ID: 954294144

View in Genome Browser
Species Human (GRCh38)
Location 3:49664887-49664909
Sequence GGGAAAGGCCCGAGGCACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294139_954294144 -10 Left 954294139 3:49664874-49664896 CCTTGCCTCTTCTGGGAAAGGCC 0: 1
1: 0
2: 1
3: 21
4: 229
Right 954294144 3:49664887-49664909 GGGAAAGGCCCGAGGCACTGGGG 0: 1
1: 0
2: 2
3: 22
4: 258
954294134_954294144 18 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294144 3:49664887-49664909 GGGAAAGGCCCGAGGCACTGGGG 0: 1
1: 0
2: 2
3: 22
4: 258
954294132_954294144 24 Left 954294132 3:49664840-49664862 CCATGCCCAGCATGGTGAGTACA 0: 1
1: 0
2: 3
3: 24
4: 222
Right 954294144 3:49664887-49664909 GGGAAAGGCCCGAGGCACTGGGG 0: 1
1: 0
2: 2
3: 22
4: 258
954294137_954294144 -4 Left 954294137 3:49664868-49664890 CCTGTACCTTGCCTCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954294144 3:49664887-49664909 GGGAAAGGCCCGAGGCACTGGGG 0: 1
1: 0
2: 2
3: 22
4: 258
954294133_954294144 19 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294144 3:49664887-49664909 GGGAAAGGCCCGAGGCACTGGGG 0: 1
1: 0
2: 2
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294144 Original CRISPR GGGAAAGGCCCGAGGCACTG GGG Intronic
900140376 1:1137210-1137232 GGGAAAGACCGGAGGAACCGTGG + Intergenic
900407767 1:2499960-2499982 GGGCAAGGCCCGGAGCACTCAGG - Intronic
900490906 1:2948712-2948734 GGCACAGGCAGGAGGCACTGGGG - Intergenic
900558271 1:3290845-3290867 GGGAAGGGCCCGGAGCACTGGGG + Intronic
900612017 1:3548271-3548293 GAGAAATGCCCCCGGCACTGGGG - Intronic
901531136 1:9853157-9853179 GGAAAAGGCCTGAGGAGCTGCGG + Intronic
902637484 1:17743976-17743998 GGGAAGGGCCCAAGACACAGTGG + Intergenic
903121643 1:21220148-21220170 GGGAGAGGCCAGGGTCACTGTGG + Intronic
903555102 1:24187358-24187380 GGGACGGGCCCGCGGCTCTGCGG - Intronic
904252923 1:29237638-29237660 GGGCAGGGCCCGAGGCTCAGGGG + Intronic
904773216 1:32892635-32892657 GGGACAGACCCGAGGGACAGAGG + Intronic
906206059 1:43987019-43987041 GGGAGAAGCATGAGGCACTGGGG + Intronic
906525415 1:46490593-46490615 GGGCAATGCCCGGAGCACTGCGG - Intergenic
907650033 1:56286226-56286248 GGCAATGGCCCCTGGCACTGAGG - Intergenic
912515639 1:110215022-110215044 TGGAAGGGCCCGCAGCACTGTGG + Intronic
913509258 1:119547508-119547530 TGGAATGGCCCTAGGCAGTGGGG + Intergenic
913512416 1:119573825-119573847 GGGAGTGGCCCCAGGCAGTGGGG + Intergenic
917648513 1:177052159-177052181 GGGAAAAGACCGAGGCAATTAGG - Intronic
917723718 1:177810819-177810841 GGGAAAGGACTGAGGGGCTGGGG + Intergenic
917962697 1:180157090-180157112 GAGAAAGGCTCCATGCACTGGGG - Intronic
919891498 1:201978671-201978693 TGGAAAGCCCCAGGGCACTGTGG + Intergenic
919895139 1:202004935-202004957 GGGAAAGGCCCCGGGCTCTCAGG + Intronic
919932511 1:202230534-202230556 GGAAAATGCCCGAGCCTCTGAGG + Intronic
920252457 1:204630723-204630745 GGGAGAGGCCTGTGGGACTGGGG - Intronic
921702119 1:218280609-218280631 GGGAAAGGCCAGAGGCAGGGTGG - Intergenic
923672443 1:236052334-236052356 GGGAAAGGACACAGGCACTCAGG + Intronic
924438569 1:244067630-244067652 GAGAAAGTTCCAAGGCACTGGGG - Intergenic
1063443767 10:6095098-6095120 GTGACAGGCCTGAAGCACTGAGG - Intronic
1063942152 10:11141628-11141650 GTGAAGGGCCTGAGGAACTGAGG - Intronic
1064528289 10:16281277-16281299 GGGAAATGCCCTAGAAACTGGGG - Intergenic
1065533783 10:26698423-26698445 GAGAAAGGCCCGAGGCCGTCAGG + Intronic
1067079426 10:43204870-43204892 GGGAGGGGCCCAAGGCCCTGAGG - Intronic
1067721709 10:48732307-48732329 GGGAAAGACCAGAGGAGCTGGGG - Intronic
1070494534 10:77009683-77009705 AAGAAAGGCCAGTGGCACTGGGG - Intronic
1070507364 10:77125890-77125912 GGGAAAAGCCAGAAGCCCTGCGG + Intronic
1070660622 10:78303117-78303139 GGGAAAGGCCCTGGGCAAAGGGG + Intergenic
1070727465 10:78802235-78802257 GGGAAAGGTAGGAGGCAGTGTGG + Intergenic
1074693455 10:116027324-116027346 GTGAACTGCCCCAGGCACTGGGG - Intergenic
1076829966 10:132989140-132989162 GGGAGGGGCCCGAGGCCCGGTGG + Intergenic
1076832181 10:133001245-133001267 GGGAAAGGCCAGGGGACCTGGGG - Intergenic
1077250788 11:1559713-1559735 TGGAGAAGCCCGGGGCACTGGGG + Intronic
1077285170 11:1762371-1762393 GGGGAAGGCCAGTGGCCCTGGGG - Intronic
1077368109 11:2169398-2169420 GGGCAAGGCAAGAGGCACAGTGG + Intronic
1077378352 11:2216011-2216033 GGAGAAGGCCCGGGGCAGTGGGG - Intergenic
1079395340 11:20057453-20057475 GGGAGAAGCCTGAGTCACTGAGG + Intronic
1080908980 11:36575931-36575953 AGGAGAGGCACGAGGCTCTGAGG + Exonic
1081869095 11:46375251-46375273 GGGAAGGGACAGAGGCAATGAGG - Intronic
1082296376 11:50445354-50445376 GGCAAATGTCCGAGGCACAGAGG - Intergenic
1083176165 11:60951624-60951646 GGGAGAGGGCCGAGGCCCGGGGG - Exonic
1083568780 11:63743954-63743976 GGGAAAGGGGCCAGGCACAGTGG + Intronic
1083674739 11:64319042-64319064 GGGGAAGGTCCAAGGCCCTGGGG - Intronic
1084265975 11:68005303-68005325 GGGCAGGGCCCGAGGCGCAGGGG + Intergenic
1085387031 11:76163378-76163400 GGAATAGCCCCGAGGGACTGTGG - Intergenic
1091826870 12:3519455-3519477 GGGACAGGGCCCAGGAACTGGGG + Intronic
1092834906 12:12478174-12478196 TACAAAGGCCCTAGGCACTGGGG + Intronic
1096106024 12:48997534-48997556 GGGACAGGCCCTGGGAACTGCGG + Exonic
1096546870 12:52346129-52346151 TGGAAAGGCCCCTGGGACTGAGG - Intergenic
1097184571 12:57189697-57189719 GGAGGAGGCCAGAGGCACTGGGG + Intronic
1097218821 12:57434894-57434916 GAGAAAGGCCAGAAGCAATGAGG - Exonic
1097233416 12:57525474-57525496 GGGAAAGGCCTGGGAAACTGAGG - Exonic
1098237693 12:68433508-68433530 GGGAAAGCTCCGTGGGACTGAGG - Intergenic
1098859267 12:75689045-75689067 TGGAAAGCCCCGGGGCACTGTGG - Intergenic
1100169760 12:91960807-91960829 GGTAAAGGCCTGAGAAACTGGGG - Intergenic
1102420992 12:112802818-112802840 GGGAGAGGACAGAGGCCCTGGGG - Intronic
1102420999 12:112802838-112802860 GGGAGAGGACAGAGGCCCTGGGG - Intronic
1103134417 12:118495260-118495282 GGGAAAGGCCAGAGGCAAGAAGG - Intergenic
1103449243 12:121016543-121016565 AGGAGAGGCGCGAGGCATTGTGG + Intergenic
1103461310 12:121107249-121107271 TGGAAAGCCCCGGGGCACCGTGG + Intergenic
1104934154 12:132355581-132355603 GGGAAAGGCCGGCAGCTCTGTGG - Intergenic
1112935663 13:104794995-104795017 GGGATGGGCCTGAGGCACAGCGG + Intergenic
1113533128 13:111043790-111043812 GGGAAGGCCCTGAGGCTCTGGGG + Intergenic
1113656963 13:112073237-112073259 GGGACGGGGCCGAGGCAATGAGG - Intergenic
1113670275 13:112171267-112171289 GGGAAAGGCCAGAGCCAGGGTGG + Intergenic
1113802809 13:113095340-113095362 GGGAGAGGCCAGAGGCCCCGAGG - Intronic
1113894750 13:113756814-113756836 AGCAAAGGCCAGAGGCCCTGCGG + Intergenic
1114985683 14:28225874-28225896 GCTAAAGGCCTGAGGGACTGGGG + Intergenic
1118259261 14:64232565-64232587 GTCAAAGGCCAGAGGGACTGTGG - Intronic
1121267458 14:92613690-92613712 GTGGAAGGACAGAGGCACTGAGG + Intronic
1121442515 14:93957877-93957899 GTGAAAGGCCCGGGCCACTGGGG - Intronic
1123114771 14:105889747-105889769 AGAAAAGGCCCGAGGCAGGGTGG + Intergenic
1123682980 15:22775840-22775862 GGGGGAGCCCAGAGGCACTGGGG + Intronic
1123706601 15:22955373-22955395 GGTCAAGGCCAGAGGCACAGAGG + Intronic
1124334728 15:28848363-28848385 GGGGGAGCCCAGAGGCACTGGGG + Intergenic
1125289590 15:38130969-38130991 GTGAGAGGCCTGAGGTACTGGGG + Intergenic
1125676244 15:41503956-41503978 GGGTAAGGACTGAGGCACTGAGG - Exonic
1125721006 15:41845144-41845166 GGGAAAGGCCCTGGGCACCCAGG + Intronic
1126179559 15:45771649-45771671 TGCAGAGGCCAGAGGCACTGAGG - Intergenic
1126582008 15:50250542-50250564 GGGAAGATCCTGAGGCACTGTGG + Intronic
1126697970 15:51341681-51341703 GAGCATGGCCCGAGGCGCTGAGG + Exonic
1128382805 15:67125832-67125854 GGGCAAGAGCCGCGGCACTGGGG + Intronic
1129109451 15:73329116-73329138 GGGCGAGGCCCGGGCCACTGGGG + Intronic
1129388717 15:75209833-75209855 GGGAAGGGCCTGTGGCAGTGAGG + Intronic
1131271404 15:90949678-90949700 GGTAGAGGACCGAGGCACTGTGG + Exonic
1131336759 15:91556290-91556312 GGGTGAGGCCCGAGGCACCTCGG + Intergenic
1132558696 16:583858-583880 GGGAGGGGGCCGTGGCACTGAGG + Exonic
1132687991 16:1170274-1170296 GGGAAAGGCCCGAAGGCGTGGGG - Intronic
1133229223 16:4358578-4358600 GGGACAGGCCCTAGGCATGGTGG - Intronic
1133348829 16:5088446-5088468 GGCAAAGGCTGGTGGCACTGGGG + Intronic
1134207053 16:12246934-12246956 GGGGAAGGCCAGAGGCACAAGGG + Intronic
1135156684 16:20058899-20058921 GGGAAGCGCCCGCGGCACAGTGG - Intronic
1136623107 16:31443017-31443039 GAGAAACGACCGAGACACTGAGG + Exonic
1136984064 16:35083543-35083565 GGGAGTTGCACGAGGCACTGGGG + Intergenic
1137715997 16:50598670-50598692 AGGAGAGGCCCGAGGGCCTGTGG - Intronic
1139632181 16:68237393-68237415 GGGAAAGGGGCGAGGCCCGGGGG + Intronic
1141443672 16:84044946-84044968 GGGAAGGGCCCCGGGGACTGGGG + Intergenic
1141841667 16:86577767-86577789 AGGGAAGGCCTAAGGCACTGGGG - Intronic
1142220916 16:88854523-88854545 GGGGTAGGCCCGAGGCTCCGAGG + Intronic
1143367317 17:6416475-6416497 GCGGAAGGCCCAGGGCACTGGGG - Intronic
1144185199 17:12789983-12790005 GGGAAAGGACTGAGGCAAGGAGG - Intronic
1144824499 17:18098197-18098219 GGGAGAGGCCCCAGGGGCTGGGG - Intronic
1145844053 17:28022240-28022262 GGGAAAGCCCCAGGGCACTGTGG - Intergenic
1146913781 17:36665184-36665206 GGGAAAGGACTGAGGAAGTGGGG + Intergenic
1147182292 17:38693968-38693990 GGGTCAGGCTCAAGGCACTGAGG + Intergenic
1147531786 17:41285918-41285940 GGGACAGGCCACAGCCACTGTGG - Intergenic
1147991096 17:44333977-44333999 GAGAAAGGCCAGGGGCACTCAGG + Intergenic
1149970288 17:61211074-61211096 AGAAAAGGCCTGAGGCACGGGGG + Intronic
1150133038 17:62679678-62679700 TGGAGAGGCCCCAGGCCCTGGGG + Intronic
1151542599 17:74772242-74772264 GGGTAAGGGCCTTGGCACTGAGG - Exonic
1151548802 17:74809427-74809449 GGGACAGTCCAGAGCCACTGTGG - Intronic
1151578367 17:74963951-74963973 GGGAAAGGACCCTGGCACTTGGG + Intronic
1152111421 17:78359535-78359557 GGGAGAAACCCGAGGCACGGGGG + Intronic
1152537623 17:80959819-80959841 GGGACAGCCCTGAGGCCCTGAGG - Intronic
1152585604 17:81188218-81188240 GGGACAGGGCCCAGGCAATGTGG - Intergenic
1153931153 18:9880949-9880971 AGGAGAGGCCCAAGGCCCTGAGG + Intergenic
1154455574 18:14519848-14519870 AGGAAAAGCCTGAGGCAGTGAGG + Intronic
1157042909 18:44061175-44061197 GGGAAAGGCCTGAGGCCTGGAGG - Intergenic
1157546496 18:48550280-48550302 TGGAAAGGCCTGAGGGCCTGAGG + Intronic
1157583839 18:48788629-48788651 GGGAACAGCCAGAGGCACAGTGG + Intronic
1157616634 18:48991270-48991292 GGGGAGGGCCCGAGTCAGTGTGG - Intergenic
1160519371 18:79495199-79495221 AGGGAAGGACGGAGGCACTGTGG - Intronic
1160679619 19:406770-406792 GTGAAAGGCGCGAGGCAGTGTGG + Exonic
1161043008 19:2120126-2120148 GGGCCGGGCCCGAGGCAGTGAGG + Intronic
1161766428 19:6211359-6211381 GGGAAAGGCCCGAGAACCTTCGG - Intergenic
1162297005 19:9820170-9820192 TGGAAAGCCCCAGGGCACTGTGG + Intronic
1162535577 19:11261679-11261701 GGGACAGGCCCCAGGCGCTGGGG - Intronic
1162717568 19:12643541-12643563 TGGAAAGCCCCAGGGCACTGTGG - Intergenic
1162789923 19:13057531-13057553 GGGGAGGGCCCGGGGCCCTGGGG - Intronic
1163126901 19:15249139-15249161 GGGACAGGCCCAGGGCTCTGAGG + Intronic
1163151597 19:15418399-15418421 GGGAAAGGCGCCAGGCCCTAGGG - Intronic
1164520523 19:28975739-28975761 GGAAAAGGCCCGAGGCCAGGAGG + Intergenic
1164578243 19:29418594-29418616 GGGAAAGCCCTGAGCCACTGTGG + Intergenic
1164879387 19:31718561-31718583 GGGTAAGGACCGAGGCACCTCGG + Intergenic
1165071035 19:33254928-33254950 GGGAAAGGGCAGAGGCATGGGGG + Intergenic
1165395711 19:35562579-35562601 GGGATGGGCCCAACGCACTGCGG - Exonic
1165902792 19:39176565-39176587 GGGACAGGGCAGAGGCAGTGGGG - Intronic
925024412 2:596250-596272 AGGCAGGGCCCTAGGCACTGAGG + Intergenic
928097544 2:28413663-28413685 AGGAAAGGCCCGGTGCCCTGCGG - Exonic
929460140 2:42097388-42097410 GAGAAAGGACCGAGGCAATGGGG - Intergenic
930065493 2:47324519-47324541 GGGCAAGGCCTTAGGCACTGGGG + Intergenic
931342711 2:61417146-61417168 TGGAAAGCCCCAGGGCACTGTGG - Intronic
932301021 2:70667086-70667108 GGGAGAGGCCCCAGGAACTAGGG + Intronic
932403103 2:71495776-71495798 GGGAAGGCCCGGAGTCACTGGGG + Intronic
933828728 2:86188711-86188733 GGCAAAGGGCCCAGGCTCTGTGG - Intronic
935048886 2:99506990-99507012 AGGAAAGGCCCAAGGAAGTGCGG + Intergenic
935212891 2:100953744-100953766 GTGAAAGGCAGCAGGCACTGGGG - Intronic
935629506 2:105201427-105201449 AGGAAAATCCAGAGGCACTGGGG + Intergenic
937131009 2:119513114-119513136 TGGAAAGGCCCCAGACACTGAGG - Intronic
937956087 2:127422519-127422541 GGGAAAGGCGCGATGCTCAGGGG + Intronic
937992730 2:127673532-127673554 GGGAAAGGCCCAAGGGACTCAGG + Intronic
942247787 2:174023779-174023801 AGGAATGGCCCGAAGCACCGGGG - Intergenic
943381718 2:187157841-187157863 GGGAAGGGCCCAAGGAATTGAGG + Intergenic
944803404 2:203258188-203258210 TGTAAAGGCCTGAGGCACAGTGG - Intronic
945046143 2:205783625-205783647 AGGAAAGGCACTAGGCAGTGAGG + Intronic
946958493 2:224957913-224957935 GGCAAAGGCCCAAGGAATTGGGG + Intronic
948308523 2:236968261-236968283 GGGAGGGGCCTGAGGCCCTGGGG - Intergenic
948507972 2:238443591-238443613 GGGAAAGGCTAGAAGCACTCCGG - Intronic
948909542 2:240996214-240996236 GGTACAGGCCCGAGGAAGTGTGG + Intergenic
948922504 2:241072334-241072356 GGGAAGGGCCCAAGGCACCTGGG - Intronic
1169388259 20:5169142-5169164 GGGAAATGGCTGAGGAACTGTGG + Intronic
1170413538 20:16115985-16116007 TGGACAGGCACGGGGCACTGTGG - Intergenic
1172644699 20:36462113-36462135 GGGAAAGCCCAGGGGCAATGGGG - Intronic
1174549253 20:51349845-51349867 GGGAGAGCCCAAAGGCACTGGGG - Intergenic
1174572005 20:51508703-51508725 GGGAAAGGCCAGAGTCTCTAGGG - Intronic
1175294759 20:57900613-57900635 GTGAAGGGCTCGAGGCCCTGTGG - Intergenic
1176818594 21:13633467-13633489 AGGAAAAGCCTGAGGCAGTGAGG - Intronic
1177941753 21:27420646-27420668 TGGAAAGCCCCAGGGCACTGTGG - Intergenic
1179099086 21:38340811-38340833 GGGAAAGGCTGGAGGCCCTATGG - Intergenic
1179779664 21:43691286-43691308 GGGAGAGGCCAAAGGGACTGCGG - Intronic
1181305794 22:21916574-21916596 GGGGGAGGCCCAAGGGACTGAGG - Intergenic
1181666921 22:24404848-24404870 GGGAAAGGGCAGAGGGCCTGGGG - Intronic
1184118918 22:42437925-42437947 GGGAAAGGGCCGGGCCACCGCGG - Intergenic
1184909413 22:47517268-47517290 GGGAAAGCCCAGAGTCAGTGTGG + Intergenic
949937069 3:9124212-9124234 GGGAAAGAGCCGGGGCACTGAGG + Intronic
950453866 3:13080813-13080835 GGGCAGGGCCTGAGTCACTGTGG - Intergenic
953480638 3:43248770-43248792 GGGCAATGCCCTAGGCACAGAGG - Intergenic
954294144 3:49664887-49664909 GGGAAAGGCCCGAGGCACTGGGG + Intronic
954389309 3:50260483-50260505 AGGAAAGGCCCGAGGAACTGGGG - Intergenic
954964934 3:54602068-54602090 GGGACAGGAACCAGGCACTGTGG - Intronic
955346445 3:58165211-58165233 GGGAGAGGGCCCAGGCACAGCGG - Intronic
956247280 3:67198002-67198024 GGTGAAGGCACGAGGCACTGGGG + Intergenic
960691021 3:120347031-120347053 GGGAAAGCCCAGAGGCAAGGAGG - Intronic
960968519 3:123122553-123122575 TGGAGAGGCCAGAGGCACAGTGG + Intronic
961404397 3:126668070-126668092 AGGAGAGTCCCCAGGCACTGGGG - Intergenic
962345932 3:134619071-134619093 GGCAAAGGCACATGGCACTGTGG + Intronic
962793206 3:138830069-138830091 GGGACAGGCCGGAAGCCCTGGGG + Intronic
963751007 3:149180040-149180062 GGGAAAGGTGCCAGCCACTGGGG - Intronic
964278012 3:155028433-155028455 GGAAAAGGCAGGAGGCAATGTGG + Intronic
968982095 4:3855810-3855832 GGGAAAGGGTCCAGGCGCTGGGG - Intergenic
969466166 4:7357797-7357819 GGAGAAGGCCCGAGGCCCTCAGG - Intronic
969656108 4:8499433-8499455 GGCAAAGGCCTGAGGCTCCGTGG - Intergenic
974430728 4:61792773-61792795 GGGAAAGTGGCCAGGCACTGTGG - Intronic
979295904 4:119031915-119031937 GGGAATGCCCACAGGCACTGGGG - Exonic
980035821 4:127881389-127881411 GGCAGTGTCCCGAGGCACTGCGG + Intronic
980753080 4:137117902-137117924 AAGAAAGGCCCGAGACCCTGTGG + Intergenic
982374774 4:154677768-154677790 GGGGAAGGCCGAAGACACTGAGG + Intronic
984959871 4:185086262-185086284 GGGAAAGGCGCGAGGCACTCTGG + Intergenic
986393580 5:7306374-7306396 GGGGGAGCCCAGAGGCACTGGGG + Intergenic
986738170 5:10682693-10682715 GGGAATGGCAGGTGGCACTGAGG + Intronic
987505716 5:18768785-18768807 GGGAAAGGCATGAAGCACAGGGG - Intergenic
988906220 5:35793229-35793251 GGGAATGGGCCAAGGCATTGAGG - Exonic
991478238 5:67046976-67046998 TGGAAAAGCCTGAGGCACTCAGG + Intronic
996512186 5:124329090-124329112 AGGGAAGGGCAGAGGCACTGTGG - Intergenic
997317806 5:132952473-132952495 GGGAAGAGCCAGAGGAACTGGGG - Intronic
997592820 5:135086169-135086191 GGGAATGTCCCGGGGCATTGAGG + Intronic
998157639 5:139795725-139795747 GGGGAAGGGCGGGGGCACTGCGG - Intergenic
1001389345 5:171366328-171366350 TGGAAAGCCCCAGGGCACTGTGG + Intergenic
1001716250 5:173818686-173818708 TGGAAAAGCCGGAGACACTGGGG + Intergenic
1002345368 5:178544704-178544726 GGCAAAGCTCAGAGGCACTGTGG + Intronic
1003441634 6:6148240-6148262 GAGACAGGCCGGAGGCAGTGGGG + Intronic
1004894158 6:20130638-20130660 GGGAAAGGGGCCAGGCACGGTGG - Intronic
1007366444 6:41397506-41397528 GGGCAAAGTCCTAGGCACTGGGG - Intergenic
1008205656 6:48653517-48653539 GGGACAGCCCCTAGGCCCTGGGG + Intergenic
1008455429 6:51705362-51705384 GGGAAAAGCCCATGGCAGTGAGG + Intronic
1013052421 6:106549223-106549245 GGGTAAAGCCTGAGGCCCTGTGG + Intronic
1016833608 6:148455896-148455918 GGCCAAGGCTGGAGGCACTGCGG - Intronic
1017205401 6:151799872-151799894 GAGAAAGTCCAGAGGGACTGAGG + Intronic
1018984577 6:168626512-168626534 CAGACAGGCCTGAGGCACTGGGG + Intronic
1019137320 6:169918389-169918411 GGGACAGGCCAGGGGCACAGAGG + Intergenic
1019553436 7:1616321-1616343 GGGAAAGGCACCAGGCATGGTGG - Intergenic
1022924499 7:35045160-35045182 GGGAATGGTGAGAGGCACTGGGG - Intergenic
1023009998 7:35917858-35917880 GGGAAGGGCCCATGGCACAGAGG - Intergenic
1024080835 7:45853721-45853743 GGGAAGGGCCCATGGCACAGAGG + Intergenic
1024283648 7:47738983-47739005 TGCAAAGGCCCGAGGACCTGAGG - Intronic
1024978045 7:55131731-55131753 GGAAAAGTCCAGAGGCCCTGGGG + Intronic
1026775273 7:73227286-73227308 GGGAAAGGGAAGGGGCACTGCGG - Intergenic
1027016130 7:74780657-74780679 GGGAAAGGGAAGGGGCACTGCGG - Intronic
1027071898 7:75165280-75165302 GGGAAAGGGAAGGGGCACTGCGG + Intergenic
1028610950 7:92710958-92710980 GGCAATGGCCAGAGGCACTCAGG + Intronic
1029217552 7:98962271-98962293 GGGCAGGGACCCAGGCACTGTGG - Intronic
1029822676 7:103160446-103160468 GGGAATGGTGAGAGGCACTGGGG - Intergenic
1030044114 7:105479708-105479730 GGGAAGGGGCCCAGGCACAGTGG + Intronic
1035259285 7:157651310-157651332 TGGAGAGTCCTGAGGCACTGAGG - Intronic
1035621295 8:1037239-1037261 GAGAAAGGCCCGAGGGAAGGTGG - Intergenic
1036044859 8:5128182-5128204 GGAAAAGGCCCAGGGCACTGTGG - Intergenic
1036604863 8:10295785-10295807 GGGAGAGGGCAGAGGCACCGGGG - Intronic
1037443193 8:18938332-18938354 GGGAAAGGGGCCAGGCACAGTGG + Intronic
1037776472 8:21838939-21838961 GGGAAAGTCCCGGGGGTCTGTGG + Intergenic
1038050524 8:23806139-23806161 GACATAGGCCAGAGGCACTGAGG - Intergenic
1038198005 8:25385540-25385562 GGAAAAGGCCAGAGTCACAGAGG + Intronic
1038218851 8:25588497-25588519 GGAAAAGCCCTGGGGCACTGTGG - Intergenic
1038328479 8:26589882-26589904 GGGACAAGCCCAAGGCACTGGGG - Intronic
1039056346 8:33540214-33540236 TGGAAAGCCCCAGGGCACTGTGG + Intergenic
1040627220 8:49162442-49162464 TGGAAAGGCCTGAGGAACTGAGG + Intergenic
1041649278 8:60285736-60285758 GAGCAAGGCACTAGGCACTGTGG + Intergenic
1042035985 8:64534250-64534272 TGAAAAGGCCCTAGGCATTGAGG + Intergenic
1044819548 8:96146142-96146164 AGGAACCGCCCTAGGCACTGAGG - Intronic
1048112842 8:131487138-131487160 GCCAAAGGCCCCAGGCAGTGAGG + Intergenic
1048498672 8:134956614-134956636 GGCACTGGCCTGAGGCACTGTGG + Intergenic
1049707043 8:144047806-144047828 GGGAAAGCCCAGAGGGGCTGTGG + Intergenic
1051110716 9:13632373-13632395 GGCAAAGGGGCCAGGCACTGTGG + Intergenic
1052974339 9:34400505-34400527 GAGAAAGGCCCAGGGCAGTGGGG - Exonic
1053280760 9:36818655-36818677 AGGAAGGGCCAGAGGCACGGTGG - Intergenic
1053307352 9:36994096-36994118 GGGACAGGCCCTGGGCACTAGGG + Intronic
1054953933 9:70886427-70886449 AGTAAAGGCACAAGGCACTGAGG - Intronic
1057723780 9:97554198-97554220 GGGAAAGGCTCGAGGCAGGTGGG + Intronic
1057845506 9:98519448-98519470 GGGAAAGGCCGGAGCAACAGTGG + Intronic
1060055132 9:120406745-120406767 GAGCAAGGCCAGAGGCACTGAGG + Intronic
1060158311 9:121336026-121336048 GGCAAAGGCCCAATGTACTGTGG + Intergenic
1060424370 9:123492415-123492437 GGGAACAGCCCAAGGCACTCAGG + Intronic
1060449831 9:123726929-123726951 GGGAAAGGCCAGGGACTCTGTGG + Intronic
1060482632 9:124026122-124026144 GGGCAGGGCTGGAGGCACTGAGG + Intronic
1060546700 9:124466178-124466200 GTGACAGGCCCCAGGCTCTGGGG + Intronic
1061442958 9:130619024-130619046 GGGAAAGGCGAGAGGCAATCTGG - Intronic
1062371740 9:136242798-136242820 ATGAAAGGCCCTTGGCACTGAGG - Intronic
1062419156 9:136471083-136471105 TGGAAAGACCTGTGGCACTGTGG - Intronic
1203528764 Un_GL000213v1:116040-116062 AGGAAAAGCCTGAGGCAGTGAGG + Intergenic
1192155579 X:68744070-68744092 GGGGAAGGCAAGAGGGACTGAGG - Intergenic
1192176075 X:68886418-68886440 GGGAAAGGCCTGAGGGCCTGGGG - Intergenic
1195598504 X:106720187-106720209 GGGAAAGGCCCAAGGCATGGGGG - Intronic
1196418148 X:115495269-115495291 ATGAAAGGCCTGAGCCACTGTGG - Intergenic
1197772506 X:130098162-130098184 AGGCAGGGCCCCAGGCACTGCGG - Intronic
1200073571 X:153540597-153540619 GGGCAGGGCCCGAGGGATTGGGG - Intronic
1200222886 X:154400491-154400513 TGGAAAGCCCCAGGGCACTGTGG + Exonic