ID: 954294145

View in Genome Browser
Species Human (GRCh38)
Location 3:49664888-49664910
Sequence GGAAAGGCCCGAGGCACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 198}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294139_954294145 -9 Left 954294139 3:49664874-49664896 CCTTGCCTCTTCTGGGAAAGGCC 0: 1
1: 0
2: 1
3: 21
4: 229
Right 954294145 3:49664888-49664910 GGAAAGGCCCGAGGCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
954294132_954294145 25 Left 954294132 3:49664840-49664862 CCATGCCCAGCATGGTGAGTACA 0: 1
1: 0
2: 3
3: 24
4: 222
Right 954294145 3:49664888-49664910 GGAAAGGCCCGAGGCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
954294137_954294145 -3 Left 954294137 3:49664868-49664890 CCTGTACCTTGCCTCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954294145 3:49664888-49664910 GGAAAGGCCCGAGGCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
954294134_954294145 19 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294145 3:49664888-49664910 GGAAAGGCCCGAGGCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 198
954294133_954294145 20 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294145 3:49664888-49664910 GGAAAGGCCCGAGGCACTGGGGG 0: 1
1: 0
2: 0
3: 15
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294145 Original CRISPR GGAAAGGCCCGAGGCACTGG GGG Intronic
900512695 1:3068095-3068117 GGAAAGGCCAGCGGCGCAGGTGG - Intergenic
900558272 1:3290846-3290868 GGAAGGGCCCGGAGCACTGGGGG + Intronic
900580207 1:3405014-3405036 GGAAGGGCCCGAGCCACCGCAGG - Intronic
901499144 1:9640875-9640897 GCAAAGGCCCTGGGCAGTGGTGG - Intergenic
901501497 1:9655203-9655225 GGAAGGGCCCTATCCACTGGAGG + Intronic
901511926 1:9721860-9721882 GGTGAGGCCCAAGGCCCTGGGGG + Exonic
902334542 1:15747464-15747486 GGAAGTGCCCGGGTCACTGGAGG + Intronic
902584160 1:17427796-17427818 GGAAGGGCTGGAGGGACTGGAGG + Intronic
902689171 1:18099089-18099111 GGAAGGTGCCTAGGCACTGGGGG - Intergenic
903419293 1:23206877-23206899 TGAAAGGCTCCAGGAACTGGTGG + Intergenic
904356784 1:29945387-29945409 GAAAAAGCCAGAGGCCCTGGCGG - Intergenic
910063669 1:83125128-83125150 CCAAAGGCCCGAGACCCTGGAGG + Intergenic
912515640 1:110215023-110215045 GGAAGGGCCCGCAGCACTGTGGG + Intronic
914300747 1:146375204-146375226 GGAAGGTCCCCAGACACTGGTGG + Intergenic
915455149 1:156035626-156035648 TGAAAGGCCAGGGGCTCTGGAGG + Exonic
918346182 1:183609317-183609339 AGAAAGGACCCAGGCACGGGTGG + Intergenic
918961493 1:191283373-191283395 GGCAAGTCCTCAGGCACTGGTGG - Intergenic
919743664 1:200995307-200995329 GGCTAGGCCCTGGGCACTGGTGG - Intronic
920002257 1:202808014-202808036 GGGGAGGCCCGAGGCGCGGGGGG - Intronic
920367592 1:205456318-205456340 GGGAAGGCGCGAGGCTGTGGAGG - Intergenic
