ID: 954290868

View in Genome Browser
Species Human (GRCh38)
Location 3:49649320-49649342
Sequence TGGTGGGAGCCTGTATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 704
Summary {0: 1, 1: 0, 2: 3, 3: 51, 4: 649}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954290860_954290868 16 Left 954290860 3:49649281-49649303 CCTTGTGGTTCTTATGGTCCACC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 954290868 3:49649320-49649342 TGGTGGGAGCCTGTATGTCCAGG 0: 1
1: 0
2: 3
3: 51
4: 649
954290865_954290868 -5 Left 954290865 3:49649302-49649324 CCTCGGTGGCAGAGTTGCTGGTG 0: 1
1: 0
2: 0
3: 21
4: 357
Right 954290868 3:49649320-49649342 TGGTGGGAGCCTGTATGTCCAGG 0: 1
1: 0
2: 3
3: 51
4: 649
954290863_954290868 -2 Left 954290863 3:49649299-49649321 CCACCTCGGTGGCAGAGTTGCTG 0: 1
1: 0
2: 1
3: 10
4: 132
Right 954290868 3:49649320-49649342 TGGTGGGAGCCTGTATGTCCAGG 0: 1
1: 0
2: 3
3: 51
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954290868 Original CRISPR TGGTGGGAGCCTGTATGTCC AGG Intronic
900332092 1:2140522-2140544 TGGTGGGTGCCTGTAATCCCAGG + Intronic
900599154 1:3495770-3495792 TGGTGGCAGCCAGGATGTGCGGG + Intronic
901041230 1:6364888-6364910 TGGTGGGAGCCTGTAATCCCAGG + Intronic
901253533 1:7800338-7800360 TGGTGGGCGCCTGTAATCCCAGG - Intronic
901650789 1:10742031-10742053 TGCTGGGAGCCAGTGTGTCTCGG - Intronic
901736900 1:11318450-11318472 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
901931278 1:12597207-12597229 TGGTGGGCGCCTGTAATCCCAGG - Intronic
901941339 1:12664497-12664519 TGGTGGGAGCCTGTAATCCCAGG - Intronic
902322101 1:15675298-15675320 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
902367657 1:15987810-15987832 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
902405533 1:16181484-16181506 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
902459093 1:16558162-16558184 TGGTGTGAGCCTGTAGTCCCAGG + Intergenic
902493062 1:16849772-16849794 TGGTGTGAGCCTGTAGTCCCAGG - Intronic
902500803 1:16910376-16910398 TGGTGGGTGCCTGTAATCCCAGG + Intronic
902586997 1:17445759-17445781 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
903152286 1:21418858-21418880 TGGTGTGAGCCTGTAGTCCCAGG + Intergenic
904101749 1:28035945-28035967 TGGTGGGTGCCTGTAATCCCAGG - Intronic
904204590 1:28845354-28845376 TGGTGGGAGCCTATAATCCCAGG + Intronic
904476678 1:30769477-30769499 TGGTGGGACCGTGTTGGTCCTGG - Intergenic
904663920 1:32105553-32105575 TGGTTGGAGCCTGCATTGCCTGG + Intergenic
904719636 1:32498410-32498432 TGGCGGGAGCCTGTAATCCCAGG + Intronic
904732437 1:32605016-32605038 TGGTGGGTGCCTGTAATCCCAGG + Exonic
905077255 1:35283468-35283490 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
905564296 1:38951425-38951447 CGGTGGGAGCCTGTAATCCCAGG - Intergenic
905721143 1:40203408-40203430 TGGTGGGCGCCTGTAATCCCAGG + Intronic
906076377 1:43055174-43055196 TGGTGGGAGCCTGAATGTGCCGG + Intergenic
906162728 1:43662473-43662495 TGGTGGGTGCCTGTAATCCCAGG + Intronic
906174329 1:43757035-43757057 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
906462329 1:46044421-46044443 GGGTGGCAGCCTGTAGGTTCAGG - Intronic
906879219 1:49572575-49572597 TCCTGGGAGAGTGTATGTCCAGG + Intronic
907074830 1:51568697-51568719 TGGCGGGAGCCTGTAATTCCAGG - Intergenic
907178067 1:52544152-52544174 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
907437251 1:54457850-54457872 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
907806758 1:57828076-57828098 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
907896550 1:58698231-58698253 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
908489619 1:64630431-64630453 TGGTGGGTGCCTGTAATCCCAGG - Intronic
909804595 1:79858694-79858716 GGGTGGGAGCCTGTAACTCCTGG + Intergenic
910253047 1:85218548-85218570 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
911836052 1:102620306-102620328 TGTTGGGAGGATGTGTGTCCAGG + Intergenic
912297475 1:108484443-108484465 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
912691679 1:111809439-111809461 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
913606492 1:120471989-120472011 TGGTGTGAGCCTGTAGTCCCAGG - Intergenic
913988780 1:143589423-143589445 TGGTGTGAGCCTGTAGTCCCAGG + Intergenic
914209937 1:145568149-145568171 TGGTGTGAGCCTGTAGTCCCAGG + Intergenic
914268861 1:146060527-146060549 TGGTGTGAGCCTGTAGTCCCAGG + Intergenic
914368235 1:147000342-147000364 TGGTGTGAGCCTGTAGTCCCAGG - Intergenic
914584704 1:149049850-149049872 TGGTGTGAGCCTGTAGTCCCAGG + Intergenic
914861229 1:151387973-151387995 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
915104338 1:153523148-153523170 TTGTGGGAGCCTGTACTCCCAGG + Intergenic
915388717 1:155520727-155520749 TGGTGGGTGCCTGTAATCCCAGG + Intronic
915717490 1:157958215-157958237 TGGTGGGAGTCTTTATGCCATGG - Intergenic
916032250 1:160887588-160887610 TGGTGTGTGCCTGTATTCCCAGG - Intergenic
916050547 1:161033514-161033536 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
916081036 1:161232428-161232450 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
916101461 1:161396641-161396663 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
917392016 1:174547482-174547504 TAGTGTGTGCCTGTATGCCCAGG + Intronic
918328518 1:183433279-183433301 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
918623909 1:186636301-186636323 TGGTGGAAGCCTGTAATCCCAGG + Intergenic
918685148 1:187405588-187405610 TAGTGGGAGCATTTATGTCAAGG - Intergenic
919859460 1:201729771-201729793 TGGCGGGAGCCTGTAGTCCCAGG + Intronic
920624466 1:207583085-207583107 TGGACTGAGCCTGGATGTCCAGG + Intronic
921248006 1:213266768-213266790 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
921349509 1:214221411-214221433 TGGTGGGCGCCTGTAGTTCCAGG - Intergenic
922110983 1:222555085-222555107 AGGTGTGAGGCTGTATCTCCTGG - Intergenic
922208371 1:223468581-223468603 TGGTGGGACCCTGTCTGCCCTGG + Intergenic
922392206 1:225156427-225156449 TGGTGGTTGCCTGCATTTCCTGG + Intronic
922552043 1:226501984-226502006 TCTTGGGAGGGTGTATGTCCAGG + Intergenic
922638060 1:227196470-227196492 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
922794734 1:228334463-228334485 CGGTGGGGGCCTGTGTGTGCTGG + Intronic
923165642 1:231358900-231358922 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1063224644 10:4004398-4004420 GGGTGGGGGCCTGAGTGTCCTGG + Intergenic
1063591416 10:7399363-7399385 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1063635526 10:7778604-7778626 TGGCGGGCGCCTGTAGTTCCAGG + Intronic
1063946096 10:11177903-11177925 TGGGTGAAGCCAGTATGTCCTGG + Intronic
1064066826 10:12189236-12189258 TGGTAGGAGCCTGTAATCCCAGG - Intronic
1064455347 10:15482670-15482692 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1065018173 10:21480525-21480547 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1065236898 10:23661205-23661227 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1065351977 10:24803993-24804015 TGGTGGGTGCCTGTAATTCCAGG - Intergenic
