ID: 954294142

View in Genome Browser
Species Human (GRCh38)
Location 3:49664885-49664907
Sequence CTGGGAAAGGCCCGAGGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 239}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294133_954294142 17 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294142 3:49664885-49664907 CTGGGAAAGGCCCGAGGCACTGG 0: 1
1: 1
2: 0
3: 18
4: 239
954294137_954294142 -6 Left 954294137 3:49664868-49664890 CCTGTACCTTGCCTCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954294142 3:49664885-49664907 CTGGGAAAGGCCCGAGGCACTGG 0: 1
1: 1
2: 0
3: 18
4: 239
954294132_954294142 22 Left 954294132 3:49664840-49664862 CCATGCCCAGCATGGTGAGTACA 0: 1
1: 0
2: 3
3: 24
4: 222
Right 954294142 3:49664885-49664907 CTGGGAAAGGCCCGAGGCACTGG 0: 1
1: 1
2: 0
3: 18
4: 239
954294134_954294142 16 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294142 3:49664885-49664907 CTGGGAAAGGCCCGAGGCACTGG 0: 1
1: 1
2: 0
3: 18
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294142 Original CRISPR CTGGGAAAGGCCCGAGGCAC TGG Intronic
900313913 1:2047853-2047875 CTGGGTCAGGCCCTCGGCACTGG - Intergenic
900373859 1:2344454-2344476 CTGGGAAAGGCCTGGGGGACGGG + Intronic
900463946 1:2814859-2814881 CTGGGAGGGGCCCCAGACACTGG + Intergenic
900558269 1:3290843-3290865 TTGGGAAGGGCCCGGAGCACTGG + Intronic
904034869 1:27553091-27553113 CTGGCAGAGCCCCCAGGCACGGG - Exonic
904465543 1:30705128-30705150 CTGGAAAAAGCCCCAGGCATGGG + Intergenic
904822941 1:33256803-33256825 CTGGGCCGGGCCCGAGGCGCAGG - Intronic
905028203 1:34865534-34865556 CTGGGAAAGGGGAGAGGCCCAGG + Exonic
905882509 1:41474029-41474051 CTGTGACAGGCCCCAGGCAGTGG + Intergenic
906206057 1:43987017-43987039 CTGGGAGAAGCATGAGGCACTGG + Intronic
907420722 1:54345406-54345428 CAGGGAAAAGACCAAGGCACTGG + Intronic
908703319 1:66924980-66925002 CTGGGAGGGGCCTGAGGCCCGGG - Exonic
912554373 1:110505479-110505501 CAGGGAAAGGCCTCAGGCTCGGG + Intergenic
913049284 1:115102720-115102742 CTGGGAAAGGGCATGGGCACAGG - Intergenic
916438437 1:164798526-164798548 CTAGGAAAGGACAGAGGCCCTGG + Intronic
919743665 1:200995310-200995332 CTGGGCTAGGCCCTGGGCACTGG - Intronic
920965037 1:210694402-210694424 TGGGTAGAGGCCCGAGGCACTGG + Intronic
921745159 1:218732070-218732092 CTGGAAAAGGACTCAGGCACTGG - Intergenic
923546732 1:234928782-234928804 CCGGGGCAGGCCCGTGGCACAGG + Intergenic
924137067 1:240979580-240979602 CGGGGAGAGGCCTTAGGCACTGG + Intronic
1063161170 10:3420134-3420156 CTGGTAAAAGACCGAGGCAGAGG + Intergenic
1064528291 10:16281279-16281301 CTGGGAAATGCCCTAGAAACTGG - Intergenic
1067225229 10:44372003-44372025 GTGGGAAGGGCCCGAAGCACAGG + Intronic
1067972847 10:50991850-50991872 CTGGGAAAGGCGAGCTGCACGGG + Intronic
1071523269 10:86344065-86344087 CTGGGCAAGGGCCCAGGCACTGG - Intronic
1071571212 10:86698466-86698488 CTGAGAAAGGCCAGTGCCACAGG - Intronic
1072673268 10:97446994-97447016 CGGGAAAAGGCCGGAGGCAGTGG - Intronic
1072791511 10:98321459-98321481 CTGAGACAGGCCCCAGGCCCTGG + Intergenic
1073099826 10:101000553-101000575 CTCGGAGAGGCCCGAGGGTCAGG - Exonic
1073483589 10:103802574-103802596 CTGGGAAAGGCCTGAGTTAGAGG + Intronic
1073625873 10:105096206-105096228 CTGGGAAAGGTCCTGGGCATTGG + Intronic
1074450144 10:113552731-113552753 CTGGCAGAGGCCTGTGGCACAGG + Intronic
1074693457 10:116027326-116027348 CTGTGAACTGCCCCAGGCACTGG - Intergenic
1075573056 10:123559172-123559194 CTCGGACAGAGCCGAGGCACAGG + Intergenic
1075803042 10:125164569-125164591 CTGAAAAAGGCCCGTGGGACCGG + Intergenic
1076406000 10:130212892-130212914 CTGGGAAAGGCCCGGGGTAGGGG - Intergenic
1076520552 10:131078302-131078324 CTGGGAAAGGACCCGGGCTCTGG - Intergenic
1076590790 10:131580729-131580751 CAGGGAAAGGCCAAAGGCAGTGG - Intergenic
1077146944 11:1050638-1050660 CGGGGACAGGCCCGAGGTGCGGG + Intergenic
1077521400 11:3037517-3037539 CAGGGAAAGGCCTGAGGAAGAGG + Intronic
1077752097 11:4983550-4983572 CTAGGAGAGGTCCTAGGCACAGG + Intronic
1078399386 11:11010655-11010677 CTGGGACAGGACAGAGGCTCCGG + Intergenic
1081570198 11:44286072-44286094 CAGGAAAAGGCCCCAGGCCCTGG + Intronic
1081605874 11:44526757-44526779 CTGGGATAGGCCTGGGGCAAGGG - Intergenic
1081677406 11:44979006-44979028 CTGGGCTAGGCCTGAGGCTCAGG - Intergenic
1083259210 11:61514137-61514159 CAGGGAAGGGCCCGAGCCAGTGG + Intergenic
1083583644 11:63840479-63840501 CTGGGAAAGGACTGAGCAACAGG - Intronic
1084661857 11:70550753-70550775 CTGGGAGAGCCCCGTGGCCCAGG - Intronic
1085022552 11:73218464-73218486 CTGGGAGAGGCCCGGGGAAGCGG + Intronic
1086224757 11:84494459-84494481 CTGGGAGTGGCCCAAGGCCCTGG - Intronic
1086822079 11:91446567-91446589 CTGGGAAAGAAACAAGGCACCGG + Intergenic
1087308549 11:96513097-96513119 CTGGGAAAGGCCCCTGGGAAGGG + Intergenic
1089616587 11:119698247-119698269 CTGGGAAAGTCTAGAGGCTCAGG - Intronic
1090210721 11:124919628-124919650 CTGGGGAAGTGCCGAGGGACAGG + Exonic
1091399907 12:175388-175410 CTGCCCAAGGCCCGAGGCCCCGG - Exonic
1092145225 12:6210179-6210201 CTGGGGAAGGGCAGAGGCTCCGG + Intronic
1095773873 12:45991227-45991249 ATGGGAAAGCCCCTAGGCTCGGG - Intronic
1097061399 12:56287036-56287058 CTGGGAAAGACCACAGGCAGAGG + Intronic
1097287645 12:57889963-57889985 CAGGGAATGCCCAGAGGCACAGG - Intergenic
1097835383 12:64267684-64267706 CTAGGAAAGGCCAGAGGAAGAGG + Intronic
1098532572 12:71557659-71557681 CTGGGAAAAGCCTGGGGCCCTGG - Intronic
1100469195 12:94874497-94874519 ATGGTAAAGGGCCGACGCACTGG - Intergenic
1100532534 12:95473923-95473945 TTCGGGAATGCCCGAGGCACCGG + Intronic
1103557635 12:121775813-121775835 CTGGGAGAGGGCCCAGGCCCTGG + Exonic
1103795284 12:123499166-123499188 CTGGGAAGGTCCCGAGGCCTGGG - Intronic
1110555794 13:76857838-76857860 CTGGGACAGGGCAGAGGCCCAGG + Intergenic
1113473776 13:110565105-110565127 CTGAGAAAGGGACAAGGCACTGG - Intergenic
1113741044 13:112712540-112712562 CTGAGACAGGCCCGAAGGACAGG + Intronic
1114458334 14:22871784-22871806 CTGGGCAAGGGCCGGGGCGCCGG + Exonic
1117166794 14:53042697-53042719 CTGGCAGAGGCTTGAGGCACAGG + Intronic
1119407136 14:74405978-74406000 CTGGGCAGTGCCCGAGGCAGGGG + Exonic
1119494756 14:75069320-75069342 CTGGCAAAGGGCGGAGGCCCTGG - Exonic
1120631945 14:86902388-86902410 ATGGAGAAGGCCGGAGGCACTGG + Intergenic
1122217039 14:100211585-100211607 CTGGGAAGAGCCTGGGGCACTGG - Intergenic
1122218956 14:100222979-100223001 CTGGAAAAGGCCAGAGCCTCTGG - Intergenic
1122399647 14:101459043-101459065 CCCGGAAAGGCCCGAGGCCCTGG + Intergenic
1122653536 14:103240955-103240977 CTGTGAGGGGCCCGAGGCTCAGG - Intergenic
1122907904 14:104810636-104810658 CTGGGAAAGGCCACAGACCCAGG - Intergenic
1123040761 14:105489350-105489372 CTGGGTAAGTCCCTGGGCACAGG - Intronic
1123573680 15:21643176-21643198 CTGGGACAGGCATGAGCCACGGG + Intergenic
1123610300 15:22085761-22085783 CTGGGACAGGCATGAGCCACGGG + Intergenic
1124448715 15:29764672-29764694 CTGGGAATGGCCTGAGAAACTGG + Intronic
1124722400 15:32121475-32121497 CTGGGAAAGGCACGAGGATGTGG - Intronic
1124997461 15:34737533-34737555 ATGGGATAGTCCCCAGGCACAGG - Intergenic
1126684230 15:51233300-51233322 CTGGGAAAGGCCCTGGTCCCAGG + Intronic
1128334682 15:66778401-66778423 CTGGGGAAGGACAGGGGCACAGG - Intronic
1131269210 15:90936107-90936129 AAAGGAAAGGCCCGAGGCAGTGG - Intronic
1202982548 15_KI270727v1_random:377515-377537 CTGGGACAGGCATGAGCCACGGG + Intergenic
1132618262 16:852814-852836 CTGGGAAAGGCTGGTGCCACGGG - Intergenic
1132901378 16:2256632-2256654 CTGGGAAGGACCCAAAGCACTGG + Intronic
1132985567 16:2765407-2765429 CTGGGAAGGGCCCGAGGGGCTGG - Exonic
1134222209 16:12363594-12363616 CTGGGAATGGTGCTAGGCACAGG - Intronic
1134447780 16:14343880-14343902 CTTGGACAGACCAGAGGCACTGG + Intergenic
1135721705 16:24823234-24823256 CTGGGCAAGGCACCAGGCCCTGG + Intronic
1136377512 16:29874009-29874031 CTGGGAGAGGCCTGAGCCTCAGG + Intronic
1136984062 16:35083541-35083563 CTGGGAGTTGCACGAGGCACTGG + Intergenic
1137387673 16:48056388-48056410 CTGGGAAAAGCCCAAAGCTCTGG + Intergenic
1138148247 16:54631479-54631501 CTGGGACAGGCCAGTGGGACAGG + Intergenic
1138157032 16:54715368-54715390 CTGAGAAAGACCCCAGGCAAAGG + Intergenic
1139512802 16:67436967-67436989 CTGGGGAAGGGCCGGGGCTCAGG - Exonic
1139632179 16:68237391-68237413 CCGGGAAAGGGGCGAGGCCCGGG + Intronic
1142154227 16:88525942-88525964 CATGGCATGGCCCGAGGCACTGG + Intronic
1142392265 16:89809425-89809447 ATGGGAAAGGCCGGACGCAGTGG + Intronic
1142622522 17:1173857-1173879 CCGGGAAAGCCTCGAGGGACTGG - Intronic
1142904810 17:3034502-3034524 CTGGAAAAGGCCCCAGGGCCAGG - Exonic
1142972642 17:3623189-3623211 CTGGGACAGGCCAGGGGCACTGG + Intronic
1143163794 17:4887455-4887477 CTGGGAGTGGCCAGAGGCAGAGG + Intronic
1143253282 17:5538068-5538090 CTGAGGAAAGCCCGAGGCCCAGG + Intronic
1143367319 17:6416477-6416499 CTGCGGAAGGCCCAGGGCACTGG - Intronic
1144778912 17:17798260-17798282 CCGGGACAGGCCCCGGGCACTGG - Exonic
1144824501 17:18098199-18098221 CTGGGAGAGGCCCCAGGGGCTGG - Intronic
1145058992 17:19720638-19720660 CTAGGAATGGCAGGAGGCACGGG + Intergenic
1145250213 17:21293335-21293357 TAGGGAAGGGCCAGAGGCACGGG - Intronic
1145832401 17:27927314-27927336 CTGGGAAAGGCATGTGGCCCTGG - Intergenic
1147315004 17:39615855-39615877 CTGGGAAATGCCCAGGTCACAGG - Intergenic
1147424140 17:40337733-40337755 CTGGGGAATGCCCGAGGGTCTGG + Intronic
1148867232 17:50634978-50635000 CTGGGTAAGGCGCGGGGCTCCGG + Exonic
1150289743 17:63974256-63974278 CAGGGAGAGGCCAGAGCCACTGG + Intergenic
1150712950 17:67547225-67547247 CTGGTAAAGGCCAGGTGCACTGG + Intronic
1150788693 17:68183013-68183035 CTGAGTCAGGCCCCAGGCACAGG + Intergenic
1151934949 17:77255783-77255805 CTGGGAAAGTCCCTGGTCACAGG - Intergenic
1151952562 17:77363202-77363224 CTGGGGAAGGCACGAGTCAGGGG + Intronic
1152618118 17:81346988-81347010 CTGGGGAGGGCGCGGGGCACAGG - Intergenic
1153285531 18:3451704-3451726 CTGGGAAAGCCTGGAGGCAGAGG - Exonic
1159793672 18:72816328-72816350 CTGGAAAATGCCTGAGGAACTGG + Intronic
1160121436 18:76133853-76133875 CTGGGAAAAGCCCTATTCACAGG - Intergenic
1160225911 18:77010305-77010327 CTGGGAAAGGCCTTCTGCACTGG - Intronic
1160878759 19:1310208-1310230 CTGGGAAAGACTGGAGGCAAAGG + Intergenic
1160884932 19:1341393-1341415 GTGGGAAACGCCTGAGGCAGGGG + Intergenic
1160889343 19:1369060-1369082 ATGGGAAACGCACCAGGCACAGG - Intronic
1162810636 19:13162786-13162808 CTGGGAAAGGGCCGGGCCACAGG + Intergenic
1164453393 19:28386072-28386094 CTTGGAAAAGCCCCATGCACAGG + Intergenic
1165225792 19:34353629-34353651 CTGGGAAAGGCCGCAGTCCCAGG - Exonic
1165902794 19:39176567-39176589 CTGGGACAGGGCAGAGGCAGTGG - Intronic
1165962525 19:39547239-39547261 CTGTGAAAAGCCCAAGCCACAGG + Intergenic
1166978932 19:46621492-46621514 CGTGGGCAGGCCCGAGGCACAGG + Exonic
1166979811 19:46625704-46625726 CAGGGACAGGCTCGAGGGACTGG - Intergenic
926983186 2:18593394-18593416 CCTGGAAAGATCCGAGGCACTGG - Intergenic
928224466 2:29436308-29436330 CTGAGAAAGGCACGGTGCACTGG + Intronic
929460142 2:42097390-42097412 CGGAGAAAGGACCGAGGCAATGG - Intergenic
930065491 2:47324517-47324539 CAGGGCAAGGCCTTAGGCACTGG + Intergenic
931515298 2:63047699-63047721 CGGGGTAAGGCCCGCGGCAAGGG + Intergenic
931895428 2:66723693-66723715 CTGGGATAGGCTCCAGCCACTGG + Intergenic
932217919 2:69978694-69978716 CTGGGAAAGGCCCCGAACACCGG + Intergenic
935115818 2:100135474-100135496 CTGTGAGAAGCCCAAGGCACAGG + Intronic
935259390 2:101341985-101342007 CTGGCAATGGCCCCAGGCTCAGG - Intergenic
935622175 2:105139795-105139817 CTGGGAGAGGTCCAAGCCACAGG - Intergenic
935896809 2:107747401-107747423 CTGGGAAGCTCCGGAGGCACAGG + Intergenic
937248044 2:120506161-120506183 CAGGGAAGGGCCCTAGGCATAGG - Intergenic
937880099 2:126858411-126858433 CAGAGAAAGGCCCTAGGCAAAGG - Intergenic
937990108 2:127657420-127657442 CGGGGAAGGGCCGGAAGCACTGG + Exonic
945898451 2:215511912-215511934 GTGAGCCAGGCCCGAGGCACCGG + Intergenic
948308525 2:236968263-236968285 CTGGGAGGGGCCTGAGGCCCTGG - Intergenic
948766853 2:240226886-240226908 CTGGGAAAAGCCTGAGTCCCCGG + Intergenic
948768825 2:240236936-240236958 CTGGGAACTGTCAGAGGCACAGG - Intergenic
1168773102 20:428596-428618 CTGGGACAGGGCCGAGGCCTAGG + Intronic
1170693058 20:18632439-18632461 CAGAGAGAGGCCCCAGGCACAGG - Intronic
1172609616 20:36240225-36240247 ATGGGTAAGGCCCCAGGAACTGG - Exonic
1173181409 20:40809112-40809134 CAGGGAAAGCCCCAAGGCATGGG + Intergenic
1173389717 20:42621227-42621249 GTGGGCAAGGCCCGAGGAGCTGG - Intronic
1173684154 20:44910804-44910826 CTGGGAAAGGCCTGAGCCCAAGG - Intronic
1174393988 20:50234680-50234702 CTGGGGAAGCACCGAGGCTCTGG + Intergenic
1175785382 20:61708620-61708642 CTGGGAGGGGCTCCAGGCACAGG - Intronic
1176260629 20:64177714-64177736 CTGGGAAAGGCTGGGGGCAGGGG + Intronic
1176426623 21:6552569-6552591 CTGCGACAGGCCCGAGGCCCCGG + Intergenic
1176524159 21:7852680-7852702 CTGGGAAAAACTCGAGTCACAGG + Intergenic
1177569833 21:22872836-22872858 CTGGGAAAGAACCAAGGCATTGG - Intergenic
1178658179 21:34482693-34482715 CTGGGAAAAACTCGAGTCACAGG + Intergenic
1178962134 21:37074384-37074406 CTGGAAAAGGCACGGCGCACTGG - Intronic
1179632349 21:42686346-42686368 CGCTGAAGGGCCCGAGGCACCGG + Intronic
1179702114 21:43160891-43160913 CTGCGACAGGCCCGAGGCCCCGG + Intronic
1180062429 21:45392595-45392617 CCGGAAAAGGCCTGAGCCACAGG + Intergenic
1181992131 22:26845361-26845383 CTGGGACAGGCCAGGGGCAGAGG + Intergenic
1183504357 22:38201117-38201139 CTGCGACAGGCCCTTGGCACTGG - Intronic
1183792005 22:40079363-40079385 CTGGAAAAGACCAGAAGCACCGG - Intronic
1184592648 22:45495518-45495540 CTGGGAAGGTCCCGGGGCAATGG - Intergenic
1185143052 22:49114066-49114088 CAGGGAAATGCCCAAGGCCCTGG + Intergenic
949697987 3:6721274-6721296 GTGTGAAAGGCACCAGGCACGGG - Intergenic
949987826 3:9553685-9553707 CTGGGCACGGCCGGAGGCAGCGG + Exonic
950310731 3:11955491-11955513 CTGGGATAGGACCTAGGCATTGG + Intergenic
950920871 3:16693510-16693532 ATGGGAAAGGTACGAGGCAGAGG - Intergenic
954294142 3:49664885-49664907 CTGGGAAAGGCCCGAGGCACTGG + Intronic
954296204 3:49675737-49675759 CTGCGCAAGGCTGGAGGCACGGG + Exonic
954389311 3:50260485-50260507 GCAGGAAAGGCCCGAGGAACTGG - Intergenic
954498643 3:50988844-50988866 CTGGGGGAGGCTGGAGGCACAGG - Intronic
954614341 3:51961885-51961907 CTGGTAAAGGCTTGAGGCAGGGG + Intronic
955719113 3:61863163-61863185 CTGGGTCAGGCCCTAAGCACTGG - Intronic
956184798 3:66552085-66552107 CTGGGAACTTCCCCAGGCACAGG - Intergenic
960998884 3:123359005-123359027 CTGGGAAAGGTGCAAGGCAAAGG + Intronic
961348209 3:126278598-126278620 CTGGGAAAGGCCTGAGGGGTGGG + Intergenic
961404399 3:126668072-126668094 CTAGGAGAGTCCCCAGGCACTGG - Intergenic
961530289 3:127536394-127536416 GTGGGCAAGGCCCCAGGCTCTGG + Intergenic
961677010 3:128573836-128573858 ATGGGAAACGCCTGAGTCACCGG + Exonic
962198198 3:133380808-133380830 CTGGGAAGGGGCTGAGACACTGG - Exonic
965348344 3:167580428-167580450 CTGGGAAAGGGCCAAAGCATAGG - Intronic
967986046 3:195095964-195095986 CGGGGAGAGGCCAGAGGCTCCGG + Intronic
968048225 3:195635605-195635627 TTGGGAAGCGCCCGACGCACAGG - Intergenic
968099179 3:195954015-195954037 TTGGGAAGCGCCCGACGCACAGG + Intergenic
968306386 3:197654316-197654338 TTGGGAAGGGCCCGACGCACAGG + Intergenic
969246013 4:5933469-5933491 CTGGGAAAGCCCAGAGTCAGGGG - Intronic
969721101 4:8893455-8893477 CCGGGAAAGGCCCGAGGCACAGG - Intergenic
976213378 4:82693228-82693250 CTGGGCAAGGTCAAAGGCACCGG - Intronic
976981939 4:91243033-91243055 CTGGGAGAGGGGAGAGGCACTGG - Intronic
977559429 4:98517402-98517424 CTGGGAAAGGGGTGAGGCAGGGG + Intronic
978876706 4:113648545-113648567 TTGGGAAAGGCACAAGGGACCGG + Intronic
985504717 5:272098-272120 TTGGGAAGGGCCCGACGCACAGG - Intronic
985743397 5:1633497-1633519 CTTGGGAAGGGCCGACGCACAGG + Intergenic
987505718 5:18768787-18768809 ATGGGAAAGGCATGAAGCACAGG - Intergenic
988489848 5:31697069-31697091 CTGAGAAAGGCCAGAGAAACTGG + Intronic
990003660 5:50922322-50922344 CTGGGCAGGGCCTGAGGGACAGG - Intergenic
997195595 5:131977171-131977193 CCTGGAAAGGCCCCAGGCTCAGG + Intronic
1000834298 5:166135353-166135375 CTAGGCAAGGCCCGTGGGACAGG - Intergenic
1001413832 5:171529161-171529183 CTGGGAAGGGCCCGAGTCAGAGG + Intergenic
1002368183 5:178729480-178729502 CTGGGAAAGGCTTGAGGCGGAGG - Intronic
1002385142 5:178860568-178860590 CTGGGAAAGGCTTGAGGCGGAGG + Intronic
1003441632 6:6148238-6148260 CTGAGACAGGCCGGAGGCAGTGG + Intronic
1003968838 6:11279435-11279457 CTGGAAACGGTCCGCGGCACCGG + Intronic
1006402109 6:33823856-33823878 CTGGGGAAGGCCCCAGGCCTAGG - Intergenic
1007223922 6:40299730-40299752 CTGGCATAGGCTGGAGGCACAGG - Intergenic
1007366446 6:41397508-41397530 CTGGGCAAAGTCCTAGGCACTGG - Intergenic
1007553522 6:42747203-42747225 CTGGCAAAAACCCGAGGCAGCGG + Intronic
1011128957 6:84034518-84034540 ATGGGAAAGGCACGGGGCACGGG - Intronic
1019344532 7:522816-522838 CCGGGAGAGGCCGGATGCACCGG - Intergenic
1019565780 7:1678395-1678417 GTGGGTAAGGCCCGCGCCACTGG + Intergenic
1019749056 7:2717427-2717449 CTGGGAGAGGCCCCGGGAACCGG + Intronic
1019808179 7:3144321-3144343 CTGGGAGAGCCCCGAGGGAGGGG - Intronic
1022330105 7:29370634-29370656 CTGGGAGAGGCCCATGGCCCGGG - Intronic
1023986677 7:45101129-45101151 CTGGGAGAGGCCCGGGGCCACGG + Intronic
1027007208 7:74705408-74705430 CTGGGAAAAGCCAGAGGCATTGG + Intronic
1034353961 7:150435910-150435932 CAGGGAAAGCCCCCAGGCAAGGG - Intergenic
1034872201 7:154694771-154694793 CTGGGAAAACCCCCAGGCATGGG - Intronic
1036604865 8:10295787-10295809 CTGGGAGAGGGCAGAGGCACCGG - Intronic
1036713182 8:11095752-11095774 CTGGGATATGACCCAGGCACTGG + Intronic
1037700952 8:21273399-21273421 CTGGGTAAGGCAGGAGGCACTGG - Intergenic
1037723025 8:21460544-21460566 ATGGGAAAGGCCCTGGGCACTGG - Intergenic
1038328481 8:26589884-26589906 CCGGGACAAGCCCAAGGCACTGG - Intronic
1045815213 8:106270480-106270502 CTCGGAGAGGCGCCAGGCACAGG - Intronic
1048014328 8:130483992-130484014 CAGGAAAAGGCCCGGGGCAAGGG + Intergenic
1048167596 8:132077166-132077188 CTGAGAAACAGCCGAGGCACAGG + Intronic
1048497358 8:134946352-134946374 CTGGGAGAGGCCTGAGAAACTGG + Intergenic
1048953666 8:139516520-139516542 CTGTGAAAGCCCCGAGTTACAGG + Intergenic
1049261553 8:141641736-141641758 CTGGGCAAGGCAGGAAGCACAGG + Intergenic
1049282832 8:141759268-141759290 CTGGGAAATTCCTGGGGCACAGG + Intergenic
1049289506 8:141794318-141794340 CTGGGTAAGGCCCCGGGCAGAGG - Intergenic
1056880844 9:90392099-90392121 CTGGGAACGGAACCAGGCACTGG + Intergenic
1058619798 9:106870988-106871010 CTGGGAAATGCCAGAGGCTGGGG + Intronic
1060057906 9:120431594-120431616 CTGGCAAAGGCCCCTGGCAAAGG + Intronic
1061478493 9:130884764-130884786 GTGGGGGAGGCCCGAGGCAGGGG - Exonic
1061838429 9:133343920-133343942 GTGGGAAAGGCCCAGGGCCCTGG + Intronic
1061922549 9:133789958-133789980 CTGGGAGGTGCTCGAGGCACAGG + Intronic
1062518955 9:136949778-136949800 ATGGGAGAGGCCCCAGGGACCGG + Intronic
1062581703 9:137231800-137231822 CTGGTGAAGGCCTGGGGCACAGG - Intronic
1188488431 X:30709273-30709295 CTGGGACAGGCCTCAGGGACAGG + Intronic
1189398997 X:40647583-40647605 CTGGGAAGTACCCGAGGCAGCGG + Intergenic
1192919736 X:75694251-75694273 CTGGGATAGGCCAGCGGCAAGGG - Intergenic
1195598506 X:106720189-106720211 TGGGGAAAGGCCCAAGGCATGGG - Intronic
1198534701 X:137574510-137574532 CTTGAAAAGGCCGGAGCCACGGG - Intronic
1199265728 X:145823428-145823450 CTGGGACAGGTGAGAGGCACAGG - Exonic
1201278687 Y:12321894-12321916 CTGTGAAGTGCCCAAGGCACTGG + Intergenic