924514776 1:244756719-244756741 GCAAAGGGCAGAGGCAGTGGAGG - Intergenic
1062795387 10:341294-341316 GGAACGGCAGAAGGCACTGGTGG + Exonic
1064092112 10:12394387-12394409 AGAAAGGGGAGAGGCACTGGAGG - Intronic
1064528288 10:16281276-16281298 GGAAATGCCCTAGAAACTGGGGG - Intergenic
1067659563 10:48224236-48224258 GGAGTGGCCCAGGGCACTGGAGG - Intronic
1068547606 10:58366867-58366889 GGAAAAGCTCCAGGCAATGGTGG - Intronic
1070481904 10:76890984-76891006 GAATAGGACCCAGGCACTGGTGG - Intronic
1072099559 10:92216355-92216377 CGAAGGGCCCGAGGCTCAGGCGG + Intronic
1073261270 10:102192396-102192418 GGAAACACCTGAGGCACAGGAGG + Intergenic
1075917773 10:126184165-126184187 GGGAAGACCCAAGGTACTGGGGG - Intronic
1077250789 11:1559714-1559736 GGAGAAGCCCGGGGCACTGGGGG + Intronic
1077250926 11:1560348-1560370 GGAGGAGCCCTAGGCACTGGGGG - Intronic
1077285169 11:1762370-1762392 GGGAAGGCCAGTGGCCCTGGGGG - Intronic
1077378351 11:2216010-2216032 GAGAAGGCCCGGGGCAGTGGGGG - Intergenic
1077380543 11:2235004-2235026 GGAAAGGCCAGAGCTGCTGGGGG - Intergenic
1077400707 11:2355503-2355525 GGAAAGGCCAGTACCACTGGGGG - Intergenic
1077760643 11:5092881-5092903 TGAAAGGCCCAAGTCAATGGTGG - Intergenic
1077889098 11:6405839-6405861 GGAGAGTCCTGAGGCAATGGAGG - Intronic
1077921775 11:6646969-6646991 GGAGTGGCCCGAGGCGCTGAAGG + Intronic
1080908981 11:36575932-36575954 GGAGAGGCACGAGGCTCTGAGGG + Exonic
1082226768 11:49717225-49717247 GGCAAGGCAGGAGGCAGTGGTGG - Intergenic
1086622658 11:88905855-88905877 GGCAAGGCAGGAGGCAGTGGTGG + Intronic
1088168227 11:106964359-106964381 AGGAAGGCCAGAGGCCCTGGAGG - Intronic
1088998060 11:115021040-115021062 GGAGAGGCCTGAAGCAGTGGGGG - Intergenic
1089500939 11:118930789-118930811 GGGAAGGCCTGAGGCACGGAAGG - Intronic
1090713360 11:129408126-129408148 GGAAAGGCCTGGGGCATTTGGGG + Intronic
1090857834 11:130625768-130625790 GGAAACACCCGAGGCCCAGGCGG - Intergenic
1091826871 12:3519456-3519478 GGACAGGGCCCAGGAACTGGGGG + Intronic
1092287355 12:7136404-7136426 GGATAGGCCTGAGGCAGTGTTGG - Intronic
1093181487 12:15972237-15972259 GGAGAGGTCCAAGGCAATGGTGG - Intronic
1100169759 12:91960806-91960828 GTAAAGGCCTGAGAAACTGGGGG - Intergenic
1101619490 12:106371040-106371062 GGAAAGGCAAGAGAGACTGGAGG + Intronic
1102213361 12:111143273-111143295 GGAAACACCCAAGGCACTTGTGG - Intronic
1103449244 12:121016544-121016566 GGAGAGGCGCGAGGCATTGTGGG + Intergenic
1103919727 12:124393124-124393146 CGAGAGGCCCGAGGCTCTGCTGG - Intronic
1104981363 12:132574362-132574384 GGGAAGGCCCGTGGCAAGGGAGG + Exonic
1105015510 12:132784286-132784308 GGAAAGGATCCAGGCCCTGGAGG - Exonic
1109866744 13:68273772-68273794 GGAAAGGCAAGAGGCAGAGGTGG - Intergenic