1065468651 10:26053690-26053712 TGGTGTGTGCCTGTAATTCCAGG + Intronic
1066295907 10:34054374-34054396 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1066958762 10:42200293-42200315 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1069432431 10:68349669-68349691 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1069444268 10:68458398-68458420 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1069501797 10:68959359-68959381 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1069785288 10:70983943-70983965 TGGTAGGAGCCTTTGTGTGCTGG + Intergenic
1070059878 10:72971608-72971630 TGGTGTGAGCCTGTAGTTCTAGG - Intergenic
1072242290 10:93507779-93507801 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1073232233 10:101981884-101981906 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1073278898 10:102337243-102337265 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1073636882 10:105208206-105208228 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1073788882 10:106919776-106919798 TGGAGTGACCATGTATGTCCTGG + Intronic
1073934234 10:108611661-108611683 TGGTGTGGGCCTGTATTTCCAGG + Intergenic
1074311984 10:112329988-112330010 TGGTGGGTGCCTGTAATTCCAGG + Intergenic
1075118585 10:119647853-119647875 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1075684777 10:124355868-124355890 TGGTGGGCGCCTGTAACTCCAGG + Intergenic
1075884001 10:125881248-125881270 TGGTGGGTTCCGGTATTTCCTGG + Exonic
1076457528 10:130611080-130611102 TGGTGGGAGTATGTCTATCCTGG + Intergenic
1077067385 11:648325-648347 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1077202251 11:1316127-1316149 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1077546537 11:3172957-3172979 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1077642711 11:3896035-3896057 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1078052630 11:7980285-7980307 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1078232447 11:9455615-9455637 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1078486326 11:11726551-11726573 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1078547597 11:12257203-12257225 TGGTGGGCACCTGTGTGCCCAGG + Intronic
1079708866 11:23655382-23655404 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1080394030 11:31873646-31873668 TGGTGGGAGCCTGTAATCCCAGG + Intronic
1080531519 11:33181091-33181113 TGGTGGGAGCTGGAATGTCTGGG - Intergenic
1080557244 11:33429102-33429124 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1080923626 11:36733430-36733452 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1081766779 11:45616851-45616873 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1082679051 11:56145706-56145728 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1083211342 11:61189014-61189036 TGGTGTGTGCCTGTAGTTCCAGG - Intergenic
1083978465 11:66143770-66143792 TGGTGTGAGCCTGTAAACCCAGG - Intronic
1085100809 11:73798208-73798230 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1085145053 11:74188029-74188051 TGGAGGCAGCCTGTATTTCTTGG - Intronic
1085327506 11:75618472-75618494 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1086507705 11:87523075-87523097 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1088252673 11:107874739-107874761 TGGCGGGTGCCTGTAATTCCAGG - Intronic
1088523857 11:110730121-110730143 TGGTGGGTGCCTGTAACTCCAGG + Intergenic
1088614758 11:111614214-111614236 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1089456849 11:118630878-118630900 TGGTGTGTTCCTGTGTGTCCTGG + Intronic
1089749147 11:120638010-120638032 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1090095843 11:123741325-123741347 TGGCCGGAGCCAGTATCTCCGGG - Intronic
1090474234 11:127004934-127004956 GGGTGGCAGCCTTTATGACCTGG + Intergenic
1091747878 12:3004074-3004096 TGGTGGGAGCCAGCGTATCCTGG - Intronic
1092342970 12:7692153-7692175 TGGTGTGAGCCACCATGTCCCGG - Intronic
1092378529 12:7975784-7975806 TGGTGTGTGCCTGTAATTCCAGG + Intergenic
1092524618 12:9302120-9302142 TGGTGGCTTCCTGTGTGTCCAGG + Intergenic
1092542647 12:9429692-9429714 TGGTGGCTTCCTGTGTGTCCAGG - Intergenic
1092638286 12:10475868-10475890 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1094032233 12:26025422-26025444 TGGCGGGCGCCTGTATTCCCAGG + Intronic
1094510365 12:31092738-31092760 TGGTGGCTTCCTGTGTGTCCAGG + Intronic
1094667733 12:32538027-32538049 TGGTGTGTGCCTGTAAGTCCTGG - Intronic
1094749991 12:33394953-33394975 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1095084379 12:38045623-38045645 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1095254030 12:40012625-40012647 AGGTAGAAGCATGTATGTCCTGG - Intronic
1095730135 12:45497694-45497716 TGGTGGGATCTTGGCTGTCCAGG - Intergenic
1096299939 12:50417991-50418013 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1096354827 12:50931576-50931598 TGGTGGGTGCCTGTAATCCCAGG + Exonic
1096703246 12:53401316-53401338 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1096930015 12:55197487-55197509 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1097024064 12:56041343-56041365 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1097252370 12:57643041-57643063 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1097692772 12:62748760-62748782 TGGTAGGAGCCTGTGTGTTGTGG + Intronic
1098928625 12:76382748-76382770 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1098988987 12:77044097-77044119 TGCTGGTAGCCTGTAAGCCCTGG - Intronic
1099877821 12:88431089-88431111 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1099932140 12:89087058-89087080 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1100047985 12:90408053-90408075 TGGTGGGAGTATGTATGTGTGGG + Intergenic
1101029313 12:100644381-100644403 TGGTGGGGGCCTTTATATTCAGG + Intergenic
1101087263 12:101249074-101249096 GGGTGGGAGCCTGCAGTTCCTGG - Intergenic
1101911709 12:108864959-108864981 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1101937106 12:109067244-109067266 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1102154328 12:110712505-110712527 TGGTGGGTGCCTGTAATTCCAGG + Intergenic
1102281484 12:111622232-111622254 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1102554478 12:113717896-113717918 TGGTGGGGGCCTGGATGTGAAGG + Intergenic
1102892251 12:116568990-116569012 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1103222995 12:119261812-119261834 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1103684008 12:122716971-122716993 TGGTGGGTTCCTGTATGCCCAGG - Intergenic
1103781221 12:123399954-123399976 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1103800778 12:123535524-123535546 TGGTGAGAGCCTGTAGTCCCAGG + Intergenic
1103832773 12:123793469-123793491 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1103939149 12:124492592-124492614 TGGCGGGAACCTGGCTGTCCTGG - Intronic
