ID: 954294135

View in Genome Browser
Species Human (GRCh38)
Location 3:49664866-49664888
Sequence AGCCTGTACCTTGCCTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294133_954294135 -2 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294135 3:49664866-49664888 AGCCTGTACCTTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
954294134_954294135 -3 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294135 3:49664866-49664888 AGCCTGTACCTTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
954294130_954294135 17 Left 954294130 3:49664826-49664848 CCTCATTCTGGTGACCATGCCCA 0: 1
1: 0
2: 0
3: 22
4: 148
Right 954294135 3:49664866-49664888 AGCCTGTACCTTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152
954294132_954294135 3 Left 954294132 3:49664840-49664862 CCATGCCCAGCATGGTGAGTACA 0: 1
1: 0
2: 3
3: 24
4: 222
Right 954294135 3:49664866-49664888 AGCCTGTACCTTGCCTCTTCTGG 0: 1
1: 0
2: 1
3: 15
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294135 Original CRISPR AGCCTGTACCTTGCCTCTTC TGG Intronic
901615496 1:10536284-10536306 AACCTGTACCTTTCTTCTTTAGG - Exonic
902611839 1:17602370-17602392 ATCCTGGACCTTGGCTCTTGGGG - Intronic
906658918 1:47568831-47568853 AGCCTGCACCCTGCCCCTTGGGG - Intergenic
911928387 1:103867100-103867122 AGCCTGTGCTTTGCTTCTCCAGG + Intergenic
915989183 1:160496127-160496149 AGCCTGTGTCTTCCATCTTCAGG + Exonic
921309939 1:213832855-213832877 AGTCTGTACCTTGTCACTGCAGG - Intergenic
923954319 1:238997531-238997553 AGCCTCTCATTTGCCTCTTCAGG - Intergenic
924431269 1:243998664-243998686 AGCCTGCATCTAGCCTCTCCTGG - Intergenic
924444546 1:244116974-244116996 AACCTGTCCTTTGCCTCTCCTGG - Intergenic
1063963482 10:11326570-11326592 AGCCTGGACTCTGCCTCTTGTGG + Intronic
1064642977 10:17433201-17433223 AACCTGTACCTTTCCTCAACAGG + Intronic
1068554382 10:58442273-58442295 ATCCTGTACATTTCCTATTCTGG + Intergenic
1068590005 10:58843714-58843736 AGCCTGTTCCATACCTCATCAGG - Intergenic
1070512975 10:77177796-77177818 AGCCTGTACCTTGCAATTACGGG + Intronic
1071021606 10:81063876-81063898 AGCATGTGCATTGCCTCATCAGG - Intergenic
1071067711 10:81656282-81656304 AGCCTGGACCCTGGCTCCTCTGG + Intergenic
1074570350 10:114618656-114618678 GGCCTGTGCCTTGCCTCTCCAGG - Intronic
1075515100 10:123102311-123102333 AGCCATTACCTTGCTGCTTCCGG - Intergenic
1078620991 11:12907848-12907870 AACCTGTGCATGGCCTCTTCAGG + Intronic
1079837169 11:25349942-25349964 AGCCTTTCCCTTGTCTCTTAGGG + Intergenic
1080048626 11:27835972-27835994 AATCTGTACCTTGCCTCTTCCGG + Intergenic
1083404804 11:62449277-62449299 AGCCTTCACCTTGCCTCCCCTGG + Intronic
1083520000 11:63300684-63300706 AGCTTGTACATTGTCTCTTGGGG + Intronic
1085517469 11:77119728-77119750 AGCATGTACCCAGCCTCTGCAGG - Intronic
1086303788 11:85458927-85458949 AGCCTTTCACTTGCCTCTTGGGG + Intronic
1086641584 11:89164674-89164696 CGGCTGTAACTTTCCTCTTCTGG + Intergenic
1088809879 11:113385135-113385157 AACCTGTTCCTTGCCCCTTCTGG + Intergenic
1089563995 11:119361217-119361239 AGCCAGGCCCTTGCCTCTGCGGG - Intronic
1091028077 11:132159758-132159780 CGCCTGCACCTAGGCTCTTCAGG - Intronic
1096104322 12:48987567-48987589 AGCCTGTACCAGGCCTACTCTGG + Intergenic
1097386638 12:58957575-58957597 AGCCTGTCCCTTACCTTTTTTGG - Intergenic
1098828961 12:75335095-75335117 AAGCTGTTCCTTGCCTCTTGCGG + Intronic
1099839727 12:87950382-87950404 AGCTTGTACTTGGCCTCCTCAGG - Intergenic
1101843632 12:108344790-108344812 AATCTGTTCTTTGCCTCTTCTGG - Intergenic
1102903447 12:116656742-116656764 AGCCTGTACCCGGCCCTTTCTGG - Intergenic
1102920303 12:116786835-116786857 AATCTGATCCTTGCCTCTTCGGG + Intronic
1102952851 12:117041841-117041863 AGCCTGTCCCTTGCTACTGCAGG + Intronic
1103967252 12:124647673-124647695 AACCTGTTTCTTGCCTTTTCTGG + Intergenic
1104903535 12:132201775-132201797 AGCTTGTACCTGGCCTTTCCTGG + Intronic
1106387148 13:29298863-29298885 TGCTTTGACCTTGCCTCTTCTGG - Intronic
1107333212 13:39324246-39324268 TGCATATACCCTGCCTCTTCTGG + Intergenic
1108644774 13:52416292-52416314 AGCCTCTACTATGTCTCTTCTGG - Intronic
1110060696 13:71034316-71034338 GGCCTGTCCCTTGTCTCTTGGGG - Intergenic
1111613765 13:90639158-90639180 ATCTTGTACCTTGCATTTTCTGG - Intergenic
1111832296 13:93344290-93344312 AAGCTATACCTGGCCTCTTCTGG - Intronic
1111847817 13:93533878-93533900 ATCCTGTTGCTTGCCCCTTCAGG + Intronic
1113123798 13:106954162-106954184 AATCTGTTCCTTGCCTCTTCTGG + Intergenic
1113445319 13:110361791-110361813 AGCTCCTGCCTTGCCTCTTCAGG - Intronic
1113458402 13:110465088-110465110 AGCCTGTGCCTTCGCTGTTCTGG + Intronic
1116376433 14:44208606-44208628 AGCCTGTTATTTGTCTCTTCAGG - Intergenic
1116634743 14:47380675-47380697 AGCCTGTAATTGGCCTATTCAGG - Intronic
1117389312 14:55247919-55247941 TGCCTTTCCCTTGTCTCTTCAGG - Intergenic
1117557733 14:56903550-56903572 AGACTCAACCTTGCCTCTGCAGG + Intergenic
1117649466 14:57887753-57887775 AGCCTGTGCACAGCCTCTTCTGG + Intronic
1117676477 14:58160077-58160099 AGCCTGAACTTTGCTTCTCCTGG - Intronic
1122759493 14:104011941-104011963 AGCCTGCACCTGGTCTCTCCAGG - Intronic
1123922904 15:25083091-25083113 AGCCTGTAGCCTGCCTCTGGTGG + Intergenic
1124123138 15:26909575-26909597 AGGCTGTTTCTTGCCTCTTCCGG + Intronic
1125514434 15:40309726-40309748 AGGCTGTCCCTTTCCTCCTCAGG - Intergenic
1125965632 15:43873712-43873734 AGCCTATCCCTTTCTTCTTCTGG + Exonic
1126359087 15:47827095-47827117 AGCATGTACCTTGCCACAGCAGG - Intergenic
1128322875 15:66705006-66705028 AGCCTGTAGCTAGCCTCTGAGGG + Intronic
1128558053 15:68645127-68645149 AGCCTGACCCTTGTCTCTCCTGG + Intronic
1128567918 15:68713572-68713594 AACCCATTCCTTGCCTCTTCTGG + Intronic
1129356194 15:74993796-74993818 AGATTGTACCTTTCCTATTCAGG - Intronic
1129387568 15:75204111-75204133 AGCCCTCTCCTTGCCTCTTCTGG - Intronic
1129757646 15:78108313-78108335 AGCTTTGACCTTGACTCTTCAGG + Intronic
1129828606 15:78652170-78652192 TGCCTGTATCTGGCCTCTGCTGG + Intronic
1130127332 15:81104996-81105018 AATCTGTTCCATGCCTCTTCTGG + Intronic
1138280237 16:55767545-55767567 CGCCAGTACCCTGCATCTTCTGG + Intergenic
1138690916 16:58767864-58767886 ATTCTGTACTTTCCCTCTTCAGG + Intergenic
1140381328 16:74490846-74490868 AGACTGAACGTTGCTTCTTCAGG - Intronic
1141712092 16:85705627-85705649 AGCCTGTGCCTGACCTCTCCTGG + Intronic
1148759379 17:49991548-49991570 ACCCTGCACCATGCCTCTCCCGG - Exonic
1150845215 17:68650014-68650036 AGTCTGTGGCTTGCCTCTTCAGG - Intergenic
1152105796 17:78328127-78328149 AGGCTGTACCTGGCCACTTGTGG - Intergenic
1153842587 18:9020363-9020385 AACCTGTACTTGGCCTCCTCAGG - Intergenic
1155208244 18:23578946-23578968 TGCCTGCCGCTTGCCTCTTCCGG + Intronic
1157399874 18:47378410-47378432 AGCCTGTCAACTGCCTCTTCTGG + Intergenic
1158275379 18:55761077-55761099 AGCCTTTATCTTTCCTTTTCAGG - Intergenic
1159103200 18:63977906-63977928 AATCTGTTCCTTGCCTTTTCTGG + Intronic
1162904031 19:13812975-13812997 AGCCTGCCCCGTGCCTCCTCAGG + Exonic
1163100064 19:15090121-15090143 AGCCTGTTCCACGCCTCTCCTGG - Intergenic
1164935002 19:32203159-32203181 AGCCTTTGCCTTTCCTCTTCTGG + Intergenic
1165826824 19:38710310-38710332 AGCTTCTACCATGCCTTTTCAGG + Exonic
1166608004 19:44162606-44162628 AGCCTGTACCTGATTTCTTCTGG - Intergenic
1167498556 19:49832842-49832864 GGCCTCTTCGTTGCCTCTTCCGG + Intronic
1167594326 19:50419113-50419135 ACCCTGTCTCTTGCCCCTTCTGG + Intronic
1168284299 19:55322743-55322765 AGCCTGGACTTTGCCTCTGCAGG - Exonic
1168487467 19:56776428-56776450 ATTCTGTACCTTCCCTCTTTAGG - Intronic
925040326 2:727925-727947 AGCCTGGACCCTGCCTTCTCTGG - Intergenic
925417302 2:3679627-3679649 AGCCTGTGCATTTTCTCTTCTGG + Intronic
928245372 2:29622008-29622030 AGCCTGTACTGTGGCTCATCTGG - Intronic
933548317 2:83741982-83742004 AGCCAGTATCTTGCCTATTAGGG - Intergenic
934156674 2:89207489-89207511 AGCCTAAACTCTGCCTCTTCAGG - Intergenic
934210642 2:89975262-89975284 AGCCTAAACTCTGCCTCTTCAGG + Intergenic
946656604 2:221955192-221955214 AGCCACTACCTTGCCCCTTTTGG - Intergenic
947969804 2:234313539-234313561 TGCCTGCACCTTGCATCTTAGGG + Intergenic
948256397 2:236571587-236571609 AGCCTATACTTGGCCTGTTCTGG - Intronic
1169206750 20:3745026-3745048 AGCCAGTCCCGCGCCTCTTCGGG - Exonic
1169302190 20:4452687-4452709 GGCCTGTCCCCTGCATCTTCTGG - Intergenic
1172331802 20:34080568-34080590 AGTCTCTACCTTCTCTCTTCTGG + Intronic
1173634870 20:44546632-44546654 AGCCTCTACCTTCCCAGTTCAGG + Intronic
1179185591 21:39083205-39083227 AGCCAGAACCTTCCCTCTCCAGG - Intergenic
1179730990 21:43367385-43367407 AATCTGTTCCTTGCCTCTTCTGG - Intergenic
1180239307 21:46489636-46489658 AGCGTGGACTCTGCCTCTTCAGG + Intronic
1183042922 22:35196676-35196698 AGCTTGTACCTGGGCTCTGCGGG + Intergenic
1183350672 22:37333018-37333040 AGCCTGGACCCTGCCTCTAGTGG - Intergenic
950227067 3:11244480-11244502 ATCCTGTACCTGGCCCATTCAGG - Intronic
950239328 3:11353930-11353952 ACCCTTTACCCTGCTTCTTCTGG + Intronic
952768635 3:36977041-36977063 GGCCTGTCTCTTACCTCTTCTGG - Intergenic
952872778 3:37916631-37916653 TGCCTCTTCCTTGCCTCTCCCGG - Intronic
954294135 3:49664866-49664888 AGCCTGTACCTTGCCTCTTCTGG + Intronic
960088477 3:113615245-113615267 AGCCTGCTCCATGCCTTTTCTGG + Intronic
963329183 3:143895042-143895064 AGCCTTTACCTTTCCACTTCAGG + Intergenic
966942759 3:184757411-184757433 AGACTGGACTTTGCCTCTGCAGG + Intergenic
968947009 4:3670454-3670476 AGCTTGTTCCTTGCCTCCTGTGG - Intergenic
971745470 4:30574377-30574399 ATTCTGTTCCTTGCCTTTTCTGG - Intergenic
973662419 4:53121696-53121718 TGCCTGTGCCTTGCCTTTGCAGG - Intronic
974666756 4:64971850-64971872 TGCCTGAAACCTGCCTCTTCTGG - Intergenic
975524593 4:75334984-75335006 AACTTGTTCCTTGCCTATTCAGG - Intergenic
976886044 4:89985511-89985533 AATCCGTTCCTTGCCTCTTCAGG - Intergenic
979739897 4:124136357-124136379 TGCCCTTTCCTTGCCTCTTCAGG - Intergenic
993576879 5:89612901-89612923 AGCCTGTTACTGGCCTGTTCAGG + Intergenic
995781086 5:115776026-115776048 AGCCTGTATCTTTCCTCTTATGG - Intergenic
998952791 5:147408714-147408736 CCCCTGTAACTTACCTCTTCTGG + Exonic
999176273 5:149633800-149633822 AGTCTATAACTTGCCTCCTCTGG + Exonic
999947676 5:156614761-156614783 AGCCTGTACTTTTCCTCATGGGG + Intronic
1000811345 5:165865588-165865610 AGCCTGTACTGTGTCACTTCAGG - Intergenic
1001116028 5:168940827-168940849 ACCCTGTCCCTTGCCACATCTGG - Intronic
1001814642 5:174657931-174657953 AGTCAGTAATTTGCCTCTTCTGG - Intergenic
1003536735 6:6982031-6982053 AGCCAGTACTTTGCCACATCAGG + Intergenic
1004465375 6:15880468-15880490 AGCCTCTCCATTCCCTCTTCTGG + Intergenic
1004872908 6:19925225-19925247 AGCCTGTGGCTTGTCTGTTCAGG - Intergenic
1005804589 6:29462397-29462419 AGCCTCATCCTTGCCTCTTATGG + Exonic
1005890212 6:30131258-30131280 ACCCTGTTCATTGCCTGTTCTGG + Intergenic
1011431763 6:87294772-87294794 CCCCCGTACCTTGCCTCTCCAGG - Intronic
1014626301 6:123730233-123730255 AGCGTCTACATTGCCTCTTTTGG + Intergenic
1015498013 6:133901061-133901083 AATCTCTTCCTTGCCTCTTCTGG - Intergenic
1016800904 6:148168009-148168031 AGCCTTTCCCTGACCTCTTCAGG - Intergenic
1022016236 7:26350762-26350784 AGACTGTAAATTGCCTCTTATGG - Intronic
1022900747 7:34808153-34808175 AATCTGCCCCTTGCCTCTTCTGG - Intronic
1024090094 7:45930187-45930209 AGTCTGTAGCTTGTCTTTTCAGG + Intergenic
1025296405 7:57778385-57778407 AGCCAGCACCTGGCCTCTCCTGG - Intergenic
1026435467 7:70393171-70393193 AGCCTGTATCTCACCTCCTCGGG + Intronic
1030223865 7:107127216-107127238 GGCAGGTACCTTGCCTCTTCAGG - Intronic
1032045393 7:128602549-128602571 ACACTGCACCTGGCCTCTTCTGG + Intergenic
1033331133 7:140417768-140417790 AGACTGTCCCTCGCCTCCTCTGG + Intronic
1036500980 8:9313717-9313739 GGCCTGTTCCCTGCCTCTCCTGG + Intergenic
1037393454 8:18418450-18418472 ATCCTGTACCTTGTCTCATAGGG - Intergenic
1038113448 8:24525660-24525682 GGCCTGTCACTTGTCTCTTCAGG - Intronic
1040974521 8:53175256-53175278 GGACTCTTCCTTGCCTCTTCCGG - Intergenic
1044929689 8:97239966-97239988 AACCCGTTCCTTGCCTCTGCTGG + Intergenic
1048098136 8:131316542-131316564 AGCCTGAACGTTGCATCTTCTGG + Intergenic
1049068946 8:140342081-140342103 AGCCTGGACTCTGCCACTTCTGG - Intronic
1052803563 9:32992147-32992169 AGCCTCTAACATGCCTCTCCCGG + Intronic
1056001660 9:82223709-82223731 ACTCTGTATCTTGCCTCTTGAGG - Intergenic
1056955013 9:91074572-91074594 TGCCTGTACCCTGCCTGCTCTGG - Intergenic
1057500574 9:95594198-95594220 AGCCTGCACCTTCCCACTTAGGG - Intergenic
1058927233 9:109678652-109678674 TGTCTGTACCTTGTCTCTGCTGG - Intronic
1059467705 9:114479374-114479396 AGCCTGTGCCTGGTCTCCTCTGG + Intronic
1060280165 9:122210329-122210351 AGTCTGTACCCTGCCTATTCAGG + Intronic
1062671081 9:137709761-137709783 AGTCTGTGCCTCTCCTCTTCTGG + Intronic
1186523180 X:10223580-10223602 ACCCTGTACCTTCCCTGCTCGGG + Intronic
1187894688 X:23969308-23969330 AGCCTGCACCTGGCTTCTCCAGG + Intergenic
1188999089 X:36923457-36923479 ATTCTGGACCTTGCCTCTTCTGG - Intergenic
1189294226 X:39907595-39907617 AATCTGTTCCTTGCCTCTTCTGG - Intergenic
1191019269 X:55842328-55842350 AGCCTTCACTTTGCTTCTTCTGG - Intergenic
1200865263 Y:8036785-8036807 TGCCTGTACCTTGCTTCCTTTGG + Intergenic