1113823803 13:113234567-113234589 GGAAAGGCCTGAGGCTCTGCTGG - Intronic
1114073296 14:19132243-19132265 GGCAAGGCCTGATGCTCTGGAGG + Intergenic
1114088970 14:19267740-19267762 GGCAAGGCCTGATGCTCTGGAGG - Intergenic
1121334821 14:93070781-93070803 GGATAGGCCCCAGGTGCTGGGGG - Intronic
1122354074 14:101112935-101112957 GGAAAGTTCTGAGGCCCTGGAGG + Intergenic
1123114772 14:105889748-105889770 GAAAAGGCCCGAGGCAGGGTGGG + Intergenic
1123682981 15:22775841-22775863 GGGGAGCCCAGAGGCACTGGGGG + Intronic
1124334729 15:28848364-28848386 GGGGAGCCCAGAGGCACTGGGGG + Intergenic
1124694346 15:31851450-31851472 GGAAAGGCCAGAGAAACTGATGG + Intronic
1125289591 15:38130970-38130992 TGAGAGGCCTGAGGTACTGGGGG + Intergenic
1125676243 15:41503955-41503977 GGTAAGGACTGAGGCACTGAGGG - Exonic
1126179558 15:45771648-45771670 GCAGAGGCCAGAGGCACTGAGGG - Intergenic
1131028739 15:89168413-89168435 GGAGAGGCCCCAGGCACTAAAGG + Intronic
1132734195 16:1377554-1377576 GGAAGGGCCCGGGGCAGCGGTGG - Intronic
1133348830 16:5088447-5088469 GCAAAGGCTGGTGGCACTGGGGG + Intronic
1134207054 16:12246935-12246957 GGGAAGGCCAGAGGCACAAGGGG + Intronic
1137898305 16:52237815-52237837 GGAAATGCCCAGGGCCCTGGAGG - Intergenic
1138553793 16:57760797-57760819 GGAAGGGCACGTGGCCCTGGCGG + Exonic
1139632182 16:68237394-68237416 GGAAAGGGGCGAGGCCCGGGGGG + Intronic
1141593801 16:85085627-85085649 GGGGAGGCCCCAGGCCCTGGAGG + Intronic
1141841666 16:86577766-86577788 GGGAAGGCCTAAGGCACTGGGGG - Intronic
1143367316 17:6416474-6416496 CGGAAGGCCCAGGGCACTGGGGG - Intronic
1144323151 17:14150515-14150537 GGAAAGGGCAGAGGCCTTGGAGG + Intronic
1144698864 17:17323682-17323704 GGAAAGGTCTGTGGCCCTGGAGG + Intronic
1144728809 17:17515084-17515106 GGCCAGGCCCGAGACGCTGGAGG + Intronic
1144824498 17:18098196-18098218 GGAGAGGCCCCAGGGGCTGGGGG - Intronic
1148228801 17:45918355-45918377 GGAAAGGGCCCAGGCTTTGGAGG + Intronic
1149882312 17:60305407-60305429 GGAAAGCACCCAGGCACTCGTGG + Intronic
1150133039 17:62679679-62679701 GGAGAGGCCCCAGGCCCTGGGGG + Intronic
1151498949 17:74476576-74476598 GGAAAGGGCCCAAGCAATGGAGG + Intronic
1151578368 17:74963952-74963974 GGAAAGGACCCTGGCACTTGGGG + Intronic
1152746046 17:82039820-82039842 GGACAGGCCGGAGGCAAGGGTGG + Intergenic
1152772510 17:82178994-82179016 GAGAAGGCCCCAGGCCCTGGTGG + Intronic
1155038707 18:22046967-22046989 GGTACGGCACTAGGCACTGGAGG - Intergenic
1156446882 18:37243290-37243312 GGAAAGGCAGGAGGCCCTAGAGG + Exonic
1159023894 18:63165708-63165730 GCAAAGGGCCCAGACACTGGCGG + Intronic
1159028191 18:63206022-63206044 GGAGAGGCCTGAGGCACAGCAGG - Intronic
1160818441 19:1046967-1046989 GGAAGGGCCCGAGGCAGCTGAGG - Exonic
1161280192 19:3441695-3441717 GGAAGGGCCGGAGGGGCTGGGGG + Intronic
