ID: 954294136

View in Genome Browser
Species Human (GRCh38)
Location 3:49664867-49664889
Sequence GCCTGTACCTTGCCTCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294134_954294136 -2 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294136 3:49664867-49664889 GCCTGTACCTTGCCTCTTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 150
954294130_954294136 18 Left 954294130 3:49664826-49664848 CCTCATTCTGGTGACCATGCCCA 0: 1
1: 0
2: 0
3: 22
4: 148
Right 954294136 3:49664867-49664889 GCCTGTACCTTGCCTCTTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 150
954294133_954294136 -1 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294136 3:49664867-49664889 GCCTGTACCTTGCCTCTTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 150
954294132_954294136 4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 954294132 3:49664840-49664862 CCATGCCCAGCATGGTGAGTACA 0: 1
1: 0
2: 3
3: 24
4: 222
Right 954294136 3:49664867-49664889 GCCTGTACCTTGCCTCTTCTGGG 0: 1
1: 0
2: 1
3: 17
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294136 Original CRISPR GCCTGTACCTTGCCTCTTCT GGG Intronic
902554483 1:17238880-17238902 TCCTGTGCCTTTCCTCTCCTGGG - Intronic
902577621 1:17388428-17388450 GCCTATACCTTGGCCCTCCTCGG + Exonic
902635075 1:17729654-17729676 GCCTGGTCCTTGTGTCTTCTGGG - Intergenic
906382935 1:45344468-45344490 GTCTGTCTCTTGCCTTTTCTTGG - Exonic
907050840 1:51329327-51329349 GGCTGTTCCTTTCCTGTTCTGGG - Intronic
907921693 1:58919854-58919876 GCCTCTACTTGGCCTTTTCTTGG - Intergenic
910211937 1:84802399-84802421 GCATGTATCTTGCCTGTCCTTGG - Intergenic
914825946 1:151138147-151138169 ATCTGTATCCTGCCTCTTCTTGG + Intronic
920497150 1:206463291-206463313 GACTGTGGGTTGCCTCTTCTAGG - Exonic
1063548027 10:7001020-7001042 GCCTGTACCATGTCTCTTTCCGG - Intergenic
1063963483 10:11326571-11326593 GCCTGGACTCTGCCTCTTGTGGG + Intronic
1068052008 10:51962070-51962092 GCCTTTAACTTGCCTCTCCTTGG - Intronic
1070963856 10:80517665-80517687 GCCTGTGGTTTGCCTCTTCTAGG + Intronic
1072578635 10:96721336-96721358 GCCTTCACCTGCCCTCTTCTTGG + Intergenic
1072737854 10:97891326-97891348 GACTGGACCTTCCCACTTCTGGG + Intronic
1072906095 10:99455467-99455489 GCCTTTACACTGCCTTTTCTCGG + Intergenic
1073627223 10:105111798-105111820 GCCTGTACTGACCCTCTTCTAGG - Intronic
1074570349 10:114618655-114618677 GCCTGTGCCTTGCCTCTCCAGGG - Intronic
1075022428 10:118961533-118961555 CCCTACACCTTGCCTCTGCTTGG + Intergenic
1078712474 11:13807765-13807787 GATTCTTCCTTGCCTCTTCTAGG + Intergenic
1080424373 11:32142793-32142815 ACCTGAACCATGCCTCATCTAGG + Intergenic
1082028054 11:47587008-47587030 ACCTGTACCTTTCCAGTTCTGGG - Intronic
1084343548 11:68526627-68526649 GGGTGTTCCTTGCCTCTCCTCGG + Intronic
1084980419 11:72825867-72825889 GCCAGAAACTTGCCTTTTCTAGG - Intronic
1085473274 11:76771659-76771681 GTCTGTCCCCTGCCTCTGCTGGG - Intergenic
1090169998 11:124592848-124592870 GCCTGTATCTTGCCTAACCTGGG - Intergenic
1096104323 12:48987568-48987590 GCCTGTACCAGGCCTACTCTGGG + Intergenic
1096112821 12:49039358-49039380 TCATCTACCTTGTCTCTTCTAGG - Exonic
1097186647 12:57199765-57199787 GTCTGAACCCTGCCTCTTTTAGG - Intronic
1098140717 12:67447838-67447860 GCCTTTTCCTTGTCTCTCCTGGG - Intergenic
1100993330 12:100274512-100274534 GGCTGTACCTTGCTTCTTTCAGG - Intronic
1101029539 12:100645765-100645787 GACTGTCCCTTGCCCCTGCTGGG - Intergenic
1101432575 12:104638844-104638866 GCCTGTACCTTTCGAGTTCTAGG - Intronic
1102041070 12:109801025-109801047 GCCTGCGCCTGGCCTCCTCTAGG - Intronic
1102903446 12:116656741-116656763 GCCTGTACCCGGCCCTTTCTGGG - Intergenic
1103541545 12:121669667-121669689 GCCCCTCCCTTGCCTCTCCTGGG + Intronic
1103827421 12:123751148-123751170 GTCTGTCCCTGTCCTCTTCTTGG + Exonic
1105614023 13:21996271-21996293 GCCTGCACCCTCCCTCTTTTGGG - Intergenic
1106865143 13:33956139-33956161 CCCTCTATCTTGCCTCCTCTTGG + Intronic
1108208045 13:48111071-48111093 GCTTGGCCTTTGCCTCTTCTTGG + Intergenic
1108498416 13:51046677-51046699 TCCTGTACCTTGTCCCCTCTGGG + Intergenic
1108644773 13:52416291-52416313 GCCTCTACTATGTCTCTTCTGGG - Intronic
1115695041 14:35887838-35887860 TCCTGTACCCTGCTTATTCTAGG + Intronic
1116981121 14:51171825-51171847 GCCTGAACCATGTCCCTTCTTGG + Intergenic
1117649467 14:57887754-57887776 GCCTGTGCACAGCCTCTTCTGGG + Intronic
1119955634 14:78796027-78796049 ACCAGTAGCCTGCCTCTTCTGGG - Intronic
1120195381 14:81476854-81476876 CCTTGTGCCGTGCCTCTTCTGGG + Exonic
1122091764 14:99345652-99345674 GCCTGTCCCTTGCCCTTTCACGG - Intergenic
1123923276 15:25085718-25085740 GCCTGTAGCCTGCCTCTGCATGG + Intergenic
1124338353 15:28873836-28873858 GCCTGTACCTCCACTCTCCTTGG - Intergenic
1125965633 15:43873713-43873735 GCCTATCCCTTTCTTCTTCTGGG + Exonic
1127852315 15:62924603-62924625 GCATCTACCTTCCCTCTCCTTGG + Intergenic
1128567919 15:68713573-68713595 ACCCATTCCTTGCCTCTTCTGGG + Intronic
1129368399 15:75071095-75071117 ACCTGTCCCTTCCCTCTCCTTGG + Intronic
1129828607 15:78652171-78652193 GCCTGTATCTGGCCTCTGCTGGG + Intronic
1130716571 15:86340824-86340846 GCCTCTACCTTGCTTCTGGTTGG + Intronic
1137244503 16:46691077-46691099 GCCTGGACCTTGCAGCTTCCTGG + Exonic
1137745537 16:50817520-50817542 GCCTTTACCTAGCTTCTGCTTGG + Intergenic
1138280238 16:55767546-55767568 GCCAGTACCCTGCATCTTCTGGG + Intergenic
1138288250 16:55826092-55826114 GCCAGTACCCCGCATCTTCTGGG - Intronic
1138563964 16:57819056-57819078 GCCTGTATCTCGTCCCTTCTTGG - Intronic
1142538048 17:633926-633948 CCCTGTTCCTACCCTCTTCTTGG + Intronic
1143944794 17:10581254-10581276 GCCTGTGCTTGGCCTCTGCTGGG + Intergenic
1145728617 17:27155897-27155919 GACTGTAGCTTGCCTTCTCTGGG - Intergenic
1147877160 17:43629769-43629791 GCCTTTCCCTTGCCTTTACTGGG - Intergenic
1148055722 17:44794182-44794204 CCCTGTACCATGTCTCTTCTAGG + Intergenic
1148497326 17:48060608-48060630 GCCTGCAGCCTTCCTCTTCTGGG + Exonic
1151185481 17:72360928-72360950 TCCTGTAACTTGCCTCTTGTAGG - Intergenic
1157396033 18:47342379-47342401 CCCTGTACCTTGCCTTTGATAGG + Intergenic
1157399875 18:47378411-47378433 GCCTGTCAACTGCCTCTTCTGGG + Intergenic
1163248709 19:16112923-16112945 GCTTTTATCTTGCATCTTCTTGG - Intronic
1163849776 19:19656385-19656407 GCCTGCACTTGGCCTCGTCTGGG + Intronic
1164078860 19:21845391-21845413 GCCTGGACCTTGCATATTTTGGG - Intronic
1165742152 19:38210863-38210885 GCCTGCACCCTGCCTCTCCCCGG - Intergenic
1167067737 19:47199534-47199556 GGCTGTGGCTTTCCTCTTCTAGG + Intronic
1168671729 19:58245878-58245900 GTCTGTACCATTCCTTTTCTGGG - Intronic
926028255 2:9563574-9563596 GTCTTTTCCTTGCCTCTTCCTGG - Intergenic
927703635 2:25283628-25283650 GCCAGAGCCTTGGCTCTTCTGGG - Intronic
928321820 2:30289842-30289864 CCCTCTACCTTGCCTCTTCAAGG - Intronic
928655971 2:33452486-33452508 GCCTGGAGCTTGCATCTCCTGGG + Intronic
929136082 2:38625007-38625029 GTCTCTAGCATGCCTCTTCTAGG + Intergenic
929852506 2:45605407-45605429 ACCTGTACTTTCGCTCTTCTTGG + Exonic
936082160 2:109439741-109439763 GCCTGTATCTAGCTCCTTCTCGG - Intronic
937076506 2:119111258-119111280 GCCTGTTCCTTCTCTCTTCCTGG - Intergenic
945891953 2:215439186-215439208 GACTGTGCCTTGTTTCTTCTTGG + Intergenic
947969805 2:234313540-234313562 GCCTGCACCTTGCATCTTAGGGG + Intergenic
948256396 2:236571586-236571608 GCCTATACTTGGCCTGTTCTGGG - Intronic
948966041 2:241381173-241381195 CCCTGTACCTGGCCTGTTGTGGG + Intronic
1170060526 20:12254053-12254075 GCCTGTACCTTGCATTACCTCGG - Intergenic
1170539696 20:17375391-17375413 GCCTTTACCTTCTCTTTTCTTGG - Intronic
1172592250 20:36126071-36126093 GCCTGTAGTTTGACTTTTCTGGG + Intronic
1173857366 20:46258878-46258900 TCCTGGACCTCCCCTCTTCTTGG - Intronic
1174190774 20:48738856-48738878 GCCAGCTCCTTCCCTCTTCTGGG - Intronic
1176975636 21:15317542-15317564 GCAAGTACCTTGCCTGTCCTGGG - Intergenic
1177064724 21:16416113-16416135 ACCTATTCCTTACCTCTTCTGGG + Intergenic
1177282466 21:18999975-18999997 GACTGTACCTTGCCTTTTTAAGG + Intergenic
1177647585 21:23918938-23918960 ACCTGCACCTTCCCTCTTATTGG - Intergenic
1179903306 21:44406203-44406225 GCCTGTACGTCACCTCTTCCAGG + Intronic
1181055281 22:20258034-20258056 GCCTGCACCTGGCCTCTCCCTGG + Intronic
1181581264 22:23829344-23829366 GCCTGTCCCTGGTCTCCTCTCGG - Intronic
1181791291 22:25268929-25268951 GCCTGTACCTACCCACGTCTAGG + Intergenic
1182442768 22:30373824-30373846 GCCTGTCCCATGTCTTTTCTTGG + Intronic
1182776996 22:32838591-32838613 TCCTGTGACTTGCCTCTTTTTGG + Intronic
1184257564 22:43295874-43295896 GCTTGTACTTCGCCTCTTCCAGG - Intronic
1185302289 22:50088217-50088239 GCCTGGACCTTGCCTGTCCATGG - Intergenic
950239330 3:11353931-11353953 CCCTTTACCCTGCTTCTTCTGGG + Intronic
950621003 3:14205207-14205229 GCCTCTAGCCGGCCTCTTCTAGG + Intergenic
951166280 3:19487811-19487833 GACTGTCCCTTGCCTTTGCTGGG - Intronic
951185142 3:19704073-19704095 GTCTGTGACTTGCCTTTTCTTGG - Intergenic
951517399 3:23576367-23576389 GCCTGCACTTTGCCATTTCTTGG - Intronic
952063715 3:29541888-29541910 GCTTGCTCCTTCCCTCTTCTAGG + Intronic
952768634 3:36977040-36977062 GCCTGTCTCTTACCTCTTCTGGG - Intergenic
954294136 3:49664867-49664889 GCCTGTACCTTGCCTCTTCTGGG + Intronic
956233823 3:67044368-67044390 GCAAATACCTTGCCTTTTCTAGG + Intergenic
956481865 3:69681216-69681238 GCCTGATTCTTGCCTCTTATAGG + Intergenic
957271327 3:78033806-78033828 GTCTATTCCTTGCCTCTTCTAGG - Intergenic
960088478 3:113615246-113615268 GCCTGCTCCATGCCTTTTCTGGG + Intronic
968592050 4:1464200-1464222 GGCTGCTCCTTCCCTCTTCTGGG + Intergenic
968947008 4:3670453-3670475 GCTTGTTCCTTGCCTCCTGTGGG - Intergenic
969230554 4:5827318-5827340 GCCTGTGCCTGGCCTTGTCTCGG + Intronic
971829834 4:31676704-31676726 GCTTGTCCCTGGCCACTTCTTGG - Intergenic
975676463 4:76832281-76832303 GCCTGTACCCTGCCTCTTCCTGG + Intergenic
984447914 4:179860611-179860633 GTCTGTTCCTTGCCTCTTCCAGG - Intergenic
984585090 4:181554143-181554165 GCATCTACCTTTCCTCATCTTGG - Intergenic
990239119 5:53799243-53799265 GTCTGCACCTTGCTTCTTATAGG - Intergenic
991337325 5:65563492-65563514 GCAGCTACCTTTCCTCTTCTTGG - Exonic
992901464 5:81301279-81301301 GCCTTTACCTTGCCTCTGCCTGG + Intergenic
994369458 5:98951765-98951787 ACCTGTACCCTGCCTTTTGTTGG + Intergenic
997642042 5:135455674-135455696 TCCTGTACCTTGGCTCTTCCTGG + Intergenic
998627800 5:143865222-143865244 GCCGATATCTTGCCTCATCTAGG + Intergenic
999176274 5:149633801-149633823 GTCTATAACTTGCCTCCTCTGGG + Exonic
1001251836 5:170152754-170152776 GTCTGTACCTTCCTTCTTCCTGG + Intergenic
1002315963 5:178343403-178343425 GCTTGTCCCCTGCCTTTTCTAGG - Intronic
1003508965 6:6763451-6763473 ACCTGTCCCTTGCTTCTTCCCGG - Intergenic
1004031118 6:11870481-11870503 GCCTACATCTTGCCTGTTCTGGG + Intergenic
1005890214 6:30131259-30131281 CCCTGTTCATTGCCTGTTCTGGG + Intergenic
1005893083 6:30155838-30155860 TCTTGTCCCTTCCCTCTTCTTGG - Intronic
1006193437 6:32223130-32223152 GCCTCCACCTTTCCTCTTCTAGG + Intronic
1006460650 6:34155688-34155710 GGCTGCACCTGGCATCTTCTGGG - Intergenic
1013069921 6:106719380-106719402 GCCTGTTGCTTCCCTCATCTGGG - Intergenic
1013820510 6:114148328-114148350 CACTGTGCCTGGCCTCTTCTAGG - Intronic
1018798866 6:167207568-167207590 GCCTCTCCCTTGCCTCTCCTTGG - Intergenic
1019471460 7:1223708-1223730 GCCTGCATCTTCCCTCTCCTGGG - Intergenic
1019847285 7:3517780-3517802 GCCTGTGCATTTCCTCTCCTAGG + Intronic
1019972389 7:4551498-4551520 GACCCTACCTTGCCCCTTCTTGG - Intergenic
1025782588 7:64615071-64615093 GCCTGGACCTTGCATGTTTTTGG + Intergenic
1031062190 7:117064701-117064723 GTCTGTACATTGCCTGGTCTGGG + Intronic
1032045394 7:128602550-128602572 CACTGCACCTGGCCTCTTCTGGG + Intergenic
1034555817 7:151849751-151849773 GCCTGTGTCTTCCATCTTCTTGG + Intronic
1039550822 8:38441635-38441657 GCATCTACCTTTGCTCTTCTTGG - Intronic
1039568990 8:38571911-38571933 GCCTGTAACTACCCACTTCTAGG + Intergenic
1043701517 8:83293926-83293948 GCCTGGACCTTTGCTTTTCTTGG + Intergenic
1048098137 8:131316543-131316565 GCCTGAACGTTGCATCTTCTGGG + Intergenic
1048517177 8:135121764-135121786 TCCTGTACCTTCACACTTCTAGG - Intergenic
1050154263 9:2649287-2649309 GTCTGTTCCAGGCCTCTTCTTGG + Intronic
1053595906 9:39561361-39561383 GACTATACCTTACCTCTGCTGGG + Intergenic
1053853873 9:42318002-42318024 GACTATACCTTACCTCTGCTGGG + Intergenic
1054570354 9:66803654-66803676 GACTATACCTTACCTCTGCTGGG - Intergenic
1058385079 9:104426821-104426843 GTCTATTCCTTGCCTCTTCCAGG - Intergenic
1058927232 9:109678651-109678673 GTCTGTACCTTGTCTCTGCTGGG - Intronic
1059566932 9:115391927-115391949 GCCTGTGAATTGCCTCATCTGGG - Intronic
1187740097 X:22346314-22346336 GCCTGTACATTGCTTTTACTTGG - Intergenic
1188025977 X:25209794-25209816 GTCTGTTCCTTGCTTCTTCCAGG - Intergenic
1190426133 X:50335854-50335876 GACTGTCCCTTGCCTTTGCTGGG - Intronic
1190439180 X:50460273-50460295 GTCTCTACCTTTTCTCTTCTGGG - Intronic
1190635069 X:52425295-52425317 GCCTGTATGTTGCTTCATCTGGG - Intergenic
1190654204 X:52596835-52596857 GCCTGTATGTTGCTTCATCTGGG + Intergenic
1191019268 X:55842327-55842349 GCCTTCACTTTGCTTCTTCTGGG - Intergenic
1202072668 Y:21008536-21008558 GTCTGTTCCTTGACTCTTTTTGG + Intergenic