ID: 954294146

View in Genome Browser
Species Human (GRCh38)
Location 3:49664891-49664913
Sequence AAGGCCCGAGGCACTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 288}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294133_954294146 23 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294146 3:49664891-49664913 AAGGCCCGAGGCACTGGGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 288
954294132_954294146 28 Left 954294132 3:49664840-49664862 CCATGCCCAGCATGGTGAGTACA 0: 1
1: 0
2: 3
3: 24
4: 222
Right 954294146 3:49664891-49664913 AAGGCCCGAGGCACTGGGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 288
954294137_954294146 0 Left 954294137 3:49664868-49664890 CCTGTACCTTGCCTCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954294146 3:49664891-49664913 AAGGCCCGAGGCACTGGGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 288
954294139_954294146 -6 Left 954294139 3:49664874-49664896 CCTTGCCTCTTCTGGGAAAGGCC 0: 1
1: 0
2: 1
3: 21
4: 229
Right 954294146 3:49664891-49664913 AAGGCCCGAGGCACTGGGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 288
954294134_954294146 22 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294146 3:49664891-49664913 AAGGCCCGAGGCACTGGGGGTGG 0: 1
1: 0
2: 2
3: 21
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294146 Original CRISPR AAGGCCCGAGGCACTGGGGG TGG Intronic
900181311 1:1312184-1312206 AGGGCCCAAGGGAGTGGGGGGGG + Intronic
900344727 1:2205240-2205262 AAGGACGGTGGCACTGGGAGGGG - Intronic
900395714 1:2452471-2452493 AAGGCCAGAGGGGCTGGGGCAGG - Intronic
900464509 1:2818503-2818525 AAGGCCCAAGACCCAGGGGGAGG - Intergenic
900938947 1:5785274-5785296 AGGGCACGAGGCACTTGGGTGGG - Intergenic
900964897 1:5951132-5951154 AAGGCCCGAGGGAATGGGCGGGG + Intronic
901877468 1:12175172-12175194 AAGGCCAGAGGCCGTGGGAGTGG + Intronic
902038327 1:13473709-13473731 GAGGCCCGACACACTGGGGAGGG - Intergenic
902225867 1:14996196-14996218 AAGATGCCAGGCACTGGGGGTGG - Intronic
902511063 1:16967395-16967417 CAGGCCAGAGGCCTTGGGGGCGG - Intronic
903234988 1:21944378-21944400 AAGGAACAAGGGACTGGGGGTGG - Intergenic
904334749 1:29789654-29789676 AAGGGAAGTGGCACTGGGGGTGG + Intergenic
905731161 1:40300396-40300418 AAGGACAGAGGCTCTGGAGGGGG - Intergenic
906214708 1:44031803-44031825 AAGGCCTGGGGCACTATGGGGGG + Intergenic
909604310 1:77493329-