1103974630 12:124694451-124694473 TGGTGGGAGTCTTTGTGTCCGGG - Intergenic
1104154878 12:126121628-126121650 TGGTGGGCACCTGTAGTTCCAGG + Intergenic
1104310414 12:127649705-127649727 TGGTGGGAGCCTGCCTGTGGAGG + Intergenic
1104523661 12:129498384-129498406 TGGTGTGAGCCTGTAACCCCGGG - Intronic
1104907489 12:132221526-132221548 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1105596627 13:21845281-21845303 TGGTGCGAGCCTGTAGTCCCAGG - Intergenic
1105723538 13:23139445-23139467 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1108731901 13:53243991-53244013 GAGTGGCAACCTGTATGTCCAGG - Intergenic
1108846177 13:54680139-54680161 GGGTGGGAGCCTGTGACTCCTGG - Intergenic
1109531252 13:63651095-63651117 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1111114489 13:83757536-83757558 TGGTGGGGGTGTATATGTCCAGG - Intergenic
1111928006 13:94483632-94483654 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1112218530 13:97461828-97461850 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1112305376 13:98268598-98268620 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1112353703 13:98657170-98657192 TGGCGGGTGCCTGTAATTCCAGG + Intergenic
1112400046 13:99068450-99068472 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1112419677 13:99236715-99236737 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1113329471 13:109314618-109314640 TGGTGGGAGCCTGTAGTCCCAGG - Intergenic
1114235630 14:20821093-20821115 TGGCGGGAGCCTGTAATCCCAGG + Intergenic
1114321756 14:21552431-21552453 TGGTGGCAGCCTGTAGTTTCAGG + Intergenic
1114737332 14:25055770-25055792 TGGTGGGAGGATGTATGTAAAGG + Intergenic
1115005144 14:28473432-28473454 TGGTGGGAGACGGTATCTCATGG + Intergenic
1115194848 14:30785970-30785992 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1115600755 14:34953650-34953672 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1116913444 14:50496191-50496213 TGGTGGGAGCCTGTAATCCCAGG + Intronic
1117151309 14:52890928-52890950 TGGTGGAAGCCTGTAGGTTGAGG - Intronic
1117434549 14:55703562-55703584 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1117698703 14:58392402-58392424 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1118163556 14:63314543-63314565 TGGTGGGTGCCTGTAGTCCCGGG - Intronic
1118797943 14:69161066-69161088 TGGTGGGCGCCTGTAAGTCCAGG + Intergenic
1119743903 14:77030860-77030882 TGGCGGGCGCCTGTATCCCCAGG - Intergenic
1122550547 14:102546819-102546841 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1123017910 14:105384340-105384362 GGGTGGGAGCCTGCATGCCAGGG - Exonic
1123055000 14:105565558-105565580 TTGTGGGAGGCTGTATGTGCAGG + Intergenic
1123079447 14:105685402-105685424 TTGTGGGAGGCTGTATGTGCAGG + Intergenic
1123418599 15:20113195-20113217 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1123502248 15:20899616-20899638 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1123527818 15:21119735-21119757 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1123559497 15:21473299-21473321 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1123595733 15:21910599-21910621 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1123714863 15:23020272-23020294 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1124412009 15:29444597-29444619 TGGTGGGCGCCTGTAGTGCCAGG - Intronic
1125017840 15:34954988-34955010 TGGTGTGTGCCTGTAGTTCCAGG + Intronic
1125570012 15:40709504-40709526 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1125896441 15:43306759-43306781 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1127940976 15:63695517-63695539 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1128150174 15:65358236-65358258 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1128461417 15:67870628-67870650 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1128502616 15:68237988-68238010 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1128545796 15:68566736-68566758 GGGAGGGAGCCTGTATATCCAGG + Intergenic
1130251847 15:82304892-82304914 GGGTGGGAGCCTGCATCTCAGGG + Intergenic
1132067851 15:98747327-98747349 CGGTGGGTGCCTGTAATTCCAGG - Intronic
1132202509 15:99964585-99964607 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1202967843 15_KI270727v1_random:200459-200481 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1132531448 16:452200-452222 TGGTGGGGGCCTGTAGTCCCAGG + Intronic
1132979148 16:2726541-2726563 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1133114334 16:3567637-3567659 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1133331483 16:4977312-4977334 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1133806851 16:9132247-9132269 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1133968662 16:10550840-10550862 TGGTGGGCACCTGTAATTCCAGG + Intronic
1134105606 16:11484138-11484160 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1134738905 16:16524938-16524960 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1134778437 16:16873240-16873262 TGGTGGGCACCTGTAATTCCAGG + Intergenic
1134928594 16:18187215-18187237 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1135058210 16:19248687-19248709 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1135075841 16:19392934-19392956 TGGTGGGAGCCTGCAATTACAGG - Intergenic
1135316887 16:21454869-21454891 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1135369810 16:21887110-21887132 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1135442004 16:22484012-22484034 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1135668676 16:24356567-24356589 TGGTGGGTGCCTATAGTTCCAGG + Intronic
1136050100 16:27644152-27644174 TGGTGTGTGCCTGTAGTTCCAGG - Intronic
1136071003 16:27787082-27787104 TGGTTGGAGCCTGTCTGCTCAGG + Intergenic
1136313712 16:29435042-29435064 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1136327154 16:29536808-29536830 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1136351909 16:29715876-29715898 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1136441843 16:30276793-30276815 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1137602540 16:49766363-49766385 TGTTGGGAGCCTGTGTGAGCAGG - Intronic
1137724088 16:50645454-50645476 TGGTGCAGGCCTGTATGGCCGGG + Intergenic
1137958227 16:52854249-52854271 CTTTGGGAGCCTGTATGTACTGG + Intergenic
1138688962 16:58750084-58750106 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1139017001 16:62701989-62702011 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1139353277 16:66351219-66351241 TGCTGGGACCCTTTATCTCCTGG - Intergenic
1139644332 16:68317103-68317125 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1139888643 16:70230520-70230542 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1140081981 16:71756807-71756829 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1140387520 16:74554399-74554421 TGGTGGGCGCCTGTAACCCCAGG + Intronic