1162535576 19:11261678-11261700 GGACAGGCCCCAGGCGCTGGGGG - Intronic
1163151596 19:15418398-15418420 GGAAAGGCGCCAGGCCCTAGGGG - Intronic
1164941074 19:32252589-32252611 GGGAGGGCCAGAGGCACGGGTGG + Intergenic
1165651378 19:37493771-37493793 GGAAAGGCTGGAGGCAATGCAGG - Intergenic
1167261941 19:48463604-48463626 GGATAAGCCTGAGGCAGTGGTGG + Intronic
925148021 2:1593986-1594008 GGAGAGGCCCAAGCCAATGGCGG + Intergenic
925899008 2:8495211-8495233 GGATAGGCACGAGGCAAAGGAGG + Intergenic
926743808 2:16134247-16134269 TGTAAGGCCCGAAGCACTGCTGG + Intergenic
927679831 2:25132051-25132073 GGAAAGGGGCGGGGCACCGGGGG + Intronic
928097543 2:28413662-28413684 GGAAAGGCCCGGTGCCCTGCGGG - Exonic
930065494 2:47324520-47324542 GGCAAGGCCTTAGGCACTGGGGG + Intergenic
933145894 2:78852183-78852205 GGAAGGGCCAGAGGCCATGGAGG - Intergenic
935138714 2:100332509-100332531 GGAAAGGCCCCAGGAAAAGGGGG - Intergenic
935629507 2:105201428-105201450 GGAAAATCCAGAGGCACTGGGGG + Intergenic
937992731 2:127673533-127673555 GGAAAGGCCCAAGGGACTCAGGG + Intronic
942301849 2:174570648-174570670 GGAAGGGACCCAGGCATTGGTGG + Intronic
946406095 2:219492829-219492851 GGAATGTCCCGTGGCATTGGTGG - Exonic
946533687 2:220604130-220604152 GGAATGGCCTGAAGCGCTGGAGG - Intergenic
947312857 2:228823272-228823294 AGAAAGGCCTGAGGCAATGATGG - Intergenic
948308522 2:236968260-236968282 GGAGGGGCCTGAGGCCCTGGGGG - Intergenic
948569155 2:238906718-238906740 AGGGAGGCCCCAGGCACTGGGGG - Intronic
1172092723 20:32445626-32445648 GGAGAGGCCTTGGGCACTGGAGG + Exonic
1172644698 20:36462112-36462134 GGAAAGCCCAGGGGCAATGGGGG - Intronic
1173389716 20:42621224-42621246 GGCAAGGCCCGAGGAGCTGGAGG - Intronic
1173845050 20:46182890-46182912 GGAAGGGGCTGAGGGACTGGAGG + Intronic
1174035883 20:47667984-47668006 GAAAAGGCCCAAGGCTCTGCTGG - Intronic
1174081202 20:47971900-47971922 GGGAAGGACAGAGGCACTGATGG - Intergenic
1174178355 20:48658905-48658927 GGGAGGCCCCAAGGCACTGGAGG + Intronic
1175233672 20:57493373-57493395 GGCAAGGCCCGGGGGACGGGAGG - Intergenic
1176012841 20:62909143-62909165 GGACAGGCCCGGGACCCTGGAGG + Intronic
1176107129 20:63394758-63394780 GGAAAAGGCGGAGGCGCTGGTGG + Intergenic
1180491736 22:15854596-15854618 GGCAAGGCCTGATGCTCTGGAGG + Intergenic
1183475582 22:38034178-38034200 GGACAGGCCCAAGGAGCTGGGGG - Intronic
1184333582 22:43840674-43840696 GGGAAGGCCCGAGGGGCAGGTGG - Intronic
1184411125 22:44327118-44327140 GGAGAGGCCCCAGGAACTGCTGG - Intergenic
1184778399 22:46634561-46634583 GGAACTGCCCAAGGCACTTGGGG + Intronic
952498906 3:33940910-33940932 GGAAAGAGCCAAGTCACTGGAGG - Intergenic
952609036 3:35184740-35184762 GGATAGTCCGGAGGCACTGTTGG + Intergenic
952684897 3:36135992-36136014 GTAAAGGCCTGAGGAACTGATGG + Intergenic
