ID: 954294143

View in Genome Browser
Species Human (GRCh38)
Location 3:49664886-49664908
Sequence TGGGAAAGGCCCGAGGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294137_954294143 -5 Left 954294137 3:49664868-49664890 CCTGTACCTTGCCTCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954294143 3:49664886-49664908 TGGGAAAGGCCCGAGGCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 143
954294133_954294143 18 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294143 3:49664886-49664908 TGGGAAAGGCCCGAGGCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 143
954294132_954294143 23 Left 954294132 3:49664840-49664862 CCATGCCCAGCATGGTGAGTACA 0: 1
1: 0
2: 3
3: 24
4: 222
Right 954294143 3:49664886-49664908 TGGGAAAGGCCCGAGGCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 143
954294134_954294143 17 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294143 3:49664886-49664908 TGGGAAAGGCCCGAGGCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294143 Original CRISPR TGGGAAAGGCCCGAGGCACT GGG Intronic
900373860 1:2344455-2344477 TGGGAAAGGCCTGGGGGACGGGG + Intronic
900463947 1:2814860-2814882 TGGGAGGGGCCCCAGACACTGGG + Intergenic
900558270 1:3290844-3290866 TGGGAAGGGCCCGGAGCACTGGG + Intronic
905487109 1:38309156-38309178 TGGGAAAGGACAGAGACAATGGG + Intergenic
906206058 1:43987018-43987040 TGGGAGAAGCATGAGGCACTGGG + Intronic
906692547 1:47802098-47802120 AGGGAAAGGCCTGAGGAGCTCGG + Intronic
912509976 1:110182746-110182768 TGAGAATTGACCGAGGCACTTGG + Intronic
912865828 1:113255405-113255427 TGGCAAAGGAGCGAGGCTCTGGG + Intergenic
1063266522 10:4457738-4457760 TGGGAAACTCACCAGGCACTTGG - Intergenic
1063496674 10:6515615-6515637 TGGGATTGGCCCAAGGCATTCGG + Intronic
1063631194 10:7735156-7735178 TGGGAGAGAGCGGAGGCACTAGG - Intronic
1064528290 10:16281278-16281300 TGGGAAATGCCCTAGAAACTGGG - Intergenic
1067246755 10:44553890-44553912 TAGGAGAGGCCTGAGGCACAAGG - Intergenic
1069261968 10:66409936-66409958 TGGGAAAGGTCTAGGGCACTTGG - Intronic
1070518640 10:77231680-77231702 TGGGAGAGGTCCGAGGCCATTGG - Intronic
1070647755 10:78213217-78213239 TGGGAGAGGCCCAAGCCACGTGG - Intergenic
1074693456 10:116027325-116027347 TGTGAACTGCCCCAGGCACTGGG - Intergenic
1075567612 10:123515931-123515953 TGGGAAGAGCACGAGGAACTTGG - Intergenic
1076405999 10:130212891-130212913 TGGGAAAGGCCCGGGGTAGGGGG - Intergenic
1076590789 10:131580728-131580750 AGGGAAAGGCCAAAGGCAGTGGG - Intergenic
1085529572 11:77183456-77183478 GGGCACAGACCCGAGGCACTTGG + Intronic
1086224756 11:84494458-84494480 TGGGAGTGGCCCAAGGCCCTGGG - Intronic
1086788667 11:91006482-91006504 TGTGAAAACCCCAAGGCACTTGG - Intergenic
1090700231 11:129288152-129288174 AGGCAAAGGACTGAGGCACTAGG - Intergenic
1091128144 11:133120353-133120375 TGGGCAAGGCCATAGGAACTAGG + Intronic
1095773872 12:45991226-45991248 TGGGAAAGCCCCTAGGCTCGGGG - Intronic
1098924822 12:76337704-76337726 TGGGAAAGGATGGTGGCACTTGG + Intergenic
1100982561 12:100172988-100173010 TGGGGGAGCCCAGAGGCACTGGG + Intergenic
1103327225 12:120129723-120129745 GGGCAGAGGCCCGAGGCCCTGGG - Intronic
1103433572 12:120907299-120907321 TGGGAAAGGCCAGAAGCCGTTGG + Intergenic
1106413696 13:29528421-29528443 TGGGAAGGCCCCCAGGAACTAGG - Intronic
1113473775 13:110565104-110565126 TGAGAAAGGGACAAGGCACTGGG - Intergenic
1121442516 14:93957878-93957900 GGTGAAAGGCCCGGGCCACTGGG - Intronic
1122207902 14:100157319-100157341 TGGAAAAGGCAAGAGGCACATGG - Intronic
1122217035 14:100211565-100211587 TGGGAAGAGCCTGAGGCACCAGG - Intergenic
1122217038 14:100211584-100211606 TGGGAAGAGCCTGGGGCACTGGG - Intergenic
1123682979 15:22775839-22775861 TGGGGGAGCCCAGAGGCACTGGG + Intronic
1124334727 15:28848362-28848384 TGGGGGAGCCCAGAGGCACTGGG + Intergenic
1125192721 15:37012304-37012326 TGGGAAAGGACTGAGGAACAAGG - Intronic
1125734302 15:41912871-41912893 AGGGACAGGAACGAGGCACTTGG - Intronic
1128382804 15:67125831-67125853 TGGGCAAGAGCCGCGGCACTGGG + Intronic
1131269209 15:90936106-90936128 AAGGAAAGGCCCGAGGCAGTGGG - Intronic
1132880022 16:2158073-2158095 TGGTCAAGGCCACAGGCACTGGG - Intronic
1134133813 16:11667268-11667290 TGGGAAAGGCTTGGTGCACTGGG + Intergenic
1134207052 16:12246933-12246955 TGGGGAAGGCCAGAGGCACAAGG + Intronic
1134447781 16:14343881-14343903 TTGGACAGACCAGAGGCACTGGG + Intergenic
1136984063 16:35083542-35083564 TGGGAGTTGCACGAGGCACTGGG + Intergenic
1142622521 17:1173856-1173878 CGGGAAAGCCTCGAGGGACTGGG - Intronic
1142957550 17:3531856-3531878 TGGGACAGGACCAAGGCCCTCGG + Intronic
1143367318 17:6416476-6416498 TGCGGAAGGCCCAGGGCACTGGG - Intronic
1144824500 17:18098198-18098220 TGGGAGAGGCCCCAGGGGCTGGG - Intronic
1144930862 17:18858020-18858042 TGGGTAAGGCGCGGGGCAGTGGG - Intronic
1145832400 17:27927313-27927335 TGGGAAAGGCATGTGGCCCTGGG - Intergenic
1146913780 17:36665183-36665205 TGGGAAAGGACTGAGGAAGTGGG + Intergenic
1147424141 17:40337734-40337756 TGGGGAATGCCCGAGGGTCTGGG + Intronic
1150266038 17:63833008-63833030 TAGCAAAGGCCTGAGCCACTTGG - Intronic
1150289744 17:63974257-63974279 AGGGAGAGGCCAGAGCCACTGGG + Intergenic
1151316313 17:73324690-73324712 TGGGAGAGTCCCCAGGCAATAGG + Intergenic
1151517464 17:74605652-74605674 AGGGAAAGGGCCCTGGCACTGGG + Intergenic
1151578366 17:74963950-74963972 GGGGAAAGGACCCTGGCACTTGG + Intronic
1152234314 17:79130564-79130586 TGGGAGAGCCCTGAGGCCCTAGG - Intronic
1153059751 18:982878-982900 TGGGAAAGGCTAGAGGGAATGGG - Intergenic
1156227369 18:35122772-35122794 TGGGAAAGCCCTGGGGCCCTAGG + Intronic
1159458564 18:68693860-68693882 TGGAAAAGGCACGATCCACTTGG - Intronic
1162332461 19:10038705-10038727 GGGTACAGCCCCGAGGCACTTGG + Intergenic
1162535578 19:11261680-11261702 GGGGACAGGCCCCAGGCGCTGGG - Intronic
1163151598 19:15418400-15418422 TGGGAAAGGCGCCAGGCCCTAGG - Intronic
1165902793 19:39176566-39176588 TGGGACAGGGCAGAGGCAGTGGG - Intronic
926313927 2:11695964-11695986 TGGGAAAGGGCCTGGCCACTGGG - Intronic
926983185 2:18593393-18593415 CTGGAAAGATCCGAGGCACTGGG - Intergenic
929460141 2:42097389-42097411 GGAGAAAGGACCGAGGCAATGGG - Intergenic
929576885 2:43057554-43057576 TGGGGACGGCCGAAGGCACTAGG + Intergenic
930065492 2:47324518-47324540 AGGGCAAGGCCTTAGGCACTGGG + Intergenic
932301020 2:70667085-70667107 TGGGAGAGGCCCCAGGAACTAGG + Intronic
935212892 2:100953745-100953767 TGTGAAAGGCAGCAGGCACTGGG - Intronic
937468898 2:122158467-122158489 GGGGCAAGGCACGAGTCACTTGG + Intergenic
937990109 2:127657421-127657443 GGGGAAGGGCCGGAAGCACTGGG + Exonic
940453867 2:153872427-153872449 TGGGACCGGCCCGGGGCGCTCGG - Intronic
942320038 2:174728766-174728788 TGGGAAATGCCCGACACCCTTGG - Intergenic
948308524 2:236968262-236968284 TGGGAGGGGCCTGAGGCCCTGGG - Intergenic
948922505 2:241072335-241072357 TGGGAAGGGCCCAAGGCACCTGG - Intronic
1173047861 20:39529705-39529727 TGGGAAAGGCCCTAGGGGATCGG - Intergenic
1173507480 20:43599319-43599341 TGGGAAAAGGCCCAGGCACCAGG - Intronic
1174572006 20:51508704-51508726 TGGGAAAGGCCAGAGTCTCTAGG - Intronic
1175368129 20:58469412-58469434 TGGGAAAGGCCCCAGAGCCTGGG - Intronic
1175983785 20:62754340-62754362 TGGCAAAGGCCCTAGGCTCTAGG - Intronic
1176044696 20:63086544-63086566 TGGGAAGGGTCCGGGGCACCCGG - Intergenic
1176273026 20:64246380-64246402 TGGGAAGGGCAGGAGGCACCAGG + Intergenic
1177569832 21:22872835-22872857 TGGGAAAGAACCAAGGCATTGGG - Intergenic
1181666922 22:24404849-24404871 TGGGAAAGGGCAGAGGGCCTGGG - Intronic
1183634674 22:39053966-39053988 TGGGAAAGCCCATGGGCACTAGG - Intronic
1183941986 22:41301259-41301281 TGGGGAAGGGCGGAGGCGCTGGG + Intergenic
1184098571 22:42329737-42329759 TGGGGGAGGCCAGAGGCTCTTGG + Intronic
949697986 3:6721273-6721295 TGTGAAAGGCACCAGGCACGGGG - Intergenic
950179571 3:10901571-10901593 TGGGAAGGGGCTGAGGCTCTTGG - Intronic
954294143 3:49664886-49664908 TGGGAAAGGCCCGAGGCACTGGG + Intronic
954389310 3:50260484-50260506 CAGGAAAGGCCCGAGGAACTGGG - Intergenic
956247279 3:67198001-67198023 GGGTGAAGGCACGAGGCACTGGG + Intergenic
956467735 3:69535970-69535992 AGGCAAAGGCCCGAGGCAGCAGG - Intronic
961404398 3:126668071-126668093 TAGGAGAGTCCCCAGGCACTGGG - Intergenic
961530290 3:127536395-127536417 TGGGCAAGGCCCCAGGCTCTGGG + Intergenic
962746703 3:138402265-138402287 TGTGACAGGCCTGAGGCCCTGGG + Exonic
963091220 3:141485957-141485979 CAGAAAAGGCCAGAGGCACTGGG - Intergenic
964344900 3:155745282-155745304 TGGCAAGGGCCAGAAGCACTGGG + Intergenic
968982096 4:3855811-3855833 TGGGAAAGGGTCCAGGCGCTGGG - Intergenic
968985979 4:3874632-3874654 TGGGTAAGAACCGAGGCAATAGG - Intergenic
969516239 4:7649630-7649652 AGGAAAAGGCCCTGGGCACTGGG + Intronic
976548537 4:86366550-86366572 TAGGAAAGGCCAGAGTCACCAGG + Intronic
976981938 4:91243032-91243054 TGGGAGAGGGGAGAGGCACTGGG - Intronic
978966722 4:114749878-114749900 TGGGAAAGGCCAAATGAACTTGG + Intergenic
979295905 4:119031916-119031938 TGGGAATGCCCACAGGCACTGGG - Exonic
985245103 4:187972295-187972317 TGTGAAAGGCACATGGCACTAGG - Intergenic
985507703 5:293331-293353 CGGGAACAGCACGAGGCACTGGG + Intronic
985507712 5:293421-293443 CGGGAACAGCACGAGGCACTGGG + Intronic
985507722 5:293511-293533 CGGGAACAGCACGAGGCACTGGG + Intronic
985507732 5:293601-293623 CGGGAACAGCACGAGGCACTGGG + Intronic
985507742 5:293691-293713 CGGGAACAGCACGAGGCACTGGG + Intronic
985507752 5:293781-293803 CGGGAACAGCACGAGGCACTGGG + Intronic
985507762 5:293871-293893 CGGGAACAGCACGAGGCACTGGG + Intronic
985507772 5:293961-293983 CGGGAACAGCACGAGGCACTGGG + Intronic
985625378 5:982740-982762 GGGGAAAGGCCCCTCGCACTGGG + Intergenic
985663326 5:1168390-1168412 TGGGAAAGGGCACAGGCATTTGG - Intergenic
985740261 5:1611708-1611730 CGGGAACAGCACGAGGCACTGGG - Intergenic
986393579 5:7306373-7306395 TGGGGGAGCCCAGAGGCACTGGG + Intergenic
987505717 5:18768786-18768808 TGGGAAAGGCATGAAGCACAGGG - Intergenic
992828181 5:80569839-80569861 TGGGAAAGGCAGGAGGCGCGAGG + Intronic
996853906 5:127983244-127983266 TGGGAGAGGCCCAAGCCACATGG - Intergenic
997317807 5:132952474-132952496 TGGGAAGAGCCAGAGGAACTGGG - Intronic
998404733 5:141867892-141867914 TGGGAACTGCCCCAGGCGCTAGG - Intronic
1001115326 5:168934556-168934578 TGGGAAAGGCACGCGGCTGTGGG + Intronic
1002192423 5:177485284-177485306 TGGGAAGGGGCAGAGGCACAAGG + Intronic
1002704136 5:181148884-181148906 AGGGCAAGGACCGAGGCCCTTGG + Intergenic
1003441633 6:6148239-6148261 TGAGACAGGCCGGAGGCAGTGGG + Intronic
1007366445 6:41397507-41397529 TGGGCAAAGTCCTAGGCACTGGG - Intergenic
1011128956 6:84034517-84034539 TGGGAAAGGCACGGGGCACGGGG - Intronic
1019076127 6:169389471-169389493 TGGGAAAGGCCTCAGGCATCTGG + Intergenic
1019309953 7:355103-355125 TGTGAGAGGCCCGAGGCCCATGG - Intergenic
1019565781 7:1678396-1678418 TGGGTAAGGCCCGCGCCACTGGG + Intergenic
1022388816 7:29926295-29926317 TAGGAAAGGCCCCAGGAACCTGG + Intronic
1022500205 7:30878021-30878043 TGTGTAGGGCCCGAGGGACTTGG - Intronic
1023715453 7:43039406-43039428 TGGGAAAGGGCCCCTGCACTGGG - Intergenic
1029712411 7:102307021-102307043 TGGGCGACGCCCGAGGCACCTGG - Intronic
1034634529 7:152556485-152556507 TGTGAACGGCGCGAGGCACAAGG - Intergenic
1034811667 7:154137690-154137712 TGGAAAAGGCCCAAGCCCCTTGG + Intronic
1035417870 7:158704845-158704867 TGGGCGAGGCCCGAGGCTCGCGG - Intergenic
1036604864 8:10295786-10295808 TGGGAGAGGGCAGAGGCACCGGG - Intronic
1037700951 8:21273398-21273420 TGGGTAAGGCAGGAGGCACTGGG - Intergenic
1038328480 8:26589883-26589905 CGGGACAAGCCCAAGGCACTGGG - Intronic
1041309083 8:56495893-56495915 CGGGAAAGGCCCGTGGGAATAGG - Intergenic
1043496512 8:80806825-80806847 TGGCAAAGGCCTCAGCCACTGGG + Intronic
1053307351 9:36994095-36994117 TGGGACAGGCCCTGGGCACTAGG + Intronic
1056900579 9:90595831-90595853 TGTCCAAGGCCCAAGGCACTGGG + Intergenic
1057723779 9:97554197-97554219 GGGGAAAGGCTCGAGGCAGGTGG + Intronic
1058530762 9:105902716-105902738 TGGGAAAGACCCGAGCCATCAGG + Intergenic
1192176076 X:68886419-68886441 AGGGAAAGGCCTGAGGGCCTGGG - Intergenic
1195598505 X:106720188-106720210 GGGGAAAGGCCCAAGGCATGGGG - Intronic
1198423498 X:136492278-136492300 TGGGAACGGTCCCGGGCACTGGG + Exonic
1200073572 X:153540598-153540620 TGGGCAGGGCCCGAGGGATTGGG - Intronic