ID: 954288817

View in Genome Browser
Species Human (GRCh38)
Location 3:49638240-49638262
Sequence CTCTAACTGTACTGGCACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954288813_954288817 18 Left 954288813 3:49638199-49638221 CCTCTTGATGAGGAGGCATCACT 0: 1
1: 0
2: 1
3: 11
4: 107
Right 954288817 3:49638240-49638262 CTCTAACTGTACTGGCACTCAGG 0: 1
1: 0
2: 1
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954288817 Original CRISPR CTCTAACTGTACTGGCACTC AGG Intronic
903751077 1:25621139-25621161 CCCTAAGTGAACTGGCAGTCTGG + Intronic
904509763 1:30994309-30994331 CTCTACCTGTACTATCACACTGG + Intronic
905453159 1:38070048-38070070 CTGTGACTGTCCTGGCACTTGGG + Intergenic
907783115 1:57585284-57585306 CTCTTACTGTTCTGTCACTAAGG - Intronic
920953516 1:210597021-210597043 CTCTAACTGTATTTGCATTACGG + Intronic
920992536 1:210953495-210953517 CTCCAACTTTTCTGGCAATCTGG + Intronic
923029611 1:230237335-230237357 CTCTAACAGCACTGACACACTGG - Intronic
1063918418 10:10908077-10908099 CTCTGACTGTACGGGCAGGCCGG - Intergenic
1066370089 10:34813342-34813364 CTCAAATTGTTCAGGCACTCTGG - Intronic
1067672830 10:48340955-48340977 CTATAACTGTCCTGCCATTCTGG - Intronic
1068171993 10:53405696-53405718 ATCTTATTGTACTGGTACTCAGG + Intergenic
1071358664 10:84822934-84822956 CTCTGACTGAACAGGCACTGTGG + Intergenic
1071424603 10:85536434-85536456 GTCTAAATGTGCTGGCTCTCAGG - Intergenic
1074774388 10:116756250-116756272 TCCTAACTCTACTGTCACTCTGG + Intergenic
1084213618 11:67635061-67635083 CTCCAGCTGAACTGTCACTCTGG + Exonic
1086616282 11:88824453-88824475 CTCCAACTTTACTGGCACCAGGG + Intronic
1089926058 11:122258961-122258983 CTCTAACTCAACTGGCTCTAGGG + Intergenic
1099566902 12:84262299-84262321 CACTAACTGTACTCACTCTCGGG - Intergenic
1104243773 12:127017349-127017371 CTCTACCTATACTTGCTCTCTGG - Intergenic
1111696391 13:91630198-91630220 CTCTAACTGTAATGCCTCTTTGG + Intronic
1112165787 13:96918622-96918644 CTCTCACTGCACTGTCCCTCAGG - Intergenic
1116059241 14:39899715-39899737 CGCTAACTATACTGACACTTAGG + Intergenic
1116814917 14:49575011-49575033 CTCAAACTATACAGGCAGTCAGG + Exonic
1120441274 14:84543664-84543686 CTCTAACTGCACCTGAACTCAGG + Intergenic
1120981318 14:90291760-90291782 CTCAAACGCTCCTGGCACTCTGG + Intronic
1121175249 14:91885987-91886009 CTCTGACTGTCCTGGCCCTAGGG + Intronic
1130901526 15:88210256-88210278 CTCTAACTGTGCTGGCCTCCTGG + Intronic
1136024510 16:27461175-27461197 TTCCCACTGTACTGGAACTCTGG - Exonic
1137031568 16:35528856-35528878 CTCAACCTCTTCTGGCACTCAGG - Intergenic
1139630437 16:68228792-68228814 CTCTAACTGTGCTAGCTCTTGGG + Exonic
1141533237 16:84661162-84661184 TTCTAACTGTGCTGGCACTCGGG - Intronic
1141809983 16:86369289-86369311 CTCTTACTGTCCTGAGACTCGGG + Intergenic
1147899479 17:43774653-43774675 CTCTGACTGGACTGTCCCTCTGG - Intronic
1153747637 18:8196357-8196379 CTCTAACAGTAATAGCACTAAGG - Intronic
1153905542 18:9658363-9658385 CTGTAAGTGGACTGGCACCCAGG + Intergenic
1155387857 18:25300168-25300190 CTCAGACTGTACTGTCACTGGGG - Intronic
1156242045 18:35264163-35264185 CTCTGACTCCACTGGCCCTCGGG - Exonic
926089314 2:10040131-10040153 CTCTCCCTGAACTGGCACTCTGG - Intergenic
930507124 2:52297206-52297228 CTCAAACTGTATTTGCACTATGG - Intergenic
938388440 2:130884707-130884729 CTCTAACTCTGCTGCCACTCAGG - Intronic
943448166 2:188015820-188015842 CTATAACTATACTTCCACTCTGG + Intergenic
944111381 2:196134543-196134565 CTCCAACTGTTTTGGCACTAGGG - Exonic
948957742 2:241307019-241307041 CTTTGACTGTACTGGGAGTCAGG - Intronic
1171989527 20:31684988-31685010 CTCTAAATTTACTGGCTCTGGGG + Intronic
1177344701 21:19854164-19854186 CTCTAGGTGTGCTTGCACTCAGG - Intergenic
1179954667 21:44731860-44731882 CTCCAACTGTGCTGGCACCCTGG - Intergenic
1181413216 22:22739438-22739460 CTCTTACTGTCCTTCCACTCAGG - Intronic
952203566 3:31156323-31156345 ATCTCACTTTACTGGCACTGTGG + Intergenic
953122052 3:40054009-40054031 CGCTAACTGTTTTGTCACTCTGG + Intronic
954288817 3:49638240-49638262 CTCTAACTGTACTGGCACTCAGG + Intronic
955215981 3:56985444-56985466 CTCAGACTGTCCTGGCACTGGGG + Intronic
956533548 3:70249655-70249677 CTCTCACTGTGCTGGTACTGTGG - Intergenic
961483142 3:127196837-127196859 CTGTAACTGACCTGGCCCTCTGG + Exonic
963088928 3:141463925-141463947 CTCTCTCTGTCCTGGCATTCAGG - Intergenic
969406341 4:6995126-6995148 TTGTAACTGTACTGGCACTAGGG - Intronic
969843000 4:9897294-9897316 CTCCAACAGCACTGGCACTGGGG + Intronic
976271206 4:83231962-83231984 CTCTAAGTGTCCTTGCCCTCAGG - Intergenic
981850061 4:149219158-149219180 CTCTATCTGCAGTGGCAGTCAGG - Intergenic
984239462 4:177200170-177200192 CTGACACTGTACTGGCACTAAGG - Intergenic
984519550 4:180785417-180785439 CTCTAACTATTTTGGAACTCTGG - Intergenic
985010541 4:185578115-185578137 CCTTAACTATACTTGCACTCTGG + Intergenic
989257691 5:39382887-39382909 CTCTAACCGGACTGGCAAACAGG - Exonic
991980123 5:72221744-72221766 TTCTAACGGTGCAGGCACTCAGG - Intronic
993347697 5:86805487-86805509 CTCTCAGTGTGCTGCCACTCTGG + Intergenic
1003419852 6:5947506-5947528 TTCTAACTGTACTTGGACCCTGG + Intergenic
1004443577 6:15676603-15676625 CTCTATCTGTACTTGAACTTAGG + Intergenic
1008279762 6:49582725-49582747 CTTCAACTGTACTGTCTCTCTGG + Intergenic
1009279644 6:61731504-61731526 CTTTTACTGTGCTGTCACTCAGG + Intronic
1016274609 6:142334469-142334491 CTCTAACTCTACAGGCACTTGGG - Intronic
1022384983 7:29891431-29891453 CTCTAAATGTACAGCCACGCAGG - Intronic
1022579755 7:31539583-31539605 CTCTTACAGTACAGGCACTTTGG - Intronic
1031116654 7:117676182-117676204 CTGTAACTGTACTATCACCCTGG - Intronic
1035907901 8:3533825-3533847 CTCTAACTGTACAGCTACTTGGG - Intronic
1037482705 8:19319461-19319483 CTCCACCTGTGCTGGCACTTGGG - Exonic
1049390269 8:142364168-142364190 CTCTCCCTGCACTGGCACTAAGG + Intronic
1052730155 9:32276016-32276038 CAGCAACTGTGCTGGCACTCTGG - Intergenic
1203364988 Un_KI270442v1:248941-248963 CTCTCACTGGACTTGGACTCAGG - Intergenic
1185788052 X:2907253-2907275 CTCTCACAGTCCTGGCATTCAGG + Exonic
1190688355 X:52893619-52893641 CTCCCACTGTCCTGGCACGCTGG - Intronic
1190697628 X:52962173-52962195 CTCCCACTGTCCTGGCACGCTGG + Intronic
1192052466 X:67737675-67737697 CTATAACTGCTCTGGTACTCTGG - Intergenic
1193703430 X:84791281-84791303 CTCTGACTGCAGTGGCAGTCTGG - Intergenic
1196982651 X:121232036-121232058 CTCCAACTGCAATGGCAATCTGG + Intergenic