1140495810 16:75387271-75387293 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1140784666 16:78328992-78329014 TGATGGGAGCCTGTAGTCCCAGG - Intronic
1141303790 16:82841916-82841938 TGATGGGAGCATTTATGCCCTGG + Intronic
1141504737 16:84468495-84468517 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1142042374 16:87902777-87902799 TGGCGGGAGCCTGTAGTCCCAGG + Intronic
1142302988 16:89269726-89269748 TGGTGCGTGCCTGTAATTCCGGG - Intronic
1142892311 17:2951899-2951921 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1143859449 17:9877742-9877764 TGGCGGGCGCCTGTATTCCCAGG + Intronic
1143942800 17:10560207-10560229 TGGTGGGCGCCTGTAATTCCAGG - Intergenic
1144345174 17:14343107-14343129 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1144637400 17:16919010-16919032 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1145744125 17:27301002-27301024 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1145930807 17:28683966-28683988 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1145960154 17:28882542-28882564 TGATGGGAAGCTGTATCTCCTGG - Intronic
1146047874 17:29525535-29525557 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1146166348 17:30592492-30592514 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1146346056 17:32061312-32061334 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1146718875 17:35108997-35109019 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1146789621 17:35743966-35743988 TTGTGGGAGCCTGTGTGTTGAGG + Intronic
1147651792 17:42066934-42066956 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1147891274 17:43719043-43719065 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1149318572 17:55461785-55461807 TGGTGGGAGTCTGTACTTTCTGG - Intergenic
1149367976 17:55964770-55964792 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1149445576 17:56710772-56710794 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1149510344 17:57236077-57236099 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1150060120 17:62060485-62060507 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1150068922 17:62135927-62135949 TCGTGGCATCCAGTATGTCCTGG - Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151916976 17:77125669-77125691 AGGTAGGTGCCTGTGTGTCCTGG - Intronic
1152184940 17:78849769-78849791 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1152422130 17:80199353-80199375 TGGTGGGCGCCTGCATGGTCAGG + Intronic
1152475102 17:80512751-80512773 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1152695120 17:81740336-81740358 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1154001807 18:10487933-10487955 TGGAAGCAGCCTGTATGGCCGGG + Exonic
1154295343 18:13142283-13142305 TGGAGGCAGCCTGTGTGTCAGGG - Intergenic
1155035853 18:22024374-22024396 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1155441711 18:25869465-25869487 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1155971850 18:32091098-32091120 TGGTGGGAGCCTGTAATCCCAGG - Intergenic
1156567721 18:38214708-38214730 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1156781601 18:40857217-40857239 TGGTGTGTGCCTGTGTGTCAGGG - Intergenic
1157256371 18:46143296-46143318 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1157370679 18:47108803-47108825 TGGTGGCAGCCTGTGTTTACTGG - Intronic
1158452919 18:57582788-57582810 TGGCGGGTGCCTGTAGTTCCAGG + Intronic
1158487549 18:57880996-57881018 TGGTGGGTGCCTGTAATGCCAGG - Intergenic
1158611324 18:58943290-58943312 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1159050948 18:63420903-63420925 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1159285507 18:66344364-66344386 TGGTGCGTGCCTGTAGTTCCAGG - Intergenic
1160704116 19:521615-521637 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1160712716 19:560006-560028 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1160850318 19:1188172-1188194 TGGTGGGCGCCTGTAGTTCCAGG - Intronic
1160934316 19:1585969-1585991 TGGTGGGTGTCCTTATGTCCTGG - Intronic
1160998583 19:1896964-1896986 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1161126497 19:2560822-2560844 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1161422892 19:4185340-4185362 AGGTGGGAGGATGGATGTCCAGG + Intronic
1161496519 19:4589323-4589345 TGGTGGGAGCCTGTAATCCCAGG + Intergenic
1161558156 19:4956065-4956087 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1161814836 19:6493802-6493824 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1161953315 19:7479349-7479371 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1162011975 19:7822756-7822778 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1162963612 19:14144332-14144354 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1162989834 19:14294777-14294799 TGGTGGGCGCCTGTAGTTCCAGG + Intergenic
1163142200 19:15357294-15357316 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1163340120 19:16700440-16700462 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1163380885 19:16967674-16967696 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1163772195 19:19197877-19197899 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1163813404 19:19448619-19448641 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1163858274 19:19723806-19723828 TCTTGGGAGGGTGTATGTCCAGG + Intronic
1163873243 19:19843198-19843220 TGGTAGGAGCCTGTAATTTCAGG + Intergenic
1163923097 19:20311925-20311947 TGGTGGGCGCCTGTAGTGCCAGG + Intergenic
1163973402 19:20824011-20824033 TGGTGGGCGCCTGTAAGCCCAGG - Intronic
1164061735 19:21681247-21681269 TGGTGGGTGCCTGTATTCCCAGG + Intergenic
1164651329 19:29892916-29892938 TGGTGGGTGCCTGTAAACCCAGG - Intergenic
1164847587 19:31447673-31447695 TGGTGGGATGCTCTCTGTCCTGG + Intergenic
1165027933 19:32975300-32975322 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1165193381 19:34081814-34081836 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1165508312 19:36249246-36249268 TGGTGGGCGCCTGTATTCCCAGG + Intergenic
1165527195 19:36366133-36366155 TGGTGGGCGCCTGTAACTCCAGG + Intronic
1165697976 19:37915512-37915534 CGGTGGGCGCCTGTAACTCCAGG - Intronic
1165788577 19:38477273-38477295 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1165848024 19:38831498-38831520 TAGTTGGAGCCTGTCAGTCCTGG + Exonic
1165881185 19:39045146-39045168 TGGTGTGTGCCTGTAATTCCAGG + Intergenic
1166141799 19:40809158-40809180 TGGTGGGTGCCTGTAATACCAGG + Intronic
1166350439 19:42195463-42195485 TGGCGGGCGCCTGTAGTTCCAGG - Intronic
1166760574 19:45221778-45221800 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
1166788197 19:45382109-45382131 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1167188015 19:47961427-47961449 TGGTGGGGGCCTGTAATCCCAGG + Intergenic
1167580958 19:50342529-50342551 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1167895676 19:52578888-52578910 TGGCGGGAGCCTGTAGTCCCAGG - Intronic