953863654 3:46565685-46565707 GGACAGGCCTGAGGCAAGGGCGG - Intronic
954294145 3:49664888-49664910 GGAAAGGCCCGAGGCACTGGGGG + Intronic
954472398 3:50708659-50708681 GGAAAGCCCCTAGGCCCTTGTGG - Intronic
954615069 3:51965338-51965360 AGAAAGGCCCGAAGGGCTGGAGG - Intronic
956247281 3:67198003-67198025 GTGAAGGCACGAGGCACTGGGGG + Intergenic
961495430 3:127287911-127287933 GGAGAGGCCTGAGGAGCTGGAGG + Intergenic
961649763 3:128411480-128411502 GGACACGCCTGAAGCACTGGTGG - Intergenic
961654226 3:128432762-128432784 GGAAAGGGCCGGGGGCCTGGAGG + Intergenic
961677011 3:128573839-128573861 GGAAACGCCTGAGTCACCGGAGG + Exonic
961831213 3:129623834-129623856 GGAAAGGCCGGAGGAGCAGGAGG + Intergenic
963106379 3:141650969-141650991 AGAAAGGGCCAAGGAACTGGAGG - Intergenic
963732060 3:148984509-148984531 TGAAAGGCCAGGGGCTCTGGAGG + Intergenic
967928688 3:194673996-194674018 GGAAATGCCCAAGGGACTGCTGG + Intergenic
969710647 4:8841076-8841098 GGAAAGGGCAGAGGCAAGGGAGG + Intergenic
970854705 4:20638306-20638328 GGAAAGTCCCGAGCCATAGGAGG - Intergenic
983574956 4:169250951-169250973 GCAAAGGCCCTAGGCTTTGGTGG + Intronic
983936202 4:173504354-173504376 GGAAAGGCCCCAGGCTGTGCTGG - Intergenic
984959872 4:185086263-185086285 GGAAAGGCGCGAGGCACTCTGGG + Intergenic
985510511 5:310681-310703 GGAAAGGTCCAAGTCACTGCAGG - Intronic
985524051 5:392802-392824 GGTAAGGCCTGAGGCAGTCGCGG - Intronic
986393581 5:7306375-7306397 GGGGAGCCCAGAGGCACTGGGGG + Intergenic
991562559 5:67969886-67969908 AGAAATGCCTGAGGCACTGAAGG - Intergenic
998462984 5:142323323-142323345 GGAGAGGCCAGACACACTGGAGG - Intronic
1002089559 5:176796496-176796518 GGAAAGGGGCGAGGCACTACAGG + Intergenic
1002580089 5:180203384-180203406 GGGTAGTCCCGAGGAACTGGGGG + Intronic
1002596028 5:180323957-180323979 CCAAAGGCCAGATGCACTGGTGG - Intronic
1003441635 6:6148241-6148263 AGACAGGCCGGAGGCAGTGGGGG + Intronic
1007214730 6:40228258-40228280 GGAAAGGGCCGAGGCAGCAGGGG - Intergenic
1007236696 6:40395540-40395562 GGAAAGGAACGAGGCCCTGGAGG - Intronic
1007366443 6:41397505-41397527 GGCAAAGTCCTAGGCACTGGGGG - Intergenic
1014644295 6:123954336-123954358 GGAAAGCCCCTAGGCCCTGATGG - Intronic
1015994958 6:138987994-138988016 GCGGAGGCGCGAGGCACTGGCGG + Exonic
1016996945 6:149967408-149967430 GGAGAGCCCAGAGGCCCTGGTGG - Intronic
1017001864 6:150002844-150002866 GGAGAGCCCAGAGGCCCTGGTGG + Intergenic
1017373075 6:153735905-153735927 GGAAAGGACCGAGGCAGCAGTGG + Intergenic
1019386721 7:761241-761263 GGAGAGCCCCCAGGCGCTGGAGG - Intronic
1021616228 7:22505786-22505808 GCAAAAGCCTGAGGCACTGCAGG - Intronic
1022506369 7:30910615-30910637 GGAGATGCCCGGGGCACAGGCGG + Intergenic
1022926018 7:35057001-35057023 GCAAAAGCCTGAGGCACTGCAGG - Intergenic
