ID: 954292942

View in Genome Browser
Species Human (GRCh38)
Location 3:49659282-49659304
Sequence GGTCCTGGCTGCAGGCACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 1, 2: 2, 3: 50, 4: 415}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954292942 Original CRISPR GGTCCTGGCTGCAGGCACAG AGG Intronic