ID: 954294134

View in Genome Browser
Species Human (GRCh38)
Location 3:49664846-49664868
Sequence GCTGCTTGTACTCACCATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294134_954294142 16 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294142 3:49664885-49664907 CTGGGAAAGGCCCGAGGCACTGG 0: 1
1: 1
2: 0
3: 18
4: 239
954294134_954294138 3 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294138 3:49664872-49664894 TACCTTGCCTCTTCTGGGAAAGG 0: 1
1: 0
2: 1
3: 14
4: 219
954294134_954294152 28 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294152 3:49664897-49664919 CGAGGCACTGGGGGTGGGGGTGG 0: 1
1: 0
2: 11
3: 151
4: 1332
954294134_954294135 -3 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294135 3:49664866-49664888 AGCCTGTACCTTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
954294134_954294141 10 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294141 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 9
4: 176
954294134_954294153 29 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294153 3:49664898-49664920 GAGGCACTGGGGGTGGGGGTGGG 0: 1
1: 1
2: 30
3: 273
4: 1994
954294134_954294144 18 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294144 3:49664887-49664909 GGGAAAGGCCCGAGGCACTGGGG 0: 1
1: 0
2: 2
3: 22
4: 258
954294134_954294148 24 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294148 3:49664893-49664915 GGCCCGAGGCACTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 35
4: 525
954294134_954294154 30 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294154 3:49664899-49664921 AGGCACTGGGGGTGGGGGTGGGG 0: 1
1: 7
2: 55
3: 450
4: 2579
954294134_954294136 -2 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294136 3:49664867-49664889 GCCTGTACCTTGCCTCTTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 150
954294134_954294143 17 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294143 3:49664886-49664908 TGGGAAAGGCCCGAGGCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 143
954294134_954294145 19 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294145 3:49664888-49664910 GGAAAGGCCCGAGGCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
954294134_954294146 22 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294146 3:49664891-49664913 AAGGCCCGAGGCACTGGGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 288
954294134_954294149 25 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294149 3:49664894-49664916 GCCCGAGGCACTGGGGGTGGGGG 0: 1
1: 0
2: 7
3: 59
4: 518
954294134_954294147 23 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294147 3:49664892-49664914 AGGCCCGAGGCACTGGGGGTGGG 0: 1
1: 0
2: 2
3: 27
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294134 Original CRISPR GCTGCTTGTACTCACCATGC TGG (reversed) Exonic
902149399 1:14430726-14430748 GCTGCTTGTGCTCAGCACCCTGG - Intergenic
904314525 1:29651657-29651679 GCTGCCCGTACTGGCCATGCTGG + Intergenic
904384649 1:30133322-30133344 GCTGCCTGTACTGGCCATGCTGG - Intergenic
904888060 1:33756630-33756652 CCTGCTTCTACCTACCATGCTGG - Intronic
906613246 1:47218053-47218075 GTGGCTTGTCCTCACCATGATGG - Exonic
910238730 1:85063307-85063329 GCTCCTGGTCCACACCATGCAGG - Intronic
911372913 1:97015457-97015479 GCTGTGTTTACTCACCATGGTGG + Intergenic
913486478 1:119336283-119336305 GCTGCTCCTGTTCACCATGCAGG - Intergenic
915691597 1:157696124-157696146 GCTGCATGTTCTCACCGTGAAGG - Exonic
917371462 1:174298293-174298315 GCTGCTTGCACTCATGAAGCAGG + Intronic
917912574 1:179665829-179665851 GCAACCTGTACTTACCATGCAGG + Intronic
1067440578 10:46307174-46307196 GCTGCTTGGTGTCACCATCCTGG - Intronic
1068368073 10:56077538-56077560 GGTGCTTGTACTCATCATTGAGG + Intergenic
1069640063 10:69949095-69949117 GCAGCTTGTCCTCTTCATGCCGG + Intronic
1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG + Intergenic
1077138561 11:1013500-1013522 GCGGCTCGTACTCACCCTGCAGG - Exonic
1077412734 11:2411041-2411063 GCTGCTTGGCCTCCCCAAGCAGG + Intronic
1084497829 11:69515318-69515340 GCTGCCTGAAGTCACCATGTGGG - Intergenic
1088500316 11:110476605-110476627 GCACCCTCTACTCACCATGCAGG + Intergenic
1091277161 11:134360389-134360411 ACTGCTGGTCCTCCCCATGCCGG - Intronic
1092519661 12:9255765-9255787 GCTTCTTGGACACACCATCCAGG + Intergenic
1093788443 12:23218873-23218895 GCTTCTTGTCGTCACCAAGCTGG - Intergenic
1095985588 12:47997523-47997545 GCTGCTTGCACTTACCTGGCTGG - Intronic
1099113041 12:78586838-78586860 GCTGCTTGTGCACACCTTGTGGG - Intergenic
1101921519 12:108937034-108937056 ACTGCTTTTAATCACCGTGCAGG - Intronic
1102513827 12:113433693-113433715 GCTGCTTGAACTCAACTAGCAGG + Intronic
1103096392 12:118136194-118136216 TCTGCTTGGCCTCGCCATGCCGG + Exonic
1103922138 12:124404557-124404579 GCTGCATTTACTGGCCATGCCGG - Intronic
1104685311 12:130780956-130780978 GCTGCTTGTACCACCCTTGCTGG - Intergenic
1105686660 13:22789933-22789955 GATTCCTGTCCTCACCATGCTGG - Intergenic
1105949129 13:25213809-25213831 AATGCCTGCACTCACCATGCTGG - Intergenic
1107130084 13:36885942-36885964 GCTGACTGTTCTCACTATGCGGG + Intronic
1111924095 13:94444636-94444658 GCTCCTTGAACTTACCATCCAGG - Intronic
1112108754 13:96271152-96271174 GCAGCTTGAAATCACCATGCTGG - Intronic
1113639376 13:111946293-111946315 GCTCCATGTGCTCACCTTGCAGG - Intergenic
1128627479 15:69224658-69224680 GCAGTTTGTACTCAGCTTGCAGG - Intronic
1130223691 15:82043126-82043148 GCTGCTAGTGCGCACCGTGCTGG - Exonic
1130651916 15:85766896-85766918 GCTGTCTGTTCCCACCATGCAGG + Intronic
1131245129 15:90784998-90785020 GCTGCTCTTGCTTACCATGCTGG + Exonic
1138237797 16:55399887-55399909 GCTTTTTCTACTCACCATGGCGG + Intronic
1141674134 16:85508689-85508711 GCTGCTTGTGCTCAGTATGCTGG + Intergenic
1154098256 18:11441344-11441366 GCTGTTTTTTCTCACCATGCTGG + Intergenic
1155311985 18:24532930-24532952 GCTGCTTGTCCTCCCCACCCTGG - Intergenic
1156785229 18:40904494-40904516 GCTGCTAAAACTCAGCATGCTGG - Intergenic
1161932215 19:7348722-7348744 TCTGTGTGTACCCACCATGCTGG + Intergenic
1165831232 19:38731349-38731371 TCAGCCTGTACTCACCCTGCCGG - Exonic
925100034 2:1236433-1236455 GCTGCCTGCCCTCCCCATGCAGG + Intronic
927462313 2:23309858-23309880 GCTGCATGTCCTCTCCATCCAGG + Intergenic
928181612 2:29072279-29072301 GTTGCTTGGACTGACCCTGCAGG + Exonic
932085639 2:68756237-68756259 GCAGCTTGTGCTCAACGTGCAGG + Intronic
934959569 2:98659057-98659079 GATGCTTCTACCCTCCATGCTGG - Intronic
935517273 2:104056287-104056309 TCTGCTGGTTCTCTCCATGCTGG - Intergenic
935722571 2:105992442-105992464 GCTGGTGGTACTCACCATGGTGG + Intergenic
937669089 2:124519481-124519503 GCTCCTTTTGCTCATCATGCTGG - Intronic
937974394 2:127573441-127573463 GCTGTTGGCACTCCCCATGCCGG + Intronic
938050039 2:128161077-128161099 GCTGCCTGCACTCAGCAAGCTGG - Intronic
942949528 2:181706708-181706730 GTTGTGTGTACTCAGCATGCAGG - Intergenic
944987707 2:205196957-205196979 GCTGATTGTACAGTCCATGCAGG - Intronic
945264956 2:207881844-207881866 GCTGCTTGGAGGCACCATCCTGG + Intronic
948663254 2:239519691-239519713 GCTGCTTGCATTTACCATGTTGG + Intergenic
1173564504 20:44029291-44029313 GGTGCTTGTTATCACCAAGCAGG - Intronic
1175036251 20:56004108-56004130 GCTGCTGGTCCTCACGCTGCCGG - Exonic
1176898689 21:14414815-14414837 GGTGCATAAACTCACCATGCAGG + Intergenic
1177893350 21:26833379-26833401 GCTGCTTGTACTCACAAGTGGGG + Intergenic
1180796875 22:18610234-18610256 GCTGCTTGTTCTCCGCTTGCAGG + Exonic
1181082048 22:20422674-20422696 TCTGCTTGTAACCACCAGGCTGG + Intergenic
1181090555 22:20469596-20469618 ACTCCATCTACTCACCATGCAGG + Intronic
1181224849 22:21385037-21385059 GCTGCTTGTTCTCCTCTTGCAGG - Exonic
1181253783 22:21549776-21549798 GCTGCTTGTTCTCCTCTTGCAGG + Exonic
950521493 3:13500416-13500438 GCTCCTTGTCCCCACCAAGCTGG - Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
965669115 3:171128428-171128450 AATGCTTGTTCTCACCTTGCAGG + Intronic
970569424 4:17365189-17365211 ACTGGTTGTGTTCACCATGCAGG - Intergenic
973176566 4:47213040-47213062 GCTGCTTTCACTCACCTTACAGG + Intronic
979100220 4:116603679-116603701 TGTGCTGGTACTCACCATTCAGG + Intergenic
982156544 4:152527748-152527770 GTTGCTTGTTGTCACCAGGCTGG - Intronic
984466252 4:180102196-180102218 GCTGCTTGTACTCAGCCATCTGG + Intergenic
985231655 4:187824694-187824716 GCTGCTTGTTATCTCCAAGCTGG + Intergenic
985584806 5:725174-725196 TCTGCTTGTCCTCACAAGGCAGG - Intronic
985598309 5:809488-809510 TCTGCTTGTCCTCACAAGGCAGG - Intronic
985953769 5:3244534-3244556 GCTGCTTCCACTCACCAGGAAGG + Intergenic
987328081 5:16830462-16830484 GTTGCTTATACCCACTATGCAGG + Intronic
987568474 5:19624691-19624713 GCTGAATGCACTCCCCATGCTGG + Intronic
989329942 5:40245413-40245435 ACTGATTGTCCCCACCATGCAGG + Intergenic
994013338 5:94935096-94935118 GTTTCTTGTACACACAATGCTGG + Intronic
998895323 5:146792752-146792774 GCTGCTTGAACTCCCCAGTCTGG - Intronic
999335287 5:150710894-150710916 GCTGCTGTTACTCAACGTGCAGG + Exonic
1003537166 6:6985459-6985481 TCTGCTTGCCCTCACCATACTGG - Intergenic
1005834124 6:29695095-29695117 GCTGCCTGTGCTCACCATTGTGG - Intergenic
1016369880 6:143362349-143362371 GCTGTTATTACTCACAATGCTGG + Intergenic
1016369956 6:143363174-143363196 GCTGTTATTACTCACAATGCTGG - Intergenic
1018536996 6:164831286-164831308 TCTGCTTTTTCTAACCATGCTGG - Intergenic
1021202640 7:17742695-17742717 GGTGCTTGCACTCACCATTGGGG + Intergenic
1023807731 7:43885805-43885827 GCTGCAGCCACTCACCATGCAGG + Intronic
1023906227 7:44523526-44523548 GCAGCTTGTACACAGCTTGCAGG + Intronic
1024240639 7:47432689-47432711 GCTGCTTCCACCCACAATGCAGG - Intronic
1024816352 7:53275951-53275973 CCAGCTTCTACACACCATGCAGG + Intergenic
1027199977 7:76057803-76057825 GCTTCTGGCACTCATCATGCTGG + Intronic
1027334768 7:77137986-77138008 GCTGGTGATACTGACCATGCTGG + Intronic
1027715116 7:81659739-81659761 GGTGCTTGTGCTCACCATTGGGG + Intergenic
1029781033 7:102733116-102733138 GCTGGTGATACTGACCATGCTGG - Intergenic
1031170476 7:118286482-118286504 TCTGCTTGTCCTCACTAGGCTGG + Intergenic
1032614505 7:133452415-133452437 GCTGCTTCTCATCACCATGTGGG - Intronic
1034330807 7:150280581-150280603 CCTAACTGTACTCACCATGCTGG - Intronic
1034667236 7:152829268-152829290 CCTAACTGTACTCACCATGCTGG + Intronic
1041671635 8:60497559-60497581 GCTGGCAGTACTCACCATGGCGG + Intergenic
1042776700 8:72440158-72440180 TCAGCTTGTACTCACCAGGTAGG + Intergenic
1044474523 8:92610645-92610667 GCAACTTGGACTCACCCTGCCGG - Intergenic
1044761599 8:95523205-95523227 GCTGCATGTTCTGAACATGCTGG - Intergenic
1047224674 8:122946219-122946241 GGTGCTGGTCCTCACCTTGCTGG + Intronic
1056221245 9:84452506-84452528 GCTGCTTCAAGTCACCATTCAGG - Intergenic
1061849350 9:133405324-133405346 GCTGCTGTCACTCACCAGGCTGG - Exonic
1188712396 X:33416367-33416389 GGTGCTTGTACTCACCATTGGGG + Intergenic
1191842543 X:65523583-65523605 CCTGCTTGGGCTCACCTTGCTGG - Exonic
1192612603 X:72582484-72582506 CATCCTTGTCCTCACCATGCTGG - Exonic
1193350769 X:80462323-80462345 CCTGCTTGTACTCGCCCTCCAGG - Intergenic
1195746068 X:108119776-108119798 CCTCCTTCTCCTCACCATGCTGG + Intronic
1195786316 X:108527661-108527683 GGTGCTTGCACTCACCATTGGGG + Intronic
1197633272 X:128886609-128886631 CCTGCTTTTTCTAACCATGCTGG + Intergenic
1199182832 X:144878699-144878721 TCTGCTTCTCCTCACTATGCAGG + Intergenic
1199379684 X:147155622-147155644 GCTGCTTTTTCTAGCCATGCTGG + Intergenic