1028113610 7:86972703-86972725 GGAAAGGACAGTGGCATTGGAGG - Intronic
1028376241 7:90148552-90148574 GCAAAAGCCTGAGGCACTGCAGG + Intergenic
1029381634 7:100219294-100219316 TGAAAGGGAAGAGGCACTGGTGG + Exonic
1029436868 7:100568521-100568543 GGAGAGGCTCGAAGCACAGGTGG - Intergenic
1029824028 7:103171690-103171712 GCAAAAGCCTGAGGCACTGCAGG - Intergenic
1031890907 7:127292640-127292662 GGAAAAGCCAGAGGCCATGGTGG - Intergenic
1034453994 7:151154950-151154972 GGAAAAGCCAGAGGGAGTGGAGG + Intronic
1035259284 7:157651309-157651331 GGAGAGTCCTGAGGCACTGAGGG - Intronic
1036695175 8:10969629-10969651 TGAAAGGCCAGAGGAACTGTTGG + Intronic
1037863549 8:22424570-22424592 GGAAAGGCAGGAGGGACTGTAGG - Intronic
1038328478 8:26589881-26589903 GGACAAGCCCAAGGCACTGGGGG - Intronic
1040278527 8:46026011-46026033 GGGAAGGCCCAAGTCACTGCTGG + Intergenic
1043231010 8:77800736-77800758 TGTAAGGCCCGAGGCCCTAGTGG + Intergenic
1044781398 8:95747027-95747049 GGAAAGGCCAGAGTGCCTGGAGG + Intergenic
1044819547 8:96146141-96146163 GGAACCGCCCTAGGCACTGAGGG - Intronic
1045346105 8:101294994-101295016 GGTGAGGACAGAGGCACTGGGGG - Intergenic
1045815210 8:106270477-106270499 GGAGAGGCGCCAGGCACAGGGGG - Intronic
1047404404 8:124573225-124573247 GGAAGGGGCCCAGGCCCTGGAGG - Intronic
1047485938 8:125330744-125330766 GGAAACGCCAGAGGCTTTGGAGG + Intronic
1049108407 8:140627914-140627936 GGACAGCCCCGAGACAGTGGGGG - Intronic
1051371087 9:16359836-16359858 GGAGAGGCCAGAGGAAGTGGAGG - Intergenic
1051504494 9:17812404-17812426 GGCCAGGCCAGAGGCACTGCTGG + Intergenic
1053280759 9:36818654-36818676 GGAAGGGCCAGAGGCACGGTGGG - Intergenic
1053429760 9:38034260-38034282 GTAAAGGTCCCAGGCAGTGGAGG - Intronic
1054953932 9:70886426-70886448 GTAAAGGCACAAGGCACTGAGGG - Intronic
1057807323 9:98228888-98228910 CGAAAGGCTCCAGGAACTGGAGG + Intronic
1058819903 9:108720499-108720521 GGCAAGGCCCAAGGCACTGCAGG + Intergenic
1060055133 9:120406746-120406768 AGCAAGGCCAGAGGCACTGAGGG + Intronic
1060508415 9:124215244-124215266 GGGAAGCCCCCAGGGACTGGGGG - Intergenic
1061790259 9:133055408-133055430 GGCAGGGCCCCAGACACTGGGGG - Intronic
1062401817 9:136376138-136376160 GCCAAGGCCCGAGGCATGGGTGG + Intronic
1186635143 X:11395649-11395671 AGACAGGCCCGGGGCACAGGAGG + Intronic
1187095686 X:16145508-16145530 GGATAGGCGGGAGGCAGTGGTGG + Intronic
1190055476 X:47178977-47178999 GGAAAGCCCCTAGGCAATGGTGG - Intronic
1190094047 X:47464559-47464581 GGAAATGACCGAGACCCTGGGGG - Intronic
1197772505 X:130098161-130098183 GGCAGGGCCCCAGGCACTGCGGG - Intronic
1199952527 X:152716919-152716941 AGTAGGACCCGAGGCACTGGAGG + Exonic
1199957156 X:152751529-152751551 AGTAGGACCCGAGGCACTGGAGG - Exonic
1200064679 X:153498678-153498700 GGCAGGGCCCCAGGCTCTGGGGG + Intronic