ID: 954288480

View in Genome Browser
Species Human (GRCh38)
Location 3:49636389-49636411
Sequence GTGTGTATGGGGAGGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737
Summary {0: 1, 1: 0, 2: 9, 3: 77, 4: 650}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954288472_954288480 7 Left 954288472 3:49636359-49636381 CCTGGAGAGGGTTACTGGTGACT 0: 1
1: 0
2: 0
3: 9
4: 117
Right 954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG 0: 1
1: 0
2: 9
3: 77
4: 650
954288470_954288480 12 Left 954288470 3:49636354-49636376 CCTCTCCTGGAGAGGGTTACTGG 0: 1
1: 0
2: 0
3: 16
4: 140
Right 954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG 0: 1
1: 0
2: 9
3: 77
4: 650
954288466_954288480 24 Left 954288466 3:49636342-49636364 CCAAGGGTCCAGCCTCTCCTGGA 0: 1
1: 0
2: 5
3: 36
4: 335
Right 954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG 0: 1
1: 0
2: 9
3: 77
4: 650
954288469_954288480 16 Left 954288469 3:49636350-49636372 CCAGCCTCTCCTGGAGAGGGTTA 0: 1
1: 0
2: 3
3: 27
4: 164
Right 954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG 0: 1
1: 0
2: 9
3: 77
4: 650

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954288480 Original CRISPR GTGTGTATGGGGAGGGTGCA GGG Intronic
900862702 1:5244520-5244542 GTGTGCATGGGTAGGGGTCAAGG + Intergenic
900880576 1:5378286-5378308 GAGTGTGTGGGGAGTCTGCAGGG - Intergenic
902218531 1:14950071-14950093 GGGTGGGTGTGGAGGGTGCAGGG - Intronic
902489580 1:16771465-16771487 GTGTGCAGGGGAAGGGTGAAGGG - Intronic
902538379 1:17135125-17135147 GTGTGCATGGAGGAGGTGCATGG - Intergenic
902538974 1:17138925-17138947 GAGTGGATGGAGAGGGTGGAAGG + Intergenic
903188253 1:21641463-21641485 GTACGGATGGGGTGGGTGCAAGG - Intronic
904043096 1:27595319-27595341 GTGTGTCTGGGGAGGTGTCAGGG + Intronic
904200929 1:28818598-28818620 GTGAGGATGGAGAGGCTGCAGGG + Intronic
904703663 1:32374670-32374692 GTGAGTTTGGGGCAGGTGCAGGG - Intronic
905447976 1:38039596-38039618 GTGTGTATGTGTTGGGGGCAGGG + Intergenic
905890912 1:41517820-41517842 GTGTGTACGGGGATGGGGCTGGG + Intronic
906098848 1:43243128-43243150 GAGTGTATGGGGAATGGGCAGGG - Intronic
907308835 1:53528020-53528042 GAGGGTAGGGAGAGGGTGCAGGG + Intronic
907527740 1:55063602-55063624 GGGTGTCTGGGGAGGGTCAAGGG + Exonic
907637221 1:56147641-56147663 GTGTGTGTGGGTGGGGTGGAGGG + Intergenic
907810318 1:57863266-57863288 GTGTGTATGGGGGATGTGTAAGG + Intronic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
908855067 1:68417581-68417603 GTGTGTTTGGGGAGGGTTAATGG + Intergenic
908878230 1:68701713-68701735 GAGTTGGTGGGGAGGGTGCAGGG - Intergenic
909115021 1:71522714-71522736 GTGTGTAAGGGGGGGGTAGAGGG - Intronic
910366837 1:86474970-86474992 GTGTGTTTGGGGATGGGGCTTGG - Intronic
910631971 1:89364649-89364671 GTGTGTGTGGGGAGGGGGTGGGG + Intronic
912465033 1:109866535-109866557 GTGTGTATGGGGATGGGGGTGGG + Intergenic
913064358 1:115236606-115236628 GTGTGTATGGCCAGTGTGAAGGG + Intergenic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
915925855 1:160019074-160019096 GTGTGTATGGGGGTGGCGGATGG - Intergenic
917002602 1:170375944-170375966 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
917121811 1:171651337-171651359 GTGTGTGTGGGGGGGGTGCGGGG - Intronic
917414145 1:174790777-174790799 GTGTGTGTGGGCAGGGGGCGGGG + Intronic
917450440 1:175143531-175143553 GTGTGTGTTAGGAGGGTGCATGG + Intronic
917693156 1:177489883-177489905 GTGTGTGTGTGGGGGGGGCAGGG - Intergenic
917956213 1:180101669-180101691 ATGTGTGTGTGGAGGGGGCAGGG - Intronic
919131925 1:193461911-193461933 GAGTGAAAGGGGAGTGTGCATGG + Intergenic
919770463 1:201155048-201155070 GTGTGCATGGCCAGGATGCAGGG + Intronic
919809015 1:201397536-201397558 GTGTGTGTGGGGAGGCAGCTGGG - Intronic
919983093 1:202654636-202654658 GTGTGTGTTGGGCGGGGGCAGGG - Intronic
920002975 1:202811937-202811959 ATATGTATGGGGAGAGTGCAGGG - Intergenic
920232710 1:204481145-204481167 GTGTGTATGGGGAGGGTGTGAGG - Intronic
920689782 1:208137141-208137163 GTGTGTTTGGAGTGGGTGCTGGG - Intronic
921712133 1:218383522-218383544 GTGTGTATGTGGGGGGTGTGGGG + Intronic
922764880 1:228151490-228151512 GTCTGAATAGGGAGGGTTCATGG + Intronic
922866216 1:228863535-228863557 CTCTGCCTGGGGAGGGTGCAAGG + Intergenic
923530857 1:234811060-234811082 GTGTGCAGGGGAAGGGTGAAGGG + Intergenic
923546046 1:234923949-234923971 GTGTTCATGGGGGTGGTGCATGG - Intergenic
923658012 1:235935079-235935101 GTGTGTGTGGGGGGGGTGTGGGG + Intergenic
923995250 1:239486424-239486446 GTGTGTATGGGCAGGCATCAGGG - Intronic
924332374 1:242953148-242953170 GTGTGTGTGGGTAGGGTGTGTGG - Intergenic
1062786533 10:269861-269883 GTGTGCTTGGGGCGGCTGCAGGG - Intergenic
1062831465 10:608486-608508 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1063022547 10:2144249-2144271 GTGTGTCTGGGGTGGGGGCAGGG - Intergenic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1064037653 10:11927940-11927962 GTGTAGATGGGGAGTGTGCTGGG - Intronic
1064876554 10:20001467-20001489 GTGTGCGTGTGGAGGGGGCAAGG + Intronic
1064906151 10:20348025-20348047 GTGTGGTGGGGGAGGGGGCAGGG - Intergenic
1065021669 10:21507100-21507122 GTGTGTATGTGGGGGGTGGGAGG - Intergenic
1065791709 10:29266304-29266326 GTGTGTATGTGGGCGGTGCGGGG - Intergenic
1066651856 10:37664019-37664041 GTGTGTAGAAGGAAGGTGCAAGG - Intergenic
1067035616 10:42914318-42914340 GTGTGTAGAGGGAAGGTGCAAGG - Intergenic
1067115713 10:43434276-43434298 GTGATTTTGGGGAGGGTCCAAGG + Intergenic
1067429591 10:46234309-46234331 GTGTGCATTGGGACTGTGCAAGG + Intergenic
1067516157 10:46946622-46946644 GTGAGGATGAGGAGGCTGCAGGG + Exonic
1067646090 10:48105188-48105210 GTGAGGATGAGGAGGCTGCAGGG - Intergenic
1068849378 10:61719472-61719494 GTGTGTGTGTGGAGGGTGTGGGG - Intronic
1070039707 10:72763907-72763929 GTGTGGAAGGGGAGTGTGAAGGG - Intronic
1070453219 10:76582580-76582602 GTGTGCATGGGGAGGGCCCATGG - Intergenic
1070891012 10:79942242-79942264 GTGGGGATTGGGAGGGTGCATGG + Intronic
1071336167 10:84601888-84601910 GGGTGTGTGGGGAGTGTTCACGG - Intergenic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072256030 10:93621135-93621157 GTGTGTGTGGGGAGAGTGGCGGG - Intronic
1072426460 10:95334655-95334677 GTGTGTATAGGAAGTGCGCACGG - Intronic
1072740092 10:97904046-97904068 GAGTGTTTGTGGAGTGTGCAGGG - Intronic
1072740253 10:97904851-97904873 GAGTGTTTGTGGAGTGTGCAGGG - Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073577981 10:104641202-104641224 GTGTGTAGGGGGAGTGGGGAGGG - Exonic
1074052262 10:109890775-109890797 GTGTGTATGTGGAGGGTGTGTGG + Intronic
1075677872 10:124308736-124308758 GTGTGTATATGGAGGGGGTAGGG - Intergenic
1076120516 10:127933244-127933266 GTGTGTATGGAGGGGGTGGTAGG - Intronic
1076178960 10:128391151-128391173 GTGTGTATGTCCAGGGTGAAAGG + Intergenic
1076281408 10:129249661-129249683 GTGTGCATGGGGGGTGTGCATGG + Intergenic
1076281413 10:129249674-129249696 GTGTGCATGGGGGGTGTGCATGG + Intergenic
1076292535 10:129358152-129358174 GTGTGTGTGGGGGGGGTGGGGGG + Intergenic
1076613191 10:131738955-131738977 GGGTGGGTGGGGAGGGAGCATGG - Intergenic
1076693599 10:132236439-132236461 GTGTGTGTGGGGCCCGTGCACGG - Intronic
1076901242 10:133339121-133339143 GTGTGTCTGGGGGGGGTGTGTGG - Intronic
1077020122 11:413678-413700 GTTTGCAGGGAGAGGGTGCAGGG - Intronic
1077020242 11:414066-414088 GTGGGGAGGGAGAGGGTGCAGGG - Intronic
1077020360 11:414415-414437 GTGTGTATGTGATGTGTGCAGGG - Intronic
1077293621 11:1813377-1813399 GTGTGTATATAGAGGGTTCAGGG - Intergenic
1078088921 11:8251726-8251748 GTGTGTATGGGGGGGGTATAGGG + Intronic
1078173439 11:8949032-8949054 GTGTGTGTGTTGAGGGTACAGGG - Intronic
1078429745 11:11280007-11280029 GTGTGTGTTGGGAGGGGACATGG + Intronic
1079125168 11:17713952-17713974 GTGTGCAGGGGGTGGGGGCAGGG - Intergenic
1079322766 11:19465223-19465245 GCGTGGATGGGAAGGGTTCAGGG + Intronic
1080569729 11:33544993-33545015 GTGTGAATGGGAAGGCTGTATGG - Exonic
1081456043 11:43223908-43223930 GTGTGGATGTGGAAGCTGCAAGG - Intergenic
1081704704 11:45175040-45175062 GTGTGTGGGGGCAGGGTGTATGG - Intronic
1081842283 11:46211413-46211435 TTGTGTGTGGTGGGGGTGCAGGG - Intergenic
1083181306 11:60987582-60987604 GTGTGTATGGTGGGGGGGTATGG + Intronic
1083412815 11:62505726-62505748 GTGTGTCGGGGGAGGCAGCAGGG - Intronic
1083420886 11:62552600-62552622 GTGTGTATGGGGTGGAGGCGGGG - Intronic
1084090734 11:66878129-66878151 GTGAGGAGGGGGAGGGTGCTAGG - Intronic
1084128919 11:67118874-67118896 GTGTGTGGGGGGAGGGCGCGCGG + Intergenic
1084451406 11:69241016-69241038 GTGTGTGTGTGGTGGGGGCAGGG + Intergenic
1084469723 11:69351892-69351914 GTGTGTGTGGTGTGTGTGCATGG + Intronic
1084680496 11:70663676-70663698 CTGTCTCTGGGGAGGGGGCAAGG - Intronic
1085058024 11:73419259-73419281 GTGTGTATGAGGAGTCTTCAGGG - Intronic
1085278292 11:75314045-75314067 GTGTGTGGGGGCAGGGAGCATGG - Intronic
1085645197 11:78218268-78218290 GTGTGGATGGGGGTGATGCAGGG - Exonic
1085745681 11:79112463-79112485 GTGTTTATGGGAAGGGGGCTGGG + Intronic
1086018679 11:82199107-82199129 GTTTGTATGTGGAAGGTGCTGGG + Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087400138 11:97654682-97654704 ATGTGTATGTGGTGGGAGCAGGG + Intergenic
1089272891 11:117314462-117314484 GTGTGTTTGGGGTGGGCGGAGGG - Intronic
1089294261 11:117458525-117458547 GTGTGTATGTAGGGGGTGCGGGG + Intronic
1089585843 11:119508988-119509010 GTGTGTGTGTGGAGTGTGGAGGG + Intergenic
1089613854 11:119684405-119684427 GTGTGTCTGAGGTGGGTGCTGGG + Intronic
1089620032 11:119716910-119716932 GTGTGTATGAGGAAGGTTTATGG - Intronic
1089808468 11:121112974-121112996 CTGTGGGTGGGGAGGGCGCAGGG + Intronic
1090679483 11:129038287-129038309 GTGTGTATGGTGATGAGGCAGGG - Intronic
1091055721 11:132417112-132417134 GTGGGCATGGGGTGGGGGCAAGG - Exonic
1091087161 11:132732634-132732656 GTGTGTAAGGGGAGGCTTCAGGG + Intronic
1092261814 12:6956883-6956905 CTGTGTAGGGGGAGCCTGCAGGG - Intronic
1092394089 12:8109828-8109850 GTGTGTAATGGGATGGTGTAAGG + Intergenic
1092696632 12:11178359-11178381 GTGGGGATGGGGAGGGTCAAGGG + Intergenic
1093643435 12:21554669-21554691 GTGTGTTAGGGAAAGGTGCAAGG + Intronic
1095085797 12:38056531-38056553 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1095130977 12:38541933-38541955 GTGTGTATGTGTTGGGTGGATGG + Intergenic
1095302071 12:40596643-40596665 GTGACTATGAGGAGGGTACAGGG - Intergenic
1095476473 12:42590929-42590951 GTGTGTGGGGGGAGTGTGGAGGG + Intergenic
1096162183 12:49387787-49387809 GGGAGTGTGGGGAGGGAGCAGGG + Intronic
1096525332 12:52206971-52206993 GTGTGTGTGTGTAGGGTGGATGG + Intergenic
1096913796 12:55010614-55010636 GTGTGTTTGCGGAGAGGGCAGGG + Intergenic
1097222997 12:57461451-57461473 GTGTGTATGGGGAGGAGGAGGGG - Intronic
1097234299 12:57529032-57529054 GGGTGGATGGGTAGGGTGTAAGG + Intronic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1099215969 12:79854211-79854233 GTGTGTGTGGCGGGGGGGCAGGG + Intronic
1099793721 12:87369054-87369076 GTGTGTATGTGGAGGGCGGGGGG + Intergenic
1099953752 12:89332391-89332413 TTTTGTAGGGGGAGGGGGCAGGG - Intergenic
1100313017 12:93414766-93414788 GTGGGGATAGGGAGTGTGCAGGG - Intronic
1100418625 12:94406481-94406503 GTGTGTGTGTGGTGGGGGCAGGG + Intronic
1100480231 12:94970781-94970803 TTGTGTCTGGGTAGGGTGAAAGG - Intronic
1101421907 12:104557431-104557453 GTGTGTATGGTCAGAGTGCATGG + Intronic
1102867922 12:116388948-116388970 GTGTGTGGCGGGAGGGTGGAGGG - Intergenic
1102932979 12:116876625-116876647 GCGTGCCTGGGGAGGGGGCAGGG - Intronic
1103007500 12:117433368-117433390 GTGTGTATGGAGTGTGTGTAAGG - Intronic
1103606865 12:122093298-122093320 GTGTGTGTGGTGTGGGTGCGTGG + Intronic
1103946838 12:124531758-124531780 GTGTGTAGGGGGAGGTTTTAGGG - Intronic
1104463695 12:128973896-128973918 GTGTGTAGGGGGTGTGTGTAGGG + Intronic
1104463707 12:128973943-128973965 GTGTGTGTGGGGGGGGCGCTTGG + Intronic
1104949621 12:132433579-132433601 GTGTGCATATGGTGGGTGCAGGG + Intergenic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105700673 13:22933505-22933527 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1105853468 13:24355660-24355682 GTGTGTGTGGGGAGCGGGGATGG - Intergenic
1105891010 13:24682051-24682073 GTGTGTATGGTGTGTGTGTATGG + Intronic
1106002600 13:25738337-25738359 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1106086873 13:26550731-26550753 GTGGGGAAGGGGAGGGTGCCTGG - Intergenic
1107096620 13:36544535-36544557 GTGTGTATGGTGAATGTGCATGG + Intergenic
1107200046 13:37704202-37704224 GGGGGAATGGGGAGGGTGCAAGG + Intronic
1108280701 13:48858478-48858500 GTGCGTATGGGGAGAATTCATGG + Intergenic
1108411583 13:50153822-50153844 AAGAGGATGGGGAGGGTGCATGG + Intronic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108586102 13:51871114-51871136 GTGTGGGTGGGGATGGTCCAAGG - Intergenic
1108700643 13:52941255-52941277 TTGTGCATGGGGGTGGTGCAGGG + Intergenic
1109301244 13:60592405-60592427 CTCTGTATGGGGAGGACGCAGGG - Intergenic
1111764747 13:92514140-92514162 GTGTGTGTGGGGCGGGGGCGGGG - Intronic
1112186848 13:97136021-97136043 ATGCGTGTGGGGAGGGTGAAGGG - Intergenic
1112308317 13:98295362-98295384 GTGGATATGGGGAGGATGAAGGG + Intronic
1112503159 13:99957373-99957395 GTGTGTGTGGGGGGGGTGGTAGG + Intergenic
1112657788 13:101470676-101470698 GTGTGTGTGGGAGGGGTGGAGGG + Intronic
1113041551 13:106108536-106108558 GTGTGCATGGGGTGGGGCCAAGG - Intergenic
1113319219 13:109215576-109215598 GTGAGCAGGAGGAGGGTGCAGGG - Intergenic
1113939757 13:114012451-114012473 GAGTGTGTGTGGACGGTGCATGG - Intronic
1113939772 13:114012544-114012566 GAATGCATGGGGAGTGTGCATGG - Intronic
1113966605 13:114156272-114156294 GCGTGGATGGGGTGGGTGCTGGG + Intergenic
1113966665 13:114156402-114156424 GCGTGGATGGGGTGGGTGCTGGG + Intergenic
1114642965 14:24236881-24236903 GGGTGGATGGGTAGGGAGCAGGG + Intronic
1115566386 14:34629051-34629073 GTGTGTATGTGGGGGGTGAGTGG + Intronic
1116512459 14:45763668-45763690 GTGCATATGTGGAGGGTGAAGGG + Intergenic
1117831136 14:59752070-59752092 GTGTGGATGTGGAGGTTGGAAGG - Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1118709368 14:68507063-68507085 GTGTGTATGTGGAGGGGGTGGGG + Intronic
1118755876 14:68843491-68843513 GTGTGTTTGGGGAGGGAGTAGGG - Intergenic
1118765724 14:68908177-68908199 GTGTGTATGGGGTGGGGGTGGGG + Intronic
1118835365 14:69474072-69474094 GAGTGGGTGGGGAGGGTGCCTGG - Intergenic
1119703546 14:76770620-76770642 GGGTGCAGGGGCAGGGTGCAGGG - Intronic
1119903933 14:78284700-78284722 GTGTGTTTGGGGAGGTTCTACGG - Intronic
1120663792 14:87281441-87281463 GTGTGTATGTGAAGGCTGAATGG - Intergenic
1121110177 14:91307317-91307339 GCGAGTATGGGGAGTGTGGAGGG - Intronic
1121472154 14:94164402-94164424 CGGTGTATGTGGAAGGTGCAGGG + Intronic
1122122948 14:99564304-99564326 GTGGGTCTGGGGAGGGTGCAAGG - Intronic
1122136333 14:99635081-99635103 GTGGGTTTGGGGTGGGGGCAGGG + Intergenic
1122316587 14:100828886-100828908 GTGGGTCTGGGGGTGGTGCAAGG - Intergenic
1122396678 14:101437721-101437743 GTGTGTAAGGGGACAGGGCAGGG - Intergenic
1122452565 14:101822075-101822097 GTGTGTGTGGGGGGGGGGCAGGG - Intronic
1122657395 14:103271392-103271414 GTGTGTGTGGGGGGGGTGTGGGG - Intergenic
1122826822 14:104374610-104374632 GTGGGTATGGGGAGGCCGGAGGG + Intergenic
1122979810 14:105186409-105186431 GTGTGTATGGGGTGTGTGTGTGG + Intergenic
1122979850 14:105186545-105186567 GTGTGTATGGGGTGTGTGTGTGG + Intergenic
1122979890 14:105186681-105186703 GTGTGTATGGGGTGTGTGTGTGG + Intergenic
1123070954 14:105642287-105642309 GTGTGTGTGTGGCGGCTGCAGGG + Intergenic
1123075917 14:105667328-105667350 GTGTGTGTGTGGCGGCTGCAGGG + Intergenic
1123090618 14:105740557-105740579 GTGTGTGTGTGGCGGCTGCAGGG + Intergenic
1123096250 14:105768321-105768343 GTGTGTGTGTGGCGGCTGCAGGG + Intergenic
1123971976 15:25515839-25515861 CTGTGAATGGGGAGGGTGATGGG + Intergenic
1124121564 15:26893260-26893282 GTGTGTATGGTGTGTGTGTATGG + Intronic
1124168513 15:27351088-27351110 GTGTGTATGGTGTGTGTGTATGG + Intronic
1124168514 15:27351101-27351123 GTGTGTATGGTGTGTGTGTATGG + Intronic
1124168529 15:27351370-27351392 GTGTGTATGGTGTGTGTGTATGG + Intronic
1124168540 15:27351572-27351594 GTGTGTATGGTGTGTGTGTATGG + Intronic
1124630708 15:31335471-31335493 GTGTGTATGGTGGCGGGGCAGGG + Intronic
1126109760 15:45168365-45168387 GTGTGTATAGGGAGCATACAGGG + Intronic
1126589416 15:50324333-50324355 GTGTGTAGGGAGATGGTGCTTGG - Intronic
1126962130 15:54008735-54008757 GTTTGTATGGGCTGGGTGTAAGG + Intergenic
1127221255 15:56883960-56883982 GTGGGATTGGGGAGGGTGCAGGG - Intronic
1127283012 15:57508186-57508208 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1127304144 15:57685506-57685528 GTGTGTCGGGGGAGGGTGGGGGG + Intronic
1127387447 15:58477988-58478010 GTGTGCATGGGGTGGGTATAGGG - Intronic
1127670228 15:61187941-61187963 GTGTGTTAGGGGAGGGTTGAGGG - Intronic
1128227057 15:66009336-66009358 ATGGGGGTGGGGAGGGTGCAGGG + Intronic
1128244731 15:66125428-66125450 GGATGAATGGGGAGCGTGCACGG + Intronic
1128426023 15:67542994-67543016 GTGGGTATGAGGAGGCAGCAGGG - Exonic
1128941315 15:71790173-71790195 GAGTGTGTCGGGAGGGTGCAGGG - Intergenic
1129151820 15:73693886-73693908 GTGTGTATGCGGTGGGTGGGGGG + Intronic
1129881870 15:79012176-79012198 CGGTGTTTGGGGAGAGTGCAGGG - Intronic
1131407491 15:92177112-92177134 GTGCATATAGGGTGGGTGCAAGG + Intergenic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1131534044 15:93219404-93219426 GTGTGTATGTGAAGGGTGACAGG + Intergenic
1133394887 16:5438933-5438955 GTGTGGATGGGGAGGTGGTAAGG + Intergenic
1134293166 16:12920171-12920193 GTGGGTACGGGGAGGGGGGAGGG + Intronic
1134638139 16:15808278-15808300 GTGTGTAGGGACACGGTGCATGG - Intronic
1136330842 16:29575417-29575439 GTGTGTATGGGGAGGGCAGGTGG - Intergenic
1136405680 16:30045293-30045315 GTGTGTGTGGGGTGGGTGTATGG + Intronic
1136412818 16:30086690-30086712 GTGTGTCTGGGGAGAGGGAAGGG + Exonic
1136445477 16:30315145-30315167 GTGTGTATGGGGAGGGGAGGTGG - Intergenic
1136692787 16:32047788-32047810 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1136793283 16:32991013-32991035 GTGTGTGTGGGGGGGGTGGTTGG + Intergenic
1137481675 16:48856965-48856987 GTGTGCATGGGGAAGATGGAAGG + Intergenic
1137826201 16:51497971-51497993 GTGTGCATGTTGAGGGGGCAGGG - Intergenic
1138214766 16:55193934-55193956 GTGTGTGTGGGCAGGGGACAGGG - Intergenic
1138517491 16:57544344-57544366 GCGTGTGGGGGGATGGTGCATGG + Intronic
1138593847 16:58018806-58018828 GTCTGTCTGTGGAGGGTGCTTGG + Intronic
1138741239 16:59313099-59313121 GTGTGTATGGGGTGGGGGTAGGG - Intergenic
1138790632 16:59899744-59899766 GTCTTTATGGGGAGGGGGGAGGG + Intergenic
1139318048 16:66090213-66090235 GTGTGTATGGGGAGAATGAAGGG + Intergenic
1139343373 16:66286542-66286564 GGGGGTATGGGGAGGGTGTGAGG + Intergenic
1140246139 16:73251809-73251831 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1140246143 16:73251871-73251893 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140663084 16:77206712-77206734 GTGTGTGGGGGGAGGGAGTAGGG - Intronic
1140866235 16:79064983-79065005 GTGTGTGTGCGAAGGGTGAATGG + Intronic
1142234538 16:88915520-88915542 GTGTGGAGGGGGAGCGTGGAGGG + Intronic
1142622160 17:1172077-1172099 GTGTGTGTGGGGAGGAAGGAAGG + Intronic
1142639174 17:1275706-1275728 GTGTGTGTGGGGGGGGTGTGTGG + Intergenic
1142782213 17:2190125-2190147 CTGCCTATGGGGAGGGTGAAGGG - Intronic
1142802401 17:2354828-2354850 GTGTGTAAGGGTTGGGGGCAGGG + Intronic
1142933686 17:3309845-3309867 ACGTGTATGCGGGGGGTGCAGGG + Intergenic
1143036517 17:4002727-4002749 GTGGGCAGGGGGAGGGAGCAGGG + Intergenic
1143143141 17:4754469-4754491 GTGTGTGTGGGGTAGGGGCAGGG - Intergenic
1145760026 17:27420601-27420623 GTGTGTGTGGCTTGGGTGCAGGG + Intergenic
1145897134 17:28465698-28465720 GTGTGTATGGGGTGGGGGAAGGG + Intronic
1146946902 17:36879630-36879652 GTGTGTCTGCGCAGGGTGTATGG + Intergenic
1147145087 17:38479912-38479934 GTGTGTGGGGGCAGGGGGCATGG + Intronic
1147426926 17:40350344-40350366 GTGTGTATGGGGGGGTGGAAGGG + Intronic
1147650736 17:42060450-42060472 GTGTGTGCAGGGAGTGTGCAGGG - Intronic
1147846393 17:43407051-43407073 GTCTGTATGGGGGAGGTCCAGGG - Intergenic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1148048277 17:44757354-44757376 GGGTGTGTGGTGAGGGTGCATGG + Intergenic
1148151476 17:45398865-45398887 GTGTGTATGGGGAGGGGCAAGGG - Intronic
1148330702 17:46812301-46812323 GTATGTGTGGGGAGGCAGCAGGG - Intronic
1148909751 17:50935122-50935144 GTGTGGCGGGGGAGGGAGCAAGG - Intergenic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149435882 17:56632904-56632926 GTGTATGTGGGGAGGGGGCAGGG - Intergenic
1150408346 17:64921202-64921224 GAATGTATGGGGAGCGGGCAAGG - Intergenic
1150553235 17:66230427-66230449 GTTGGTATGGGGAGGATGGAAGG - Intronic
1151212270 17:72553560-72553582 GGGTGTGTGGGGGGTGTGCATGG - Intergenic
1151212333 17:72554019-72554041 GTGTGTGTGGGGTGTGTGCATGG - Intergenic
1151212343 17:72554086-72554108 GTGTGTGTGGGATGTGTGCATGG - Intergenic
1152036153 17:77874368-77874390 CTGTGTTTGGTGATGGTGCAGGG - Intergenic
1152166706 17:78713015-78713037 GTGGGTTTGGCGGGGGTGCAGGG - Intronic
1152288579 17:79426006-79426028 GTGTGGAGGGGGAGAGAGCAAGG + Intronic
1152466338 17:80468654-80468676 GTGTGTTTGGGGAGGGGGAGAGG + Exonic
1152470087 17:80486282-80486304 GTGTGCATGTGCAGGGGGCAGGG + Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1152511525 17:80792891-80792913 GTGTGTGTGGGGAGGGCGCAGGG - Intronic
1152720220 17:81919958-81919980 GTGTGGAAGAGGAGGGTGTAAGG - Exonic
1152733422 17:81984839-81984861 GTGTGTGTGGGGTGTGTGCAGGG - Intronic
1153664076 18:7352392-7352414 GTGTGTATGGGATGGGGGCAGGG - Intergenic
1153942650 18:9991110-9991132 GTGTGTGTGAGAAGGGAGCAGGG - Intergenic
1154253999 18:12767277-12767299 GTATGTAAGGTGAGGGGGCAGGG - Intergenic
1155172172 18:23275148-23275170 GTGTGTGTGTGCAGGGTGCAGGG + Intronic
1155838818 18:30622560-30622582 GTGTGTGTGTGTAGGGGGCAGGG + Intergenic
1156134927 18:34026269-34026291 GTGTGCATGGGGAGGGAGGAGGG - Intronic
1156262547 18:35458877-35458899 GTGGGTTTGGGGAGGAGGCATGG - Intronic
1156591211 18:38490691-38490713 GTAGGTAGGGGAAGGGTGCATGG + Intergenic
1157142457 18:45123393-45123415 GTGTGTGTGTGGCGGGGGCAGGG + Intergenic
1157327907 18:46682110-46682132 GTCAGGCTGGGGAGGGTGCAGGG + Intronic
1157446701 18:47751624-47751646 GTGTGGATGAGGAGGGGACAAGG + Intergenic
1158911947 18:62073199-62073221 GTGTGTAAGGGGGGGATGGAGGG + Intronic
1160174517 18:76581639-76581661 GTGTGCATGAGGAGGGAGGAAGG - Intergenic
1160400402 18:78606687-78606709 GTGTGTGTGGGGTGTGTGTATGG - Intergenic
1160777128 19:861513-861535 GTGGGGATGGGGTGGGTGCGAGG - Intronic
1161043750 19:2123623-2123645 GTGTCTGTGGGGTGGATGCATGG - Intronic
1162528902 19:11224051-11224073 GTGTGTGTGGGGCGGGGGCAGGG + Intronic
1162966040 19:14156559-14156581 GTGTGTGTGGGGGGGGTGGGGGG + Intronic
1162998222 19:14349944-14349966 GTGGGTAGGGGGACAGTGCATGG - Intergenic
1163109660 19:15151899-15151921 TTCTGTCTGGGGTGGGTGCAGGG - Intergenic
1163490872 19:17616551-17616573 GAGTGTGTGTGGAGGGGGCAGGG + Intronic
1163528230 19:17834460-17834482 GTGTGTCTGGTGAGGTTGGAGGG - Intronic
1163751064 19:19078136-19078158 CTGTATATGGGGAGGCTGGAGGG + Intronic
1163786548 19:19277659-19277681 GTGGGAATGGGGAGGCGGCAGGG + Intronic
1164455612 19:28404138-28404160 GTGTACATGGGGAGGCTGGATGG + Intergenic
1164586808 19:29480835-29480857 GTGTTTATGGGGTGGGTGAGTGG - Intergenic
1164832594 19:31333972-31333994 GTGTGGGTGGGGAGGGAGCAAGG - Intronic
1165802790 19:38563097-38563119 GTTTGTATGGGGAGCACGCAGGG - Intronic
1165806359 19:38583526-38583548 GTGGGGGTGGGGAGGGAGCATGG - Intronic
1165928078 19:39339696-39339718 GTGTGTGGGGGGGGGGGGCAGGG - Intronic
1166777728 19:45322987-45323009 GTGGGTATGGTGCGGGAGCAGGG - Intergenic
1167087641 19:47321052-47321074 GTGTGTGTGGGGGGGGTGGGGGG - Exonic
1167407840 19:49325301-49325323 GTGCGTGTGGGGAGAGAGCAGGG - Intergenic
1167635652 19:50653799-50653821 GTGACTTTGGGGAGGGTTCACGG + Intronic
1168173733 19:54608090-54608112 GTGGGTTTGGGGAGGGTCCCTGG - Intronic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
924963720 2:57321-57343 CTGTGCAAGGGTAGGGTGCAGGG - Intergenic
925135722 2:1524108-1524130 GGGTATTTGGGGAGGTTGCACGG - Intronic
925137162 2:1529925-1529947 GGGGATATGGGGAGGCTGCAAGG - Intronic
925419811 2:3703243-3703265 GAGTGTAGGGGGAGGAGGCACGG + Intergenic
925541692 2:4974330-4974352 TTGTGTGTGGGGAGGGTGCCAGG - Intergenic
926099205 2:10103307-10103329 GTGGGTGTGGGGAGGGCACAGGG + Intergenic
927100500 2:19784221-19784243 GTGTGTATGGGGTGTGTGTGTGG - Intergenic
927470864 2:23375487-23375509 AAGTGTATGGAGAAGGTGCAGGG + Intergenic
927903144 2:26837212-26837234 GTATGTGTGGGGAGGGGGTATGG + Intergenic
929074545 2:38068909-38068931 GTGTGTGTGGGGTGGGGGGATGG - Exonic
929095853 2:38262723-38262745 ATGTGGAGGGGGAGGGGGCAGGG - Intergenic
929356330 2:41029146-41029168 GTGTGTGTGTGGAGGGGGCTGGG + Intergenic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
930364206 2:50418365-50418387 GTGTGTTGGGGGAGGCTGCAAGG - Intronic
930683275 2:54280363-54280385 GTGTGGGTGGGAAGGGGGCATGG + Intronic
931391919 2:61851778-61851800 GGGTGTATAGGGATGGTGCAGGG + Intronic
931694920 2:64864610-64864632 GTGTGTCGGGGGAGGGTATAAGG - Intergenic
932481006 2:72039318-72039340 AGGGGTTTGGGGAGGGTGCAGGG - Intergenic
933220933 2:79687128-79687150 GTGGGAATGGGGAGGTTGCTTGG + Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934589158 2:95530746-95530768 GTGTGGATGGTGGGGCTGCAGGG - Intergenic
934609881 2:95727216-95727238 GTGTGTATTGCAGGGGTGCAGGG - Intergenic
935209239 2:100924152-100924174 GTGTGTCTAGGGAGGGCTCAGGG - Intronic
935819251 2:106877792-106877814 GTGTGTGTGGAGAGGTTGTAGGG - Intronic
936091727 2:109505896-109505918 GTCTGTCTGGAGAGGGTGCCTGG + Intergenic
936092355 2:109509694-109509716 GTGAGAAGGGTGAGGGTGCAGGG - Intergenic
936438907 2:112533262-112533284 GATTGCATGGGCAGGGTGCAGGG + Exonic
936543209 2:113368792-113368814 GTGTGTATTGCAGGGGTGCAGGG - Intergenic
937002180 2:118477844-118477866 GTTAGTATCGGGAGGATGCAGGG - Intergenic
937229411 2:120388892-120388914 GTGGGGATGGGGTGGGTGCAGGG + Intergenic
937718267 2:125060319-125060341 CTGTGCATGGGGAGGGTTCAGGG + Intergenic
937718599 2:125063943-125063965 GTTTGTGTGGGGAGGGTGGTTGG + Intergenic
937821241 2:126313443-126313465 GTGTGTATGTGGTGGGTGCAGGG - Intergenic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940378301 2:152983457-152983479 ATGTATATGGGGAGGTTGGAGGG + Intergenic
941905613 2:170714781-170714803 GCGTGTGCGGCGAGGGTGCAGGG + Intergenic
942042146 2:172078010-172078032 GTGTTTATGTGCAGGGGGCAGGG + Intronic
943029475 2:182669186-182669208 GTGTGTCTGGGGTGAGTGAAGGG - Intergenic
943358141 2:186884283-186884305 GTGGGGATGGGGAGAGGGCAAGG + Intergenic
947391215 2:229641506-229641528 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
947634565 2:231673464-231673486 GTGGGGAAGGGGAGGGAGCAGGG - Intergenic
947722875 2:232380117-232380139 CTGTGCATGAGGAGGGGGCACGG + Intronic
948563635 2:238870113-238870135 GTGTGTGTGTGGGGGGTGTATGG - Intronic
948634738 2:239327905-239327927 GTGTGTATGCGGGGAGAGCATGG - Intronic
948907239 2:240985786-240985808 GTGTGTGTGGAGTGGGTGCCTGG - Intronic
1169138645 20:3213651-3213673 ATGTGTGTGGGGAGGATGTAGGG - Intronic
1169691863 20:8341095-8341117 GTGTATATGGGAGGGGGGCATGG - Intronic
1169781190 20:9312343-9312365 GTGTGTGTGTGTAGGGTGGAAGG - Intronic
1170125431 20:12957998-12958020 GTGTGTGTGGCAAGGGTGCAGGG - Intergenic
1170554354 20:17503767-17503789 GTGGGAATGGGGAGTTTGCAGGG - Intronic
1170747229 20:19111071-19111093 GTGTGTGTGGGGAGGGGGGAGGG + Intergenic
1171321840 20:24252582-24252604 GTGTTTTTGGGGGGGATGCAGGG - Intergenic
1171411548 20:24951473-24951495 GGCTGTATAGGGAGGGTGCTGGG + Intronic
1171769403 20:29310965-29310987 GTGTGTGTGGGGAGGGGGTGTGG - Intergenic
1172207801 20:33176768-33176790 GTGAGTAAGGGGAGGGTACAGGG - Intronic
1172281572 20:33711467-33711489 GAGTTTGTGGGGAGGGTGCAGGG + Intronic
1173404488 20:42752967-42752989 GTGTGTTTGGGGTCGGGGCAGGG + Intronic
1173675931 20:44835775-44835797 GTGTGTATGTGGGGGGTGGGGGG - Intergenic
1173866211 20:46314068-46314090 GTGTGTGTGGGGAGTGTGGTAGG - Intergenic
1174039343 20:47688029-47688051 GGGTGCATGGGGAGGGTGCAGGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174200245 20:48802122-48802144 GTGGGGATGGGGTGTGTGCAGGG - Intronic
1174402634 20:50284098-50284120 GTGTGTGTGACGAGGCTGCACGG - Intergenic
1174605714 20:51759949-51759971 GTGTGTCTGGGGGCGGGGCAGGG - Intronic
1174898635 20:54475877-54475899 GTGGCTCTGGGGAGGGTGGAGGG - Exonic
1174924500 20:54742762-54742784 GTGTGTGTGGGGAGGGGGTGGGG + Intergenic
1175296729 20:57913740-57913762 ATGTGCATGGGCAGGGTGGACGG + Intergenic
1175875618 20:62227955-62227977 GTCTGTTTGGGGAGGAAGCAAGG + Intergenic
1175922672 20:62457432-62457454 CTGTGTGTGGGGAGGGTCCCCGG - Intergenic
1176229294 20:64023634-64023656 GTGGGCATGGGGAGGGGGCCAGG - Intronic
1176263232 20:64194340-64194362 GTAGGGATGGGGAGGGTGAATGG - Intronic
1176551852 21:8226565-8226587 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176570761 21:8409564-8409586 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1176578670 21:8453711-8453733 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1179107241 21:38413015-38413037 GTGTGTATGGGGTGGGGACTCGG + Intronic
1179352461 21:40625572-40625594 GGGTGATTGGGGTGGGTGCAGGG - Intronic
1179467336 21:41585155-41585177 TTGTGTATGGTGAGGGTGTGTGG - Intergenic
1179662228 21:42883956-42883978 GGGTTTATGGGGAGGGTGAAAGG - Intronic
1179772395 21:43631970-43631992 GTGTGTGTGGGGAGCGTGTGTGG - Intronic
1179881212 21:44294062-44294084 GAGTGTAGGGTGTGGGTGCAGGG - Intronic
1180794062 22:18593295-18593317 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1181227677 22:21402025-21402047 GGCTTTATGGGGAGGGTGGATGG - Intergenic
1181250974 22:21532814-21532836 GGCTTTATGGGGAGGGTGGATGG + Intergenic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1181750149 22:24983597-24983619 GTGTGTATGGTGGGGGGGCGGGG + Intronic
1181921936 22:26327387-26327409 GTGTGTATGTGGTGTGTGTATGG - Intronic
1181921952 22:26327551-26327573 GTGTGTGTGGGGTGTGTGTATGG - Intronic
1182366714 22:29784117-29784139 GTGTGTATGGGGTGGGGGTGAGG - Intergenic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182517454 22:30867131-30867153 GTGTGCCTGGGCTGGGTGCAGGG + Intronic
1182721310 22:32403116-32403138 GTATATATTGGCAGGGTGCAGGG + Intronic
1182729445 22:32475165-32475187 GAGTGCTTGGGGTGGGTGCAGGG + Intronic
1182785404 22:32903511-32903533 GTGGGTAGGGGGAGGGGGCTTGG + Intronic
1183034908 22:35134232-35134254 GTGGGACTGGGGAGGGTGGAGGG - Intergenic
1183353041 22:37344205-37344227 GTGGGTGTGGGCAGGGGGCATGG - Intergenic
1183587587 22:38761884-38761906 GTGTGTGTGGGGAGTGTGTGTGG + Intronic
1184196026 22:42929065-42929087 GTGTGTATGTGCAGTGAGCATGG + Intronic
1184268893 22:43366283-43366305 GTGTGTCTGGGGTGGGTGGGCGG - Intergenic
1184697067 22:46145728-46145750 GTGAGTTTGAGGAGGGAGCACGG - Intergenic
1184955809 22:47885310-47885332 GTGGGCAGGGGGCGGGTGCATGG - Intergenic
1185046193 22:48529772-48529794 GTGTGGACGGGGAGGGTGTGTGG + Intronic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185420887 22:50733762-50733784 GTGTGCATGGGGAGGGAGCAGGG - Intergenic
1203256873 22_KI270733v1_random:143487-143509 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
949105724 3:197897-197919 GTGTGCGTGGGGAGGCAGCACGG + Intronic
949426448 3:3922261-3922283 GTGTATATGTGGTGGTTGCAGGG + Intronic
949491212 3:4590874-4590896 TTGTGGAGGGGGAGGGTGGAAGG - Intronic
949565327 3:5239334-5239356 GTGTGTATGGTGTGTGTGTATGG - Intergenic
949565341 3:5239558-5239580 GTGTGTATGGTGTGTGTGTATGG - Intergenic
949617668 3:5772231-5772253 GTGTGTAGAGAGAGGGTGCCAGG - Intergenic
950145021 3:10642851-10642873 CAGTGTATGGGGAGGAAGCAGGG - Intronic
950709981 3:14807122-14807144 TTGTGTGTGGGGAGGGTCCTGGG + Intergenic
950857680 3:16120873-16120895 TTTTGTTTGGGGAGGTTGCAGGG - Intergenic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
951991676 3:28682358-28682380 GTGTGTGTAGGAAGGGTGCATGG - Intergenic
952561323 3:34596854-34596876 GTGTGTATGAGGAGGGTATGGGG + Intergenic
953413568 3:42703046-42703068 GTGTGTCTGTGGTGGGGGCAGGG - Intronic
953460214 3:43076111-43076133 GTGGGGACTGGGAGGGTGCAGGG + Intergenic
953506478 3:43490789-43490811 GTGTGTGTGGGGGTGGTGCTGGG - Intronic
953679644 3:45029811-45029833 GTGTGTAAGTTGAGGGTGCCGGG - Intronic
953699914 3:45187522-45187544 GTGGGCATGGGCATGGTGCAGGG + Intergenic
954063399 3:48088161-48088183 GTGGGGGTGGGGAGGGTACAGGG - Intronic
954288480 3:49636389-49636411 GTGTGTATGGGGAGGGTGCAGGG + Intronic
954884375 3:53858900-53858922 GTGTGTATGTGGGCAGTGCAAGG + Intronic
955760724 3:62278939-62278961 ATTTGTATGGGGAGGCTGGAGGG + Intronic
955884728 3:63585463-63585485 GTGTGTGTGTGGTGGGTGCGGGG - Intronic
956230306 3:67007662-67007684 GTTTGTATTGGGAAGGTACAAGG - Intronic
956607445 3:71086943-71086965 TTGTGTTTGGGTAGGGTGCCTGG - Intronic
956737247 3:72247271-72247293 GCGTGGGTGGGGAGGGTGGAAGG - Intergenic
957816400 3:85303977-85303999 TTTTGTATGTGGAGGGTGCTAGG - Intronic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
959051378 3:101527932-101527954 GTGTGTGTGGGGGGGGGGCGGGG - Intergenic
960436042 3:117628074-117628096 ATGCATATGGGGAGGGGGCATGG - Intergenic
960483283 3:118219533-118219555 GTGTGTTGGGGGAGGGGGCAGGG + Intergenic
960619327 3:119623660-119623682 GGGTGTGTGGAGAGGGAGCAGGG + Intronic
960939449 3:122923795-122923817 GGGTTTATGAGGAGGGTGCCAGG - Intronic
961572096 3:127806479-127806501 GGATGTATGGGGTGGGTGGATGG + Intronic
961736354 3:129004313-129004335 GGGTGTGTGGGGTGGGTGAATGG - Intronic
962170242 3:133094227-133094249 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
962834874 3:139181199-139181221 GTGTGCATGGGCCTGGTGCATGG + Intronic
963610128 3:147456674-147456696 GTTTGTTTGGGGAGACTGCAGGG + Intronic
964327552 3:155563606-155563628 GTGTGTTTGTGGAGGGAGAAGGG - Intronic
964891387 3:161540307-161540329 GTGTATATGGGGATGGAGCCAGG + Intergenic
964891444 3:161540829-161540851 GTGTGTCTGGGGGTGGTACAAGG + Intergenic
966314401 3:178629482-178629504 GTGAGAATGGGGTGGTTGCAAGG + Intronic
966633503 3:182106127-182106149 GTGTGTATGGCGAGGATTCTGGG - Intergenic
966912562 3:184567505-184567527 GTGTGTGTGTTGCGGGTGCATGG + Intronic
966938411 3:184729773-184729795 GTGTGCATGGGGAGAGGGCAAGG - Intergenic
967006757 3:185391225-185391247 GGGTGTGTGGGGAGGGGGAATGG - Intronic
968516706 4:1018579-1018601 GGGTGTCTTGGCAGGGTGCACGG + Intronic
968569801 4:1333670-1333692 GTGGGCATGGGGTGGGTGCAGGG - Intronic
968569851 4:1333811-1333833 GTGGGCATGGGGTGGGTGCAGGG - Intronic
968576310 4:1367842-1367864 GTGTGTGTGGGGTGGGGACAGGG - Intronic
968669241 4:1839865-1839887 GTATGTACGGGGAAGGGGCATGG - Intronic
969046312 4:4339226-4339248 AGGGGTATGGGGGGGGTGCATGG - Intergenic
970190589 4:13512363-13512385 GTGTGTATGGGGTGGGGGTGGGG + Intergenic
970195721 4:13548116-13548138 GTGTGTTTGGGGTGGGGGCGGGG + Intergenic
972315782 4:37924206-37924228 GATTGTTTGGGGAGGGAGCATGG - Intronic
973110351 4:46390199-46390221 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
973189686 4:47372902-47372924 GTGAGTATGGGGAGGGAGTGAGG - Intronic
975408931 4:74025109-74025131 GTGTGTGTGTGGAGGGTGTGGGG + Intergenic
976615712 4:87074005-87074027 GACTGGATGGGGTGGGTGCAGGG + Intronic
976627634 4:87204214-87204236 GTGTGTATGGGGATGTGGCAGGG - Intronic
977177969 4:93838791-93838813 GTGGGGAGGGGGGGGGTGCAAGG + Intergenic
977753790 4:100641053-100641075 GTGGGAAGGTGGAGGGTGCATGG + Intronic
979412380 4:120395100-120395122 GGGTGCATGCGGACGGTGCAAGG - Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
980277384 4:130671588-130671610 TTGTTTATGGTGAGGGTTCAGGG - Intergenic
981516893 4:145619408-145619430 GTGAGTATGGGGAGTGCGCGCGG + Intronic
983891623 4:173035553-173035575 GTGTGTATGAGGAGAGAGCATGG - Intronic
984232991 4:177121761-177121783 GTAACTATGGGGAGGTTGCACGG + Intergenic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
984521678 4:180809784-180809806 ATGTGTGTGGTGGGGGTGCAGGG - Intergenic
985511624 5:317145-317167 GTGTGGCTGGGCAGGGGGCACGG - Intronic
985636124 5:1036627-1036649 GTGTGTATGTGGCGGATGCGGGG + Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985825625 5:2188805-2188827 TGGGGTATGGGGAGGGAGCAAGG + Intergenic
986034940 5:3928257-3928279 GTGTGTAGGGGGAGGCGGGAGGG - Intergenic
986433050 5:7700708-7700730 GTGTGTGTGTGGTGGGTGCGAGG - Intronic
986806159 5:11310872-11310894 GCGTGTGAGGTGAGGGTGCATGG - Intronic
986806177 5:11310993-11311015 GTGTGTGGGGTGAGGGTGCATGG - Intronic
986806289 5:11311694-11311716 GAGTGTGTGGTGAGGGTGCATGG - Intronic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
986806314 5:11311840-11311862 GTGTGTGGGGTGAGGGTGTATGG - Intronic
986818846 5:11443396-11443418 GTGTGTGTGGGGGGGGTGTGTGG + Intronic
987911363 5:24150563-24150585 GTGTGTGGGGGGATGGGGCATGG + Intronic
988178681 5:27761519-27761541 GTGAGTATGGGAAGAGGGCAAGG - Intergenic
988623049 5:32843001-32843023 GTGTGTGTTGGGGGGGTGCAGGG + Intergenic
990008188 5:50966496-50966518 GTGTGTAGGGGGTGGGGGCTCGG + Intergenic
991144398 5:63283832-63283854 GTGGGGACGGGGAGGGTGGAGGG + Intergenic
991295674 5:65077788-65077810 GTGTGTGTGGGGGGGGGGCGCGG - Intergenic
992272669 5:75081654-75081676 GTGTGTTTGGGGTGGGTGGTGGG + Intronic
992492500 5:77259070-77259092 GTGTGTGTGGGGGGGGGGCGGGG - Intronic
993653193 5:90547120-90547142 GTGTGTCTGGAGATTGTGCAAGG - Intronic
994067586 5:95560657-95560679 GTGTGTTTGTGTATGGTGCAAGG - Intronic
994640068 5:102396652-102396674 GTGTGTAGGGGGTGGGTGAGTGG + Intronic
994682062 5:102900247-102900269 GTGTGTGTGGGGGGGGGGCGGGG + Intronic
994721834 5:103389535-103389557 GTGTGTGTGGGCAGGGGGCTGGG + Intergenic
995646695 5:114320696-114320718 GTTTGGAGGGGTAGGGTGCATGG + Intergenic
996213969 5:120845179-120845201 GTGTGTATGGGGAGGAAGAAGGG + Intergenic
997335530 5:133106529-133106551 GTGTGTGTGGGGTGGGGGCGGGG + Intergenic
997337923 5:133120837-133120859 GTGTGTGTGGGGAGGCTTCCAGG - Intergenic
997358620 5:133280297-133280319 GTGGGTATGGGGAGGGGGTGAGG + Intronic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
999030881 5:148289919-148289941 GTGTGTTGGGGGAGGGGGGAGGG - Intergenic
999321074 5:150615419-150615441 GTGGGCGTGGGGAGGGGGCAGGG - Intronic
999418919 5:151423879-151423901 GTGTGTAGGGAGAGGGTATATGG + Intergenic
999666272 5:153916782-153916804 GTGTCTAGGGTGAGGGGGCAAGG - Intergenic
1000129627 5:158283684-158283706 GTGTGTATGTGGTGGGGGAAGGG + Intergenic
1001293890 5:170485426-170485448 GTGTGGACGGGGAGGGTGGCTGG + Intronic
1002167669 5:177358385-177358407 GTGGGGATGGGCAGGGGGCAAGG - Intronic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002466063 5:179409349-179409371 GTGTGTCTGGGCAGTGTGGATGG - Intergenic
1002915858 6:1527237-1527259 GGGTGTGTGTGGAGGGGGCAGGG - Intergenic
1002971784 6:2030261-2030283 GTATGTGTGGGGGTGGTGCATGG + Intronic
1003463371 6:6352863-6352885 GTGTGTATGTGTAGTGTGTATGG - Intergenic
1003874441 6:10423629-10423651 GTGTGTTGGGGGAGGGGGGATGG + Intergenic
1004080389 6:12386756-12386778 GTGTGTGTGGGGGGGGTGGTGGG + Intergenic
1004193637 6:13486244-13486266 GTGTGTGTGGGGGGGGGGGATGG - Intronic
1004292981 6:14385245-14385267 GTGTGTTTGGTTAGGGTGAATGG + Intergenic
1005773542 6:29103146-29103168 GTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1006408551 6:33858777-33858799 ATGTGCATGGGGAGTGGGCATGG + Intergenic
1008067156 6:47061872-47061894 CTGTAAATGGGGAGGGTGCTGGG + Intergenic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1009498019 6:64374409-64374431 GTGGGTGTGGGGTGGGTGCAGGG + Intronic
1010024417 6:71199124-71199146 GTGTGAATGTGGAAGGGGCAGGG + Intergenic
1010815803 6:80356948-80356970 GTGTGTGTGGGGGGGGGGCGGGG - Intergenic
1010925860 6:81745168-81745190 GTGTGTGTGTGTTGGGTGCAAGG - Intronic
1011055393 6:83198552-83198574 GTGTGTAGGGGGAGGGGGTTGGG - Exonic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011540938 6:88427891-88427913 CTGGGTCTGGGGAGGGAGCAGGG - Intergenic
1011931129 6:92715025-92715047 ATATGTATAGAGAGGGTGCAGGG - Intergenic
1012967555 6:105691249-105691271 ATGTGTGTGGGGAGGGGTCAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013568373 6:111393647-111393669 GGGTGTATGGGAAGGGTTCCAGG - Intronic
1013726961 6:113110468-113110490 GTATGTATGGGGTGGGTAAATGG - Intergenic
1014443669 6:121501906-121501928 GTGTGTGTGGTGGGGGGGCATGG + Intergenic
1014628993 6:123766465-123766487 ATGTTTCTGGGGAGGCTGCAGGG - Intergenic
1014813152 6:125907393-125907415 CTGTGTTTGGGGAGTGTGAAGGG - Intronic
1014899596 6:126946701-126946723 GAGTGTATGGGGAGGTGGGATGG - Intergenic
1015449131 6:133343589-133343611 GTGTGTATGGAGAGGGTCAAGGG - Intronic
1015525429 6:134171364-134171386 GTGTGTGTGTGGAGGGTGAGGGG + Intronic
1015594608 6:134854466-134854488 GTGTGTGTGGGGTGGGTGATGGG - Intergenic
1017227096 6:152034140-152034162 GTGTGGTTGGGGAGGGGGGAGGG + Intronic
1017491138 6:154946208-154946230 GTGGGGAAGGGGAGGGTGGAAGG - Intronic
1017705981 6:157123234-157123256 GTGTGTGTGGGGGGGGGGCGGGG - Intronic
1017913919 6:158818309-158818331 GCGGGCATGGGGAGGGGGCACGG + Intronic
1018060605 6:160086879-160086901 GTGTGTGTGGTCAGGGTGGAAGG + Intronic
1018755998 6:166850274-166850296 GTGTGTTTGGGTAAGATGCAAGG - Intronic
1018837075 6:167493181-167493203 GTGTGCATGGAGTGTGTGCATGG - Intergenic
1018837078 6:167493208-167493230 GTGTGCATGGAGTGTGTGCATGG - Intergenic
1019057864 6:169236030-169236052 GTGTGGATGGGGAGGGAGTGTGG - Intronic
1019057873 6:169236060-169236082 GTGTGGATGGTGAGTGTGGATGG - Intronic
1019057935 6:169236346-169236368 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057942 6:169236375-169236397 GTGTGGATGGGGAGTGTGGATGG - Intronic
1019057987 6:169236604-169236626 GTGTGGATGGCGAGTGTGGATGG - Intronic
1019057992 6:169236633-169236655 GTGTGGATGGCGAGTGTGGATGG - Intronic
1019341297 7:510318-510340 GTGTGGCTGGTGGGGGTGCACGG - Intronic
1019351631 7:556762-556784 GTGTGTTTGGAGAAGGTGAAAGG - Intronic
1019487290 7:1295233-1295255 GTGTGTGTGGTGTGGGTGCAGGG + Intergenic
1019487356 7:1295543-1295565 GTGTGTGTGGTGTGGGTGCAGGG + Intergenic
1019525112 7:1477294-1477316 GTGGGGATGGGGTGGGTGGATGG - Intronic
1019599406 7:1873796-1873818 GTGTGTTTGGGGAGCAGGCAGGG + Intronic
1019638972 7:2092556-2092578 GTGTGTGAGGGGAGGATGCTCGG - Intronic
1021291312 7:18848479-18848501 GTGTGCATGGAGAGAGAGCAAGG - Intronic
1021865393 7:24951594-24951616 GTGTGTGTGGGTAGGGGGAAGGG - Intronic
1022100377 7:27165800-27165822 GTGTGTATGGGGGGGGAGACGGG - Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1022509677 7:30927123-30927145 GTGGGCATGGGGAGGGGGAAGGG + Intergenic
1022785671 7:33634738-33634760 GTGTGTATGTGGACAGGGCAGGG + Intergenic
1023967785 7:44971983-44972005 GCGTGAGTGGGGAGGGTGCTCGG - Intronic
1024091316 7:45943110-45943132 GTGTGTATGGTGTGTGTGTATGG - Intergenic
1024524391 7:50336254-50336276 GGGGGCAGGGGGAGGGTGCAGGG + Intronic
1024585194 7:50836005-50836027 GAGTGTATGTGGAGGGAGAAAGG - Intergenic
1025030611 7:55553746-55553768 GTGTGTGTGTGTAGAGTGCAGGG - Intronic
1025193916 7:56917921-56917943 GTGTTTATTGGGTGGGTGGATGG + Intergenic
1025678030 7:63659025-63659047 GTGTTTATTGGGTGGGTGGATGG - Intergenic
1026082033 7:67230483-67230505 TTGTGTTTGAGGAGGGTACAAGG - Intronic
1026295656 7:69049871-69049893 GTGTGTGGAGGGAGGGTGTAGGG - Intergenic
1026695033 7:72583506-72583528 TTGTGTTTGAGGAGGGTACAAGG + Intronic
1027570221 7:79856891-79856913 CTGTGTTTGGGGAGAGAGCATGG - Intergenic
1027770420 7:82399701-82399723 GTGTGTATGGGGTGGGGGTGGGG - Intronic
1027812101 7:82916273-82916295 GAGTGTATGAGGTGGGTGCTTGG + Exonic
1027988658 7:85329858-85329880 GTGGGTGGGGGGAGGGTGGAGGG - Intergenic
1029126026 7:98295750-98295772 GTGTGCTTGGGGTGGGTGGAGGG - Intronic
1029631579 7:101754467-101754489 GTGTGTAGGAGGAGGGAACATGG - Intergenic
1030110161 7:106020041-106020063 GTGTGTGTGGGGGGGGGGCAAGG + Intronic
1031898274 7:127379846-127379868 GTGTGTGTGGGGGGGGTGGGGGG - Intronic
1032582554 7:133116863-133116885 GTGTGTGTGGGGAGGGGGGGCGG - Intergenic
1033026115 7:137774541-137774563 GTGTGTAGGGGGAGGGTAATGGG - Intronic
1033202902 7:139389547-139389569 GTGTGTATGAGGAGGTTTCTAGG - Intronic
1033244173 7:139704613-139704635 GTGTGTATGGGGTGTGTGTTGGG - Intronic
1034140038 7:148806803-148806825 ATGTACCTGGGGAGGGTGCAGGG + Intergenic
1034416373 7:150966378-150966400 GTGTGTGTGGGGGGGGGGGAGGG - Intronic
1034730492 7:153382875-153382897 TTGTGTATGGAGAGGTTGCCAGG - Intergenic
1034830003 7:154300661-154300683 GTGTGTGTGGGGTTGGGGCAAGG + Intronic
1035243138 7:157545112-157545134 GTGTGTGTGGGGTGTATGCATGG + Intronic
1035243167 7:157545326-157545348 GTGTGTGTGGGGGGTGTGCCTGG + Intronic
1035293172 7:157853027-157853049 GGGTGAATGGGGAGGGTGGATGG + Intronic
1035685256 8:1519606-1519628 GTGTCCATGGGGAAGGTGCATGG - Intronic
1036972073 8:13366435-13366457 GTGTGAATGGGGAGGTTCTATGG + Intronic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037186032 8:16064711-16064733 GTCTGTATGGGGCAGGTGCAGGG + Intergenic
1037913926 8:22760595-22760617 GTGTGTGTGTGGTGGGTGCAGGG + Intronic
1038869875 8:31482152-31482174 GTGTGTATGGGGGGGTTGGGAGG + Intergenic
1039367374 8:36944456-36944478 GTTTGAGTGGGGAGGGTGGAAGG + Intergenic
1039434009 8:37547271-37547293 GTGTGTATGGGGTGGGGGGCGGG - Intergenic
1039476059 8:37839978-37840000 GAGTGTATGGGGAGTGGGCTGGG + Intronic
1039748563 8:40455816-40455838 GTGTGTTTGGTGAGGGAGCCAGG - Intergenic
1039893812 8:41702014-41702036 GTGTGTCTGGGGTGGGTGCGGGG + Intronic
1040892851 8:52335864-52335886 GTGTGTAATTGGAGGGTGAAGGG - Intronic
1040903268 8:52439182-52439204 GTTTGTGTGGGGTGTGTGCATGG + Intronic
1042041366 8:64594101-64594123 GTGTGTATGTGGGGGGTGGGTGG + Intronic
1042155437 8:65840972-65840994 GTGTGTATGGGAAGGGGGACAGG + Intronic
1043192813 8:77248186-77248208 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1044469714 8:92552517-92552539 GTGTGTGTGGGGGGGGTGTTGGG - Intergenic
1045469155 8:102495992-102496014 GTGTGTGTGTGGAGGGTGTGGGG - Intergenic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1046243352 8:111527263-111527285 GTGTGTATGGTGGGGTTCCAAGG - Intergenic
1047235549 8:123039231-123039253 GTGTGTATGGAGGGGGTTGAAGG - Intronic
1047563472 8:126014043-126014065 GTGTATGTGGGGAGGTTGAAGGG + Intergenic
1047746998 8:127852748-127852770 GTGTGGATGGAGAGGGAGGAGGG - Intergenic
1047885330 8:129244125-129244147 GCATGAATTGGGAGGGTGCAAGG - Intergenic
1047955547 8:129972709-129972731 ATGTGTGTGGGGTGTGTGCATGG - Intronic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048307880 8:133296467-133296489 GTGTGTGGGGGGAGGGTCCAGGG - Intronic
1048389508 8:133948154-133948176 GTGTGTATGGGGTGGGGGTGGGG + Intergenic
1048810100 8:138277829-138277851 GTGTGTATTGGAGGGATGCATGG - Intronic
1048823640 8:138402021-138402043 GTGTGTGTGAGGAGGGTGGGAGG + Intronic
1048924178 8:139255971-139255993 GTGTGCATGGTGTGTGTGCATGG - Intergenic
1049361784 8:142215518-142215540 GTGTGTGTGGGGAGGCTGAGGGG - Intronic
1049662092 8:143824107-143824129 GCCTGGGTGGGGAGGGTGCAGGG + Intronic
1049878976 8:145049079-145049101 GTGGGAAGGGGGATGGTGCAGGG - Intergenic
1050772805 9:9224302-9224324 ATGTGTATGGGGAGGGAGAAAGG + Intronic
1050975685 9:11935383-11935405 GAGTGGGAGGGGAGGGTGCAGGG + Intergenic
1051168839 9:14297027-14297049 GTGTGTGTGGGCAGGGAGCAGGG - Intronic
1052105260 9:24506666-24506688 GTGTGTATGTGTAGGGGGTAGGG + Intergenic
1052536604 9:29755713-29755735 GTGGGTGGGGGGAGGGGGCATGG + Intergenic
1053289143 9:36868539-36868561 GTGAGGATGGGGAGGGAGAAAGG + Intronic
1053504368 9:38628846-38628868 GTGTGTATGGGGGGTGTTTATGG - Intergenic
1054337843 9:63823456-63823478 GTGTGTGTGGGGAGTATGTATGG - Intergenic
1055349340 9:75370110-75370132 GTGTGTATGTAGAGGGTGCAGGG - Intergenic
1056838109 9:89974323-89974345 GTGTTTTTGGTGTGGGTGCAGGG + Intergenic
1057439306 9:95071279-95071301 GTGTGTGTGGGGCGGGGGGAGGG - Intronic
1057850405 9:98562589-98562611 GTGTGTGTGGGGGTGGTGCAGGG + Intronic
1058797989 9:108516975-108516997 GTGTGTGGGGGGAGGGGGCAAGG - Intergenic
1059246862 9:112856347-112856369 GTGTGTATGGGGAGGGCACGTGG + Intronic
1059400606 9:114067864-114067886 GTGTTTTTGAGGAGGGTTCATGG - Intronic
1060105891 9:120873306-120873328 GTGTGTATGGGAAGGGAGAATGG + Intronic
1060346501 9:122821397-122821419 GTGTGTTTGGGGATGGTGTGGGG - Intronic
1060395457 9:123313288-123313310 GTGTGCAAGGGGTGGGTACATGG + Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1061396221 9:130345017-130345039 GTGTGTGTGTGGTGTGTGCATGG + Intronic
1061433221 9:130544404-130544426 GTGTGTTTGGGGAGTGTTTAAGG + Intergenic
1061772189 9:132934211-132934233 CTGTGTATAGGAAGGGTGTAGGG - Intronic
1062215299 9:135385890-135385912 GTGGGCACGGGGAGGGTGGAGGG - Intergenic
1203473031 Un_GL000220v1:125169-125191 GTGTGTGTGGGGAGGGGGTGCGG + Intergenic
1203363132 Un_KI270442v1:235349-235371 GTGTGTATGGGGAGGTGGTGTGG - Intergenic
1185566844 X:1101396-1101418 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185566875 X:1101596-1101618 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185566928 X:1101956-1101978 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185566978 X:1102236-1102258 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185567022 X:1102516-1102538 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185567037 X:1102636-1102658 GTGTGAATGGGGAAGGGCCATGG + Intergenic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1185886667 X:3789421-3789443 GTGTGTGTGGGGAGGGAGCAGGG - Intergenic
1186325076 X:8467179-8467201 GTGTGTGTGGGGAGGGAGGGAGG + Intergenic
1186338731 X:8620517-8620539 GTGAGAATGGGGAGGATGAACGG + Intronic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1186661253 X:11669511-11669533 GTGTGTACCTGGAGGGTTCATGG - Intergenic
1186732083 X:12420612-12420634 GTGTAAATGGGGATGGGGCAGGG - Intronic
1187607889 X:20906060-20906082 GTGTCTGTGGGGGGGATGCAGGG + Intergenic
1187943409 X:24403125-24403147 GGGCCTATGGGGAGGGGGCAGGG - Intergenic
1188981361 X:36730043-36730065 GTGTATATGTGGAGGGTGCAGGG - Intergenic
1189273383 X:39767498-39767520 GTGTGTGTGTGCAGGGGGCAAGG - Intergenic
1189692710 X:43633741-43633763 GTGTGTATATTGAGGGTGGAGGG + Intergenic
1190065563 X:47239485-47239507 TAATGGATGGGGAGGGTGCATGG + Intronic
1190595472 X:52049158-52049180 GTGGGTAGGGGGAGGGGGGAGGG + Intergenic
1190613352 X:52204915-52204937 GTGGGTAGGGGGAGGGGGGAGGG - Intergenic
1190666942 X:52704829-52704851 GTGTGTGTGGGGTGGGGGTAGGG + Intronic
1190672476 X:52753579-52753601 GTGTGTGTGGGGTGGGGGTAGGG - Intronic
1190739367 X:53279425-53279447 GAGTGTATGAGGAGAGTGCCTGG - Intronic
1191972387 X:66831633-66831655 GTGTATGTGGGGCGGGTGGAGGG - Intergenic
1192187078 X:68954814-68954836 GTGGATCTGGGGAGGGTGGATGG - Intergenic
1192301059 X:69903566-69903588 GTGTGTGTGCGGAGGGGGCCTGG - Intronic
1192556113 X:72090803-72090825 GTGTGTATGGAGAGGGGGTGGGG + Intergenic
1192864387 X:75115780-75115802 GTGTGTTGGGGGGGGGGGCACGG + Intronic
1193570610 X:83137323-83137345 GCGTGTGTAGGGGGGGTGCATGG - Intergenic
1193699410 X:84743571-84743593 GTGTGTATAGGGATGGTGTATGG - Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1194806816 X:98339328-98339350 GTGTGTGTGGGGTGGGAGAAGGG - Intergenic
1195339373 X:103891259-103891281 GTGTGGTGGGGGAGGGTGGAGGG - Intergenic
1195364434 X:104113055-104113077 GTGTGTTCGGGGAGGTGGCAAGG + Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195991889 X:110691205-110691227 GTGGGTCTGGGGAGGGAACAGGG - Intronic
1196196895 X:112846278-112846300 GTGTGGTTGGGAAGGGTGGAAGG - Intergenic
1196734758 X:118974120-118974142 GTGTGTGTGGGGGGGCTTCACGG + Intergenic
1196893611 X:120311932-120311954 GTGTGTGTGGGGCGGGGGGAGGG + Intergenic
1197206790 X:123797928-123797950 GTGTGTGGGGGGTGGGGGCAGGG - Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197853386 X:130888992-130889014 GTGTGTTGGGGGAGGATTCAAGG + Intronic
1199594168 X:149493568-149493590 GAGTGGATGGAGAGGCTGCAGGG + Intronic
1199609289 X:149599500-149599522 GTGTGTCTGGGGGGGGACCAGGG - Intronic
1199629828 X:149769854-149769876 GTGTGTCTGGGGGGGGACCAGGG + Intergenic
1199828306 X:151522755-151522777 GTGTGTAGGGTGAGGGGGAAGGG - Intergenic
1200044046 X:153391151-153391173 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1200044081 X:153391510-153391532 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1200044084 X:153391541-153391563 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1200044114 X:153391870-153391892 GTGTGTGTGGTGTGTGTGCATGG - Intergenic
1201075194 Y:10181439-10181461 GTGTGTGTGGGAAGGGGGTATGG + Intergenic
1201229700 Y:11852403-11852425 GTGTGTGTGGGTAGGGTGTGTGG - Intergenic