85536082 AAGGGTGGCAGGCGGGGAGATGG - Intergenic
1056643476 9:88389197-88389219 CACGGAGGGCGGCGAAGAGACGG - Intronic
1056971168 9:91204963-91204985 CAGGGTGGGGGGAGGGGGGAGGG + Intergenic
1057185538 9:93055629-93055651 CAGGGAGGGCTCCATGGAGAAGG + Intergenic
1057704643 9:97388209-97388231 CAGGGTGGCCACCCTGGAGATGG - Intergenic
1057853718 9:98585491-98585513 TAGGGTGGGGGGAGTGGGGAGGG + Intronic
1058991284 9:110256754-110256776 GACGGTGGGAGGCGGGGAGACGG + Intergenic
1059404717 9:114092587-114092609 CAGGGTGGGGGCCGGGCAGATGG + Exonic
1059458378 9:114413906-114413928 CAGGGAGGGAGGCGTGGAGCAGG - Intronic
1059651359 9:116319005-116319027 TGGGGTGGGAGGCGGGGAGAGGG - Intronic
1059758368 9:117315402-117315424 CATGGTTGGCGGCTGGGAGAGGG - Intronic
1059780412 9:117520066-117520088 CAGGCTGGGTGGCTTGGGGAGGG + Intergenic
1059912672 9:119063542-119063564 TGGGGTGGGCGGAGTGGGGAGGG - Intergenic
1060555327 9:124504872-124504894 CAGGATGGGGGGCGGGGAGGCGG - Intronic
1060884527 9:127141045-127141067 CCAGGTGGGTGACGTGGAGAGGG + Intronic
1061369538 9:130190761-130190783 CAGGGGTGGAGGAGTGGAGATGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061916901 9:133760084-133760106 CAGGGAGGGCTGCGTGAGGAGGG + Intergenic
1062162831 9:135089136-135089158 CAGGGAGGGCGGCCTCAAGAGGG - Intronic
1062165101 9:135103667-135103689 CAGGGTGGGCGGGATGAAGTGGG + Intronic
1062424714 9:136500794-136500816 CAGCGGGGGCGGCCTGGAGACGG - Exonic
1062472579 9:136712850-136712872 CGGGGTGGGCAGCGGGGAGGGGG + Intronic
1203435673 Un_GL000195v1:134673-134695 CATGGTGGGGGATGTGGAGAAGG - Intergenic
1203532215 Un_GL000213v1:156795-156817 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1203543960 Un_KI270743v1:114357-114379 CAGGGTGGGGGGCTAGGAGAGGG + Intergenic
1185749605 X:2600193-2600215 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1185914175 X:4016991-4017013 AAGGGTGGGAGGGTTGGAGAGGG - Intergenic
1186442666 X:9599459-9599481 CAGGGTGGGCTTGGTGGAGGAGG + Intronic
1186981911 X:14966128-14966150 CGGGGTGGGGGGCGAGGGGAGGG - Intergenic
1188268025 X:28102635-28102657 TAGTGTGGGAGGCGGGGAGAGGG - Intergenic
1189248559 X:39582040-39582062 CAGGGTGGGGGCAGTGGAGCAGG + Intergenic
1189325581 X:40109083-40109105 CTGGGAGGGCGGCGGGGAGGAGG + Intronic
1190057957 X:47193002-47193024 AATGGAGGGAGGCGTGGAGAGGG + Intronic
1191024705 X:55900984-55901006 CAGGGTGGGGGTCTAGGAGAGGG + Intergenic
1191759682 X:64632926-64632948 TAGGGTGGGGGGAGTGGAGAGGG - Intergenic
1191798674 X:65053248-65053270 CGGGGTGGGGGGAGTGGGGACGG - Intergenic
1192124178 X:68486186-68486208 CAGGGTGGGGGGAGGGGGGAGGG - Intergenic
1192244391 X:69360669-69360691 CAGGGTGGTGGCAGTGGAGATGG + Intergenic
1192510516 X:71718166-71718188 CAGCCTGGGCTGCGGGGAGACGG + Intergenic
1192510713 X:71719105-71719127 CAGCCTGGGCTGCGGGGAGACGG - Intergenic
1192515984 X:71762448-71762470 CAGCCTGGGCTGCGGGGAGACGG + Intergenic
1192516181 X:71763387-71763409 CAGCCTGGGCTGCGGGGAGACGG - Intergenic
1192821457 X:74649969-74649991 CTGGGTGGGGGGCGAGGAGAGGG - Intergenic
1193288549 X:79743215-79743237 TGGGGTGGGGGGAGTGGAGAGGG - Intergenic
1194421150 X:93673923-93673945 CAGGGTGGGCGGATGGGAGAAGG - Intergenic
1194614115 X:96080054-96080076 CGGGGTGGGGGGAGGGGAGAGGG + Intergenic
1195310710 X:103629453-103629475 CAGGGTAGGGGGCGGGGAGTGGG - Intronic
1196332210 X:114485685-114485707 GAGGGTGGGCGGGGTGAGGAGGG - Intergenic
1197415130 X:126165379-126165401 CAGGGTGGGCAGCTGGTAGATGG + Exonic
1198124319 X:133627164-133627186 CAGGGTGGGGGGAGGGGGGAGGG + Intronic
1198189077 X:134285869-134285891 CAGGGTGGGGGCCGGGCAGAGGG + Intergenic
1198600440 X:138279150-138279172 GAGGGTGGGTGGCTGGGAGAGGG - Intergenic
1200002981 X:153071776-153071798 CCGGATGGGCAGCGGGGAGATGG + Intergenic
1200004742 X:153078233-153078255 CCGGATGGGCAGCGGGGAGATGG - Intergenic
1200099984 X:153685508-153685530 CAGGGTGGCCGACGTGGGGAGGG + Intronic
1201796354 Y:17900627-17900649 TGGGGTGGGGGGCGTGGGGAGGG + Intergenic
1201805201 Y:18005358-18005380 TGGGGTGGGGGGCGTGGGGAGGG - Intergenic
1202357750 Y:24069693-24069715 TGGGGTGGGGGGCGTGGGGAGGG + Intergenic
1202513028 Y:25600420-25600442 TGGGGTGGGGGGCGTGGGGAGGG - Intergenic
1202574803 Y:26312259-26312281 TGGGGTGGGGGGCGTGGGGAAGG + Intergenic