1168061593 19:53895925-53895947 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1168501692 19:56898570-56898592 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1168599039 19:57703351-57703373 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1202675340 1_KI270711v1_random:344-366 TGGTGTGAGCCTGTAGTCCCAGG + Intergenic
1202708384 1_KI270714v1_random:1721-1743 TGGTGTGAGCCTGTAGTCCCAGG - Intergenic
926277626 2:11416729-11416751 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
926352251 2:12006680-12006702 TGCTGGGAGCCTTTTTGTCCTGG + Intergenic
928087262 2:28353494-28353516 TGGTGCGAGCCTGTAATCCCAGG - Intergenic
928587462 2:32775328-32775350 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
928624061 2:33121491-33121513 TGGTGGGTGCCTGTGCTTCCAGG - Intronic
928939907 2:36717298-36717320 TGGTGGGAGCCTGTAGTCCCAGG - Intronic
928981663 2:37142261-37142283 TGGTGTGTGCCTGTAGTTCCAGG - Intronic
929515604 2:42603881-42603903 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
929828009 2:45325078-45325100 TGGTGGGTTCCTGTATCTTCTGG - Intergenic
930659227 2:54037243-54037265 TGGTGGGCGCCTGTAATCCCAGG - Intronic
930962466 2:57277600-57277622 TGGCTGGAGCCAGAATGTCCAGG - Intergenic
931736279 2:65197639-65197661 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
931775197 2:65534305-65534327 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
932153796 2:69396937-69396959 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
932420122 2:71596638-71596660 TGGTGGGAGCCTCTCTGGCATGG - Intronic
933417795 2:82008906-82008928 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
934060781 2:88290929-88290951 CGGTGGGAGCCTGTAATCCCAGG + Intergenic
934117214 2:88809341-88809363 TGGTGGGACCCTGTGTTTCAAGG + Intergenic
934270812 2:91535661-91535683 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
934957125 2:98631975-98631997 TGGTGGGCGCCTGTAATCCCAGG + Intronic
936160660 2:110081984-110082006 TGGTGGGACCCTGTGTCTCAAGG + Intergenic
936184004 2:110289370-110289392 TGGTGGGACCCTGTGTCTCAAGG - Intergenic
937365227 2:121256642-121256664 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
937988045 2:127647461-127647483 TGGTGGGGGCCTGCCTGTGCTGG - Intronic
938227452 2:129628107-129628129 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
938245365 2:129772665-129772687 TGGTGGGAGGCAGTATGACGTGG - Intergenic
938600554 2:132834475-132834497 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
939320949 2:140621251-140621273 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
939524254 2:143272518-143272540 TGGTGGGCGCCTGTAATCCCAGG + Intronic
940278640 2:151966411-151966433 TGGTGGGTGCCTGTAATCCCAGG - Intronic
941804400 2:169695502-169695524 TGGCGGGCGCCTGTAGTTCCAGG + Intronic
941843333 2:170110481-170110503 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
942159293 2:173165282-173165304 TGGTGCGTGCCTGTAATTCCAGG + Intronic
942174090 2:173314427-173314449 TGGTGGGTGCCTGTAAGTCAAGG - Intergenic
943615164 2:190084223-190084245 TGGTGGGCGCCTGTAATCCCAGG - Intronic
944555611 2:200884931-200884953 TGGTGGGTGCCTGTAATCCCAGG + Intronic
944999331 2:205331648-205331670 TGGTGGGTGCCTGTAATCCCAGG + Intronic
945237442 2:207644608-207644630 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
945873182 2:215249402-215249424 TGGCGGGAGCCTGTAATCCCAGG - Intergenic
946026374 2:216674115-216674137 TGGGGGGAGCTTGTAGTTCCTGG + Exonic
946318599 2:218934271-218934293 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
946493296 2:220170896-220170918 TGGTGGGGGCCTGTAATCCCAGG + Intergenic
948019694 2:234720320-234720342 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
948476433 2:238223480-238223502 TGGTGGGCGCCTGTATTCCCAGG - Intergenic
948784769 2:240346632-240346654 TGTGGGGAGCCTGTATGTGCAGG - Intergenic
948784780 2:240346690-240346712 GTGTGGGAGCCTGTGTGTGCAGG - Intergenic
948784799 2:240346801-240346823 GTGTGGGAGCCTGTGTGTGCAGG - Intergenic
948966741 2:241387658-241387680 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
949007333 2:241657106-241657128 TGGCGGGTGCCTGTAATTCCAGG - Intronic
1168751192 20:282737-282759 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1169519015 20:6351230-6351252 CAGTGGGAACCTGTATGACCCGG + Intergenic
1169659503 20:7962669-7962691 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1169667110 20:8049982-8050004 TGGTGAGTGCCTGTAATTCCTGG - Intergenic
1170625406 20:18026512-18026534 TGGCGGGTGCCTGTAGTTCCAGG - Intronic
1171118258 20:22545885-22545907 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1171273514 20:23835066-23835088 TGGTGGGAGTCTGCAGTTCCTGG - Intergenic
1171453669 20:25253937-25253959 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1172084910 20:32373732-32373754 TGGTGGGTGCCTGTAATTCCAGG + Intronic
1172464863 20:35148577-35148599 TGGCGGGTGCCTGTAAATCCCGG + Intergenic
1173893585 20:46532378-46532400 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1173984730 20:47252159-47252181 TGGTGGGTGCCTGTAATCCCCGG + Intronic
1174296127 20:49546355-49546377 TGCTTGGAGCCTGAGTGTCCTGG - Intronic
1174622084 20:51883267-51883289 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1174649798 20:52115070-52115092 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1175235743 20:57509835-57509857 TGCTGGGAGCCTGACTCTCCAGG + Intronic
1175377149 20:58535868-58535890 TGGTGGGTGCCTGCAATTCCAGG - Intergenic
1175750860 20:61496267-61496289 TGGTGTGTGCCTGTATTCCCAGG + Intronic
1175756124 20:61531337-61531359 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1176415793 21:6474104-6474126 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1176645099 21:9342195-9342217 TGGTGGGAGCAGGTATGACTGGG + Intergenic
1176669817 21:9722669-9722691 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1176838383 21:13816253-13816275 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1176977979 21:15345873-15345895 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1177525310 21:22283186-22283208 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1177612193 21:23466134-23466156 TGGTGTGTGCCTGTAGTTCCAGG + Intergenic
1177742840 21:25174679-25174701 TGGTGGGCACCTGTAGTTCCAGG - Intergenic
1177792030 21:25732511-25732533 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
1179168489 21:38954281-38954303 TGGTGGGTGCCGGTGTATCCTGG + Intergenic
1179636822 21:42717421-42717443 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1179691293 21:43082438-43082460 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1180137541 21:45871233-45871255 TGGGGGGTGCCTGTCTCTCCCGG - Intronic
1180228846 21:46414359-46414381 GGGTGGGTGGCTGTGTGTCCAGG - Intronic
1180228893 21:46414546-46414568 GGGTGGGCGGCTGCATGTCCAGG - Intronic
1180228920 21:46414645-46414667 GGGTGGGTGGCTGCATGTCCAGG - Intronic
1180228960 21:46414801-46414823 GGGTGGGCGGCTGCATGTCCAGG - Intronic
1180367854 22:11957039-11957061 TGGTGGGAGCAGGTATGACTGGG - Intergenic
1180835811 22:18928840-18928862 AGGTGGGAGCCTGGAGGTGCAGG - Intronic
1181452206 22:23030995-23031017 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1182382332 22:29902497-29902519 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1182535710 22:31001274-31001296 TGGTGCATGCCTGTATTTCCAGG + Intergenic
1182583793 22:31331257-31331279 TGGTGGGAGCCAATGTCTCCTGG - Intronic
1182704465 22:32267989-32268011 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1183419845 22:37705240-37705262 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1183651992 22:39161695-39161717 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1183907901 22:41056282-41056304 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1184112670 22:42404371-42404393 TGGAGGGAGCCTCTTTCTCCTGG + Intronic
1184545668 22:45165147-45165169 TGGTGGGAGACTGAAAGTCTAGG - Intronic
1184613235 22:45619456-45619478 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1185294393 22:50046158-50046180 CGGTGGGAGCATGGATGTGCAGG + Intronic
1203285902 22_KI270734v1_random:154139-154161 AGGTGGGAGCCTGGAGGTGCAGG - Intergenic
949802928 3:7923166-7923188 TGGTAGGTGCCTGTAATTCCAGG - Intergenic
950065205 3:10106779-10106801 TGGTGGGTGCCTGTAATCCCGGG + Intronic
950115968 3:10450531-10450553 TGGTGGGGGCCTGTGGGTGCAGG - Intronic
950597827 3:14000347-14000369 TGGTGCGCGCCTGTAATTCCAGG + Intronic
950665853 3:14494608-14494630 TGGTGGGGGCCTTCTTGTCCCGG - Intronic
950735199 3:15001748-15001770 TGGTACGTGCCTGTAAGTCCCGG - Intronic
953007936 3:38995251-38995273 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
953913799 3:46905663-46905685 TGGGGGTACCCAGTATGTCCTGG - Intergenic
953996993 3:47527423-47527445 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
954024032 3:47767733-47767755 TGGTGGGCGCCTGTAATCCCAGG + Intronic
954290868 3:49649320-49649342 TGGTGGGAGCCTGTATGTCCAGG + Intronic
954339613 3:49942354-49942376 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
954752836 3:52823361-52823383 TGCCGAGAGCCTGTATGTGCTGG + Intronic
955645695 3:61134948-61134970 TGCTGGGAGTCTGCATGGCCTGG - Intronic
955659823 3:61286146-61286168 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
955692474 3:61604189-61604211 TGGTGGGCACCTGTATTCCCAGG + Intronic
956101391 3:65772066-65772088 TGGTGGGTGCCTGTAATCCCAGG + Intronic
956166356 3:66400874-66400896 TGCTGTGAGCCTGTGTTTCCAGG - Intronic
956787483 3:72654542-72654564 TGGTGGGAGTGTGTGTGTCGGGG - Intergenic
956879204 3:73493068-73493090 AGGTGGGAGAGGGTATGTCCGGG + Intronic
957379670 3:79410458-79410480 TTGAGGCAACCTGTATGTCCAGG + Intronic
957614813 3:82512877-82512899 TGGTGGGAGCCTGTGATCCCAGG - Intergenic
959038135 3:101388245-101388267 TGGTGGCAGGCTGGATGTGCTGG - Intronic
959323076 3:104904043-104904065 TGGTGGGACCCTGTGTACCCAGG - Intergenic
959702555 3:109311605-109311627 TGGTGGGCGCCTGTAATTACAGG + Intronic
961258630 3:125581222-125581244 TGGTGGGCGCCTGTAATCCCAGG - Intronic
961919858 3:130414459-130414481 TTGTGGGAGCCTGTGTATGCAGG - Intronic
962370940 3:134820247-134820269 TGGAGGGAGCCTCCATGTCTGGG + Intronic
963108719 3:141667518-141667540 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
963401316 3:144802749-144802771 TGGAGGGAGAATGCATGTCCTGG - Intergenic
963724542 3:148905209-148905231 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
964117102 3:153147814-153147836 TGGCGGGCGCCTGTAGATCCAGG + Intergenic
964123115 3:153206879-153206901 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
964530671 3:157664266-157664288 AGGTGGGGGTGTGTATGTCCAGG - Intronic
964765574 3:160175665-160175687 TGGCGGGTGCCTGTAGTTCCAGG + Intergenic
964798773 3:160530000-160530022 TGGTGGGCGCCTGTAGCCCCAGG + Intronic
964861361 3:161205529-161205551 TGGTGGGTGCCTGTAGTCCCAGG + Intronic
965177238 3:165351109-165351131 TGGTGGGTGCCTGTAATTCCAGG - Intergenic
965480990 3:169219372-169219394 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
965678281 3:171222893-171222915 GGGTGGGAGACCGTAAGTCCTGG - Intronic
966524178 3:180903305-180903327 TGGTGGGCGCCTGTAATCCCAGG + Intronic
967001423 3:185339184-185339206 TGGTGGGTGCCTGTAATCCCAGG + Intronic
967165844 3:186778846-186778868 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
968322178 3:197779750-197779772 TGGTGTGTGCCTGTATCCCCAGG - Intronic
968322206 3:197779886-197779908 TGGTGTGTGCCTGTATCCCCAGG - Intronic
968322219 3:197779941-197779963 TGGTGTGTGCCTGTATCCCCAGG - Intronic
1202741792 3_GL000221v1_random:62873-62895 TGGTGGGAGCAGGTATGACTGGG - Intergenic
968773685 4:2525687-2525709 TGGTGGGCGCCTGTAATCCCAGG + Intronic
968844467 4:3032343-3032365 TGGTGGGCGCCTGTAATCCCAGG + Intronic
969651843 4:8472691-8472713 TGGTTGGAGCCTGTGTTTCTCGG + Intronic
970831473 4:20345371-20345393 GGTTGGGAGCTTGAATGTCCAGG + Intronic
971070386 4:23084631-23084653 GGGTGGTAGCCTCTAAGTCCTGG + Intergenic
972156581 4:36170565-36170587 TGGTGAGATCCTATTTGTCCTGG + Intronic
972540446 4:40034687-40034709 TGGTGGGTGCCTGTAACCCCAGG + Intergenic
972641628 4:40930878-40930900 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
973814833 4:54610163-54610185 TGGTGGGTGCCTGTAGACCCAGG - Intergenic
973988354 4:56377935-56377957 TGGTGGGTGCCTGTAATACCAGG - Intronic
974081382 4:57216898-57216920 TGTGGGAAGCCTGTATGCCCAGG + Intergenic
975378728 4:73673933-73673955 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
976597247 4:86905845-86905867 TGGTGGGTGCCTGTAATCCCAGG - Intronic
977154795 4:93558503-93558525 TCTTGGGAGGGTGTATGTCCAGG - Intronic
977266595 4:94862983-94863005 TGGTGGGCGCCTGTAATCCCAGG + Intronic
977850982 4:101828993-101829015 TGGTGGGTGCCTGTAGTCCCAGG - Intronic
978069816 4:104453532-104453554 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
979072399 4:116224583-116224605 TGGTGTGTGCCTGTAGTTCCAGG - Intergenic
979346403 4:119592323-119592345 TGGCGGGCGCCTGTAGTTCCAGG + Intronic
979452715 4:120891760-120891782 TGGTGGGTGCCTGTAATCCCAGG - Intronic
979740293 4:124141874-124141896 TGGTGGGCGCCTGTAAGCCCAGG + Intergenic
980346681 4:131631682-131631704 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
980400693 4:132280620-132280642 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
980608228 4:135121895-135121917 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
980779391 4:137477821-137477843 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
981701808 4:147616003-147616025 TGGCGGGAGCCTGTAGTCCCAGG - Intergenic
982243686 4:153326846-153326868 TGGTGGGCGCCTGTAACCCCAGG + Intronic
982250949 4:153405934-153405956 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
985112776 4:186563258-186563280 TGGTGGGGGCCTGTAATCCCAGG + Intergenic
985404963 4:189628851-189628873 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
986894700 5:12351358-12351380 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
987334800 5:16889271-16889293 TGGTGGGTGCCTGTAATCCCAGG + Intronic
987812743 5:22859020-22859042 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
988476569 5:31591216-31591238 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
988491042 5:31705916-31705938 TGGTGGGTGCCTGTAATCCCAGG + Intronic
988822601 5:34902281-34902303 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
989010970 5:36872512-36872534 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
989031184 5:37119852-37119874 TGGTGGGCGCCTGTAATCCCAGG + Intronic
990491637 5:56308643-56308665 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
990592242 5:57278170-57278192 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
991307611 5:65196388-65196410 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
991682581 5:69153569-69153591 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
992223210 5:74593036-74593058 TGGTGTGAGTCTGTATGAGCAGG - Intergenic
992692521 5:79255227-79255249 TGGTGGGTGCCTGTAATCCCAGG - Intronic
993879381 5:93345266-93345288 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
994585969 5:101709951-101709973 TGGTTGGAGCCTGTGCTTCCTGG - Intergenic
994650546 5:102521266-102521288 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
995119710 5:108522809-108522831 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
995249826 5:109980205-109980227 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
996195684 5:120604238-120604260 TGGTGGGAGCATATATTTCTAGG + Intronic
996700110 5:126442422-126442444 TGGTGGGCGCCTGTAATCCCAGG - Intronic
996757700 5:126951977-126951999 TGGTGGGCGCCTGTAATCCCAGG - Intronic
996848548 5:127928058-127928080 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
996856994 5:128019464-128019486 TGCTGGAATCCTGTATTTCCCGG + Intergenic
997364129 5:133314581-133314603 TGGTGGGAGCCATTCTCTCCAGG + Intronic
998558794 5:143151823-143151845 TGGTGTGAGCCTGTAGTCCCAGG + Intronic
1000324157 5:160159374-160159396 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1000529867 5:162406339-162406361 TGGCGGGCGCTTGTATTTCCAGG + Intergenic
1000881420 5:166702286-166702308 TGCTGGCAGCTTGTAAGTCCTGG + Intergenic
1001190375 5:169624891-169624913 TCTTGGGAGGGTGTATGTCCAGG + Intergenic
1001509896 5:172312857-172312879 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1001791719 5:174463468-174463490 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1004519534 6:16348567-16348589 TGGTGAGTGCCTGTAATTCCAGG + Intronic
1004608553 6:17216876-17216898 TGGGGGGTGCCTGTAGTTCCTGG + Intergenic
1004938265 6:20529101-20529123 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1005022669 6:21432831-21432853 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1005913728 6:30333488-30333510 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1006044501 6:31283275-31283297 TGGTGGGCGCTTGTATTTCCAGG + Intronic
1006106494 6:31720037-31720059 AGGTGGGAGCCTCTATGACCAGG - Intronic
1006204432 6:32327922-32327944 TGGCGGGTGCCTGTAGTTCCAGG - Intronic
1006294933 6:33166087-33166109 TGGGGGGAGTCTATTTGTCCTGG + Intronic
1007727160 6:43923572-43923594 TGCTGGGAGCCTGCATCCCCAGG - Intergenic
1008112461 6:47507576-47507598 TGGTGGGAGCCTGTAATCCAAGG - Intronic
1008523308 6:52383052-52383074 TGGTGTGAGCCACTATGCCCAGG + Intronic
1008668723 6:53744198-53744220 AGGTGGGAGGGTGTAGGTCCAGG - Intergenic
1008711099 6:54228048-54228070 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1009726562 6:67543043-67543065 TAGGGGAAGCCTGTATGTCCAGG + Intergenic
1010213460 6:73381631-73381653 TCTTGGTAGCCTGAATGTCCAGG + Intronic
1010391196 6:75339813-75339835 TGGTGGGCACCTGTAGTTCCAGG + Intronic
1011458262 6:87575933-87575955 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1013251007 6:108333275-108333297 TGGCGGGCGCCTGTAATTCCAGG + Intronic
1013305236 6:108841521-108841543 GGGTGTGTGCCTGTATGACCTGG + Intergenic
1013459927 6:110365224-110365246 TGGTGGGAGCCAGTGTGCCAGGG - Intergenic
1014682307 6:124446905-124446927 TGGTGGGAGCATGTATCTAGTGG + Intronic
1015842045 6:137487595-137487617 TGGTGGGAGGCTGAATAACCAGG + Intergenic
1015953853 6:138580549-138580571 TGGTGGGAGGCTTTATATCATGG - Intronic
1016494786 6:144648595-144648617 AGATGGGAGCCTCTCTGTCCTGG + Intronic
1016868109 6:148789728-148789750 TGGTGGGCACCTGTAATTCCAGG - Intronic
1018407565 6:163503870-163503892 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1018758246 6:166867969-166867991 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1019461767 7:1162981-1163003 TGGTCTGAGCCTGAATGCCCGGG + Intergenic
1020003894 7:4771673-4771695 GGCCGGGAGCCTGTATGTCTAGG - Intronic
1020003935 7:4771792-4771814 GGCCGGGAGCCTGTATGTCCAGG - Intronic
1020003965 7:4771887-4771909 GGCCGGGAGCCTGTATGTCCAGG - Intronic
1021421802 7:20453970-20453992 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1023786344 7:43712243-43712265 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1024067311 7:45751146-45751168 TAGTGGGTGCCTGTAGTTCCAGG + Intergenic
1025003048 7:55333781-55333803 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1025096236 7:56097484-56097506 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1025173593 7:56783599-56783621 TGGTGCCTGCCTGTATTTCCAGG - Intergenic
1025698510 7:63794554-63794576 TGGTGCCTGCCTGTATTTCCAGG + Intergenic
1025746296 7:64245871-64245893 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1025930629 7:65990801-65990823 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1026491281 7:70866167-70866189 TGCAGGGAGCCTGGGTGTCCTGG - Intergenic
1026604937 7:71807659-71807681 AGGTGTGAGCCTGTTAGTCCAGG - Intronic
1026729463 7:72898663-72898685 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1026938608 7:74273502-74273524 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1029002555 7:97169191-97169213 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1030038933 7:105432752-105432774 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1031289351 7:119913386-119913408 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1031420841 7:121550078-121550100 TGGCGGGTGCCTGTAAGCCCAGG - Intergenic
1032227595 7:130045756-130045778 TGGTGGGAGCCTGTAATCCCAGG + Intronic
1033125091 7:138700469-138700491 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1033407497 7:141084522-141084544 TGCTGGGAGCCTGGATGGCTGGG + Intronic
1033915815 7:146324127-146324149 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1034485549 7:151358930-151358952 TGGTGGGCGCCTGTAGTCCCAGG + Intronic
1034574682 7:151986856-151986878 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1035379982 7:158431778-158431800 CGGTGTGAGCCAGTGTGTCCTGG - Intronic
1035455898 7:159008417-159008439 TGGAGGGAGCCGGTGTGTCCAGG + Intergenic
1036522801 8:9507623-9507645 TGGTGTGTGCCTGTAGTTCCAGG + Intergenic
1037347880 8:17919042-17919064 TGGTGCGAGCCTGTAATCCCAGG - Intergenic
1037381723 8:18292341-18292363 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1037664844 8:20959628-20959650 TCTTGGGAGGGTGTATGTCCAGG - Intergenic
1037844400 8:22270265-22270287 TGGCGGGAGCCTGTAATCCCAGG + Intergenic
1039669763 8:39582814-39582836 TGGTGGGCGCCTGTAATCCCAGG - Intergenic
1039841339 8:41295394-41295416 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1040024548 8:42769931-42769953 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1040097747 8:43463536-43463558 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1041372384 8:57175831-57175853 TCTTGGGAGACTGTATTTCCAGG - Intergenic
1042552842 8:70009826-70009848 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1043511050 8:80950568-80950590 AGGAGGGAGCCTGCATTTCCAGG + Intergenic
1043680413 8:83018358-83018380 TGGTGGGTGCCTGTATTTCCAGG - Intergenic
1045169427 8:99647426-99647448 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1045457770 8:102398646-102398668 TGGTGGGCGCCTGTAATCCCAGG + Intronic
1046240518 8:111485038-111485060 TGGTAGGCGCCTGTAATTCCAGG + Intergenic
1047462556 8:125081368-125081390 TGGTGGGCGCCTGTAATTCCAGG - Intronic
1048564171 8:135576964-135576986 TGGTGGGAGCCAGTTTCTCACGG - Intronic
1049280980 8:141744400-141744422 TGGTGGGCACCTGTAGGCCCAGG - Intergenic
1049985732 9:948958-948980 TGGTGGGTGCCTGTACTTCCAGG + Intronic
1050107680 9:2182625-2182647 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1050439028 9:5641222-5641244 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1051112416 9:13654427-13654449 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1052716238 9:32120924-32120946 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1053177075 9:35934413-35934435 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1053221091 9:36313795-36313817 TGGTGGGTGCCTGTAATCCCTGG + Intergenic
1053484846 9:38444563-38444585 TGGTGGGAGCGTTTATATCATGG - Intergenic
1053559499 9:39175363-39175385 TGGTGGGAACCTGTAGTCCCAGG + Intronic
1054137614 9:61443580-61443602 TGGTGGGAACCTGTAGTCCCAGG - Intergenic
1054594450 9:67050821-67050843 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1055271683 9:74567156-74567178 TGGTGTGTGCGTGTATTTCCAGG - Intronic
1055473406 9:76636821-76636843 TGGTGCCCGCCTGTAAGTCCTGG + Intronic
1055576310 9:77662918-77662940 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1055615711 9:78070129-78070151 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1056855658 9:90127389-90127411 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1057354796 9:94324135-94324157 TGGCGGGCGCCTGTAAGCCCAGG + Intronic
1057387449 9:94616563-94616585 TGGTGGGCGCCTGTAGTCCCGGG - Intronic
1057394550 9:94668150-94668172 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1057964301 9:99488304-99488326 TGCTGAGAGCTTGTAAGTCCTGG - Intergenic
1058214558 9:102217598-102217620 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1058524681 9:105845000-105845022 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1058704275 9:107625719-107625741 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1058742788 9:107960563-107960585 TGGTGGGCACCTGTAATTCCAGG + Intergenic
1058967507 9:110050758-110050780 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1060524854 9:124314790-124314812 TGGTGGGTGCCTGTAATCCCAGG - Intronic
1060614608 9:125000516-125000538 TGGTAGGTGCCTGTATTCCCAGG + Intronic
1060693522 9:125686188-125686210 TGGTGGGCGCCTGTACTCCCAGG + Intronic
1060850762 9:126873394-126873416 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1060992379 9:127856485-127856507 TGGAGGGAGGATGTCTGTCCAGG + Intergenic
1061246752 9:129404622-129404644 TGGTGGGAGCCTGACAGTCCTGG + Intergenic
1062038866 9:134395144-134395166 TGGCAGGAGCCTGTCTGTGCTGG + Intronic
1062204161 9:135326485-135326507 TGTCCAGAGCCTGTATGTCCAGG - Intergenic
1062329912 9:136034959-136034981 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1062377574 9:136269513-136269535 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1062600144 9:137315859-137315881 TGTTGGGACCCTGTGTGGCCCGG - Intronic
1062727867 9:138087250-138087272 TGGTGGGTGCCTGTAATCCCAGG + Intronic
1203710422 Un_KI270742v1:92797-92819 TGGTGGGAGCAGGTATGACTGGG - Intergenic
1185522782 X:754281-754303 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1185568653 X:1115682-1115704 TGGTGGGCGCCTGTAATCCCAGG + Intergenic
1185685433 X:1924647-1924669 TGGTGGGTGCCTGTAACCCCAGG - Intergenic
1185696102 X:2195913-2195935 TGGTGGGTGCCTGTAATGCCAGG - Intergenic
1185887813 X:3798307-3798329 TGGTGGGCGCCTGTAATTCCAGG - Intergenic
1187549794 X:20290599-20290621 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1187946838 X:24434162-24434184 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1187949820 X:24460843-24460865 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1188252083 X:27909063-27909085 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1188423877 X:30023994-30024016 TGGTGGGCGCCTGTAGTCCCAGG - Intergenic
1188434128 X:30141056-30141078 TAGTGGGAGACAGTTTGTCCTGG - Intergenic
1188453613 X:30336505-30336527 TTGTGGGAGGCTGTATCTCTTGG - Intergenic
1189363905 X:40373623-40373645 TGGGGGGAGCCTGTGTATCTAGG + Intergenic
1190831606 X:54063792-54063814 TGGTGGGCGCCTGTAGTCCCAGG + Intergenic
1190974001 X:55381490-55381512 TGGTGGGGGCCTGTAGTCCCAGG + Intergenic
1191103435 X:56757852-56757874 TGAGGGGAGCTTGTATTTCCGGG + Intergenic
1191591068 X:62885866-62885888 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1191640655 X:63427644-63427666 TGGTTGGAGCCTGAAAGACCAGG + Intergenic
1191849285 X:65574073-65574095 GTGTGAGAGTCTGTATGTCCAGG + Intergenic
1192347417 X:70322442-70322464 TGGTGGGCGCCTGTAGTCCCAGG - Intronic
1196033157 X:111113404-111113426 TGGTGGGAGGATGTAAGGCCAGG + Intronic
1196249062 X:113436862-113436884 GGGTGGGAGGCTGTATGTACGGG - Intergenic
1196260593 X:113575829-113575851 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1196580820 X:117377022-117377044 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1196773151 X:119315833-119315855 TGGTGGGTGCCTGTAGTCCCAGG - Intergenic
1197246339 X:124170993-124171015 TGGTGGGCGCCTGTAATCCCAGG - Intronic
1197393970 X:125903322-125903344 TGGTGGGAGGCTATATGGGCAGG + Intergenic
1197448870 X:126585837-126585859 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1200114891 X:153765656-153765678 AGGCTGCAGCCTGTATGTCCTGG - Intronic
1200250040 X:154547810-154547832 AGGGGGGAGCCTGAACGTCCGGG - Intronic
1200773926 Y:7152674-7152696 TGGTGGGTGCCTGTAATTCCAGG + Intergenic
1201272900 Y:12272650-12272672 TGGTGGGTGCCTGTAATCCCAGG - Intergenic
1201284523 Y:12367908-12367930 TGGTGGGTGCCTGTAGTCCCAGG + Intergenic
1201350371 Y:13033887-13033909 TGGTGGGTGCCTGTACTCCCAGG + Intergenic
1201889738 Y:18929035-18929057 TGGTGGGTGCCTGTAATCCCAGG + Intergenic
1201899958 Y:19038872-19038894 TGGTGGGCACCTGTATTCCCAGG + Intergenic
1202189179 Y:22223452-22223474 TGGTGGGGGCCTGTAATCCCAGG + Intergenic