ID: 954294141

View in Genome Browser
Species Human (GRCh38)
Location 3:49664879-49664901
Sequence CCTCTTCTGGGAAAGGCCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294134_954294141 10 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294141 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 9
4: 176
954294130_954294141 30 Left 954294130 3:49664826-49664848 CCTCATTCTGGTGACCATGCCCA 0: 1
1: 0
2: 0
3: 22
4: 148
Right 954294141 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 9
4: 176
954294133_954294141 11 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294141 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 9
4: 176
954294132_954294141 16 Left 954294132 3:49664840-49664862 CCATGCCCAGCATGGTGAGTACA 0: 1
1: 0
2: 3
3: 24
4: 222
Right 954294141 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 9
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294141 Original CRISPR CCTCTTCTGGGAAAGGCCCG AGG Intronic
900095686 1:939255-939277 CCTCTGCTGGGGAGGACCCGGGG - Exonic
900136787 1:1121155-1121177 GCCCTTCTGGGAATGGCCTGCGG - Intergenic
900516897 1:3086443-3086465 CCTGTGCTGGAAAACGCCCGAGG + Intronic
901960110 1:12819557-12819579 CCTCTCCTGGGAAGGGCAAGGGG - Intergenic
902992899 1:20202005-20202027 CCTCTTCTTGGATAGACCCAAGG - Intergenic
903658259 1:24961889-24961911 CCCCTTCTGGTAAAAGCCTGTGG + Intronic
905631987 1:39524123-39524145 CATCTCCTTGGAAAGGCCCAGGG + Intronic
913279657 1:117173805-117173827 CCTCTTCTTGGCAAGGGCCCAGG - Intronic
915031461 1:152883471-152883493 GCTCTTCTGGGAACGTCCCTGGG - Intronic
915308922 1:154997488-154997510 CCTCCCCTGGCAAAGGCCCTTGG - Intergenic
915676992 1:157541227-157541249 CCTCTACTGGGACTGGCCTGGGG + Intronic
916674164 1:167052489-167052511 CCCCTTCTGAGAAAGGGGCGGGG - Intergenic
916890196 1:169106400-169106422 CCTCTGCAGAGACAGGCCCGGGG - Exonic
922600860 1:226851836-226851858 CCTCTTCTGCGATAGTCCCTGGG - Intergenic
1063376105 10:5555380-5555402 CGTTTTCTGAGAAAGGCCGGGGG - Intergenic
1064743196 10:18454028-18454050 CCTATTGTGGGAAAGGCGCTGGG - Intronic
1065022615 10:21512863-21512885 CCTCTTATTGTAAAGGACCGAGG - Intergenic
1068097268 10:52507070-52507092 CCTCTTCTGTGATAGTCCCTGGG + Intergenic
1068419171 10:56767014-56767036 CCTCTTCTGTGATAGTCCCTGGG + Intergenic
1071898368 10:90089984-90090006 CCTCTTCTGAGATAGTCCCTGGG - Intergenic
1072622742 10:97090758-97090780 CCTCTTCTGTGAAAGCGCCAAGG - Intronic
1073076045 10:100826473-100826495 CCTCTTGAGGGAAAGGCGGGAGG + Intronic
1073642710 10:105269304-105269326 AATCTTCTGGGAGAGGCCCCAGG - Intergenic
1073646868 10:105313951-105313973 CCACTTCTGGAACAGGCCAGGGG + Intergenic
1076732714 10:132446502-132446524 CAGCTTCTTGGAGAGGCCCGGGG + Intronic
1076738577 10:132469437-132469459 CCCCTCCTGGGACAGGCCCCAGG - Intergenic
1077905487 11:6529699-6529721 CCTGTACTGGGGAAGGCCGGTGG + Intronic
1078079097 11:8191171-8191193 CCTCTTATGGAAAAGGCCCAAGG - Intergenic
1078912626 11:15747159-15747181 CCACTTCTGGGAAAGGGTCAAGG + Intergenic
1079690175 11:23407038-23407060 TCTCTTCTGGAAAAGCCCCGGGG + Intergenic
1081430088 11:42967294-42967316 CCTCTGCTGGGATAAGCCCAGGG + Intergenic
1083106307 11:60361612-60361634 CCTCTTATGGGGGAGGCCTGGGG - Intronic
1083695347 11:64438805-64438827 TCTTTTCTGGGAAAGTCCCAGGG - Intergenic
1089299992 11:117492779-117492801 CCTCCCCTGGGAAAGGCTGGGGG + Intronic
1089971784 11:122699411-122699433 CTTCTTCTGTGAAATGCCTGTGG + Intronic
1090435624 11:126684234-126684256 CCCGTTCTGGGAAAGCCCCTGGG + Intronic
1094522390 12:31206493-31206515 ACTCTGTTGGGAAAGGCCTGTGG + Intergenic
1096498255 12:52051004-52051026 CCTCATCCGGGGAAGCCCCGCGG + Intronic
1096502607 12:52074062-52074084 CCTCTTCAGGGGAGGGCGCGCGG + Intronic
1096914877 12:55020400-55020422 TCTCTTCTGGGTAAGGCAGGAGG + Intronic
1098408770 12:70155962-70155984 CCTCTTCTGTGATAGTCCCTGGG - Intergenic
1098532576 12:71557665-71557687 CCTCCCCTGGGAAAAGCCTGGGG - Intronic
1102346417 12:112163826-112163848 CCTCTCTTGGGAGAGGCCTGGGG + Intronic
1102672612 12:114632882-114632904 CCTCTTCTGTGCCAGGCCCTGGG + Intergenic
1103400942 12:120642015-120642037 ACTCTTGAGGGAAAGGCCTGAGG - Intronic
1104749883 12:131231690-131231712 CGTCCTCTGGGGAAAGCCCGTGG - Intergenic
1104897923 12:132173370-132173392 CCTGTGCTGGGAAAGGCCAAGGG - Intergenic
1105012813 12:132766878-132766900 CGTCATCTGGGAAAGGCTTGGGG + Intergenic
1106552909 13:30787191-30787213 CCTCTTCTGGTGATGGCCCTGGG - Intergenic
1109778374 13:67074298-67074320 CCTCATCTGGGGAAGGGGCGAGG - Intronic
1112413456 13:99184090-99184112 CCTCTTCTGTGATAGTCCCTGGG + Intergenic
1114646736 14:24260240-24260262 CCTCTCCTGGCAAAGGCCCCTGG - Intronic
1116415213 14:44670323-44670345 CCTCTTCATGGAAAGGGCAGAGG + Intergenic
1117286253 14:54288246-54288268 CTTTTTCTGTAAAAGGCCCGAGG + Intergenic
1118610233 14:67533663-67533685 CCGCTCCTGGGAAGGGCCCTCGG + Intronic
1118612665 14:67553776-67553798 ACTCCTCTGGGACAGGCCTGAGG + Intronic
1121147509 14:91597657-91597679 CCTCTTCTGCGATAGTCCCCGGG + Intronic
1121658899 14:95620169-95620191 CCTCTTCTGGGAGAGGGAGGTGG - Intergenic
1122374518 14:101249069-101249091 CCTCTTCTGGCACAGGGCGGTGG + Intergenic
1122627996 14:103094055-103094077 CCTCTTCTGGGAAGTGTCAGTGG + Intergenic
1122939529 14:104975041-104975063 CCTCTTCTGGGAAGTCCCCTGGG - Intronic
1124264227 15:28219347-28219369 CCTCTGTGGGGAAAGGCCCCAGG + Intronic
1130046866 15:80452624-80452646 CCTCTTCTGGAAAAGGACTTGGG - Intronic
1132985570 16:2765413-2765435 CTTCGTCTGGGAAGGGCCCGAGG - Exonic
1133210653 16:4261744-4261766 CCTCTGCTGGGCACGGCGCGCGG - Intronic
1134268939 16:12716967-12716989 CTTCTTCTGGGAAAGCTCTGGGG - Intronic
1139431629 16:66913874-66913896 CCTCTTCTAGGAATGCCCTGGGG - Intronic
1139512803 16:67436973-67436995 CCACTGCTGGGGAAGGGCCGGGG - Exonic
1140839407 16:78825285-78825307 CCTCTTCTTGGAAATTCGCGCGG - Intronic
1141593501 16:85083742-85083764 CTTCTTCTGGGGAAGGCTCAGGG - Intronic
1141891873 16:86931362-86931384 CTCCTTCCGGGAAAGGCCAGGGG + Intergenic
1142220913 16:88854515-88854537 TCCCTTCTGGGGTAGGCCCGAGG + Intronic
1142622525 17:1173863-1173885 CCTCATCCGGGAAAGCCTCGAGG - Intronic
1143635366 17:8161431-8161453 CCTCTCCAGGGAAAGGGCCCCGG + Intronic
1144300781 17:13921789-13921811 CCTCTTCTGTGATAGCCCCTAGG + Intergenic
1146000649 17:29128362-29128384 CCGCTTCCGGGACAGGCCCTGGG + Intronic
1146441662 17:32901435-32901457 CCTCTTCTGTGATAGTCCCTGGG + Intergenic
1147304530 17:39554109-39554131 CCTCTTCTGGAAAGTGCCCAGGG - Intronic
1147583326 17:41638787-41638809 CCTCTTTTGGGAAGGGCCCCTGG - Intergenic
1147596101 17:41718506-41718528 CCTCTTCTGGGACAGGCGGTAGG - Intronic
1149895582 17:60426213-60426235 CTTCTTCTGGGGAAGGTCCCTGG - Exonic
1151459974 17:74248668-74248690 CCTCTTCTGGGACAGACCTTTGG - Intronic
1152658469 17:81530784-81530806 TCACTGCTGGGACAGGCCCGAGG - Intronic
1153156958 18:2160742-2160764 CCTCTTCTGTGATAGTCCCTGGG - Intergenic
1160183414 18:76655639-76655661 CCATTTCTGGGAAGAGCCCGTGG - Intergenic
1160947002 19:1648333-1648355 CCACCTCTGGGTAAAGCCCGAGG + Intronic
1161369468 19:3902481-3902503 TCTCTTCTGGGAGTGGCCTGCGG - Exonic
1164146753 19:22517436-22517458 CTTCTTCAGGGAAAGCCCCCCGG + Intronic
1164458462 19:28428017-28428039 CCACTTCTGGGAAAGCCTCCAGG + Intergenic
1165393630 19:35551973-35551995 CCTCTTTTCCCAAAGGCCCGCGG - Intronic
1166275601 19:41751503-41751525 ACTCTTCTGGAAAAGGCTTGGGG - Intronic
1167159320 19:47756853-47756875 CCTCTTCTGGGCATGGCCAAGGG - Intronic
925606527 2:5666264-5666286 GCTGGTCAGGGAAAGGCCCGGGG - Intergenic
926226380 2:10969946-10969968 CCTTCTCTGGGAAAGACCCCAGG - Intergenic
931069299 2:58626535-58626557 ACTCTTCTGGGAGAGGCCTGTGG + Intergenic
933949591 2:87316979-87317001 CCTCTTCTGTGAAATGCCATTGG + Intergenic
934712310 2:96523965-96523987 CCTCCTCTGGGAAAGGGCCAGGG - Intergenic
935640238 2:105283170-105283192 TCTGTTCTTGGAAAGACCCGTGG - Intronic
936330600 2:111544618-111544640 CCTCTTCTGTGAAATGCCATTGG - Intergenic
937992727 2:127673524-127673546 CGTCTCCAGGGAAAGGCCCAAGG + Intronic
941691336 2:168503357-168503379 CCTCTTCAGGTAAAGGCAAGAGG + Intronic
946631386 2:221672744-221672766 CCTCTTCTGGGAAGGGGTCATGG - Intergenic
947665984 2:231905498-231905520 CTGCCTCTTGGAAAGGCCCGTGG + Intergenic
1169909277 20:10634169-10634191 CCTCTTCTGGGAAAGTAGTGGGG + Intronic
1170592575 20:17782124-17782146 CCTTCTCTGGGAAAGGCCTTTGG - Intergenic
1170596110 20:17806990-17807012 CCTCTGCTGGGGAGAGCCCGAGG + Intergenic
1172112363 20:32554623-32554645 CCTCTCCTGGGAAACCCCCCAGG + Intronic
1173258102 20:41409334-41409356 CCCCTTCCAGGAAAGGCCTGCGG + Intronic
1174246779 20:49187958-49187980 CCTCCTCCGGGAAGGCCCCGCGG + Intronic
1175525700 20:59631946-59631968 TCTCTCCTGGGAAAGGACAGAGG - Intronic
1176260626 20:64177708-64177730 CCGCTGCTGGGAAAGGCTGGGGG + Intronic
1177194867 21:17893190-17893212 CCTCTGGTGGGAAAGACCCTGGG + Intergenic
1181021937 22:20108118-20108140 CCTCTTCGGGGACAGTGCCGAGG - Intronic
1181992130 22:26845355-26845377 CAGCTTCTGGGACAGGCCAGGGG + Intergenic
1182287253 22:29255724-29255746 CCTCCTCTGGGCCAGGCCAGAGG - Intronic
1183984584 22:41562449-41562471 CGTGTCCTGGGAAAGGCCAGAGG + Intronic
1184241689 22:43214383-43214405 GCTCTTCTGGGATAGGTCAGGGG - Intronic
949809203 3:7988009-7988031 CCTCTTATGGGAATGGCTGGGGG - Intergenic
950007435 3:9700433-9700455 CCTCTTCTATTAAAGGCCCTTGG + Intronic
950600089 3:14027050-14027072 CCTCTTCTGTGATAGTCCCTGGG + Intronic
950903012 3:16513786-16513808 CATCTTCAGGGAAAGCCTCGCGG + Intronic
951308371 3:21094981-21095003 CCTCTTCTGGGATAGTCCCTGGG + Intergenic
952742530 3:36748438-36748460 CCTGTTCTGGGGAAGGCAGGTGG - Intergenic
953161448 3:40424096-40424118 CCTCTTCTGGGAAACTCACAAGG - Intronic
953221188 3:40973300-40973322 TTTCTTCTTGGAAAGGCCCCAGG - Intergenic
953250647 3:41243606-41243628 CCTCTGATGGGAGAGGCCAGAGG + Intronic
954294141 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG + Intronic
954994192 3:54866629-54866651 TGTGTTCTGGGAAAGGCCAGAGG - Intronic
959980523 3:112511401-112511423 CCTCTTCTGTGATAGTCCCAGGG + Intergenic
961658176 3:128454518-128454540 CCTCTTCAGGGACAGGCACTAGG + Intergenic
963044521 3:141092966-141092988 CCTCCTCTGAGCAAGGCCTGGGG - Intronic
966746934 3:183286006-183286028 CGTCATCTGGGAAAGCCCGGTGG - Intronic
967387535 3:188926279-188926301 CCTCTTCTGGGAAACACTCCAGG + Intergenic
973553653 4:52060144-52060166 TCTCTTCTGGGCCAGGCCCCAGG + Intronic
974626175 4:64431153-64431175 CTTCTTCTCGGTAAGGCCCTTGG - Intergenic
975579331 4:75892476-75892498 CCTCATCTGGAAAAGGGGCGGGG + Intronic
986622317 5:9688685-9688707 CCTGTTCTGTGCATGGCCCGTGG - Intronic
992765219 5:79991929-79991951 CCTCTTCTGTGAAAGGCAAAAGG - Intronic
1001781430 5:174372174-174372196 CCTCTGCTGGGCTGGGCCCGGGG - Intergenic
1002202543 5:177538272-177538294 CCTTTGCTGGGAAAGGGCTGCGG + Intronic
1002456737 5:179349591-179349613 CCTCATCTGGGAAAGGCCTTTGG + Intergenic
1003246830 6:4388928-4388950 CCCCTGCTGTGAAAGGCACGAGG - Intergenic
1005681827 6:28216182-28216204 CCTCTTCTGGCAAAGGCAGAGGG + Intergenic
1006502109 6:34465827-34465849 CCTCTTCTGGGGGCTGCCCGCGG - Intergenic
1006665159 6:35688487-35688509 CCTCTGCCGGGAGAGGCCGGCGG + Intronic
1011405999 6:87015960-87015982 CCTTTTCTGGTAAAGGCTCTTGG - Exonic
1011805591 6:91069513-91069535 CTTCTCCTGGGGAAGGCCCTGGG + Intergenic
1013612802 6:111810774-111810796 CCTCTTCCTGGAAGGGCCCCAGG - Intronic
1015024823 6:128520273-128520295 CCTCTCCTGGGATCGGCCCAAGG - Exonic
1017351346 6:153445736-153445758 CCTCTTCTGTGATAGTCCCTGGG + Intergenic
1018145760 6:160886679-160886701 CCTCTTCTGTGATAGTCCCTGGG - Intergenic
1019163908 6:170086889-170086911 CCTCCTCTGGGAAAGCCGCCTGG + Intergenic
1019554157 7:1620213-1620235 CCTCTTGTGGGAAAGGGGTGAGG + Intergenic
1019554326 7:1621099-1621121 CCTCTTCTGGGACTCGCCGGAGG + Intergenic
1020346966 7:7175878-7175900 CCTCTTCTTGGAAGGGCACCAGG + Intronic
1022330107 7:29370640-29370662 CCTAATCTGGGAGAGGCCCATGG - Intronic
1024048324 7:45600358-45600380 GCTCTTCCAGGAAAGGCCAGTGG - Intronic
1027258396 7:76445929-76445951 TCTCTCCTGGCAAAGGCCCAGGG - Intergenic
1027280452 7:76606089-76606111 TCTCTCCTGGCAAAGGCCCAGGG + Intergenic
1028078773 7:86548217-86548239 CCTCATCTGGGAATTGCCAGGGG - Intergenic
1029537508 7:101164973-101164995 CCTCTTCTGGGTAAGGTTTGGGG - Intronic
1031635932 7:124100889-124100911 CTCCTTCTGGGAAATGCCCATGG + Intergenic
1034830074 7:154301308-154301330 CCTCTTCTGTGCAAGGCGCTTGG + Intronic
1045480328 8:102586499-102586521 CCTCTTGTGGGAGAGTCCCCAGG + Intergenic
1048172899 8:132124842-132124864 CATCTTCTGGGAAAGCACAGGGG + Exonic
1048996219 8:139795165-139795187 GCCCTGCTGGGGAAGGCCCGGGG + Intronic
1049289508 8:141794324-141794346 TCTCTCCTGGGTAAGGCCCCGGG - Intergenic
1057562760 9:96140935-96140957 CCTGTTCCGGGCAAGGCCCCCGG - Intergenic
1057855179 9:98596041-98596063 CCTCTGTTGGGGAAGGCCCATGG + Intronic
1058886013 9:109321323-109321345 CCTCTTCTGGAAAAGGAGAGGGG + Intergenic
1058888573 9:109341825-109341847 CCTCTTCGCGGGAAGGCCTGAGG + Intergenic
1060814062 9:126625665-126625687 CCTCTTCTCCGCCAGGCCCGTGG + Intronic
1061419717 9:130466626-130466648 CCTCTCCTGGGAGGGGCCCATGG - Intronic
1061808892 9:133151233-133151255 CCCCTGCTGGGACAGGCCTGCGG + Intergenic
1062355311 9:136159232-136159254 GGTCTTCTGGGAGAGGCCAGTGG - Intergenic
1062374677 9:136256587-136256609 CATCTGCTGGGAAGGGCCCTGGG + Intergenic
1191624855 X:63259667-63259689 CCTCTTCTGTGATAGTCCCTGGG + Intergenic
1193973836 X:88092334-88092356 CCTCTTCTGTGATAGTCCCTTGG + Intergenic
1194008746 X:88531712-88531734 CCTCTTCTGTGATAGTCCCTGGG + Intergenic
1195225732 X:102791173-102791195 CCTCTTCTGCGATAGTCCCTGGG + Intergenic
1196518300 X:116640314-116640336 CCTCTTCTAGGAAAGTGCAGAGG - Intergenic
1198115778 X:133543493-133543515 CCTCTTCTAGGAGAGGCCATTGG - Intronic
1199160496 X:144604690-144604712 CCTCTTCTGTGATAGTCCCTGGG + Intergenic
1199869391 X:151884016-151884038 CCTCTTCTGTGATAGTCCCTGGG - Intergenic
1200954011 Y:8927456-8927478 CCTTCTCTGGGACAGGCCCCTGG - Intergenic
1201398048 Y:13570876-13570898 CCTCATCTGGGAAATGCAAGGGG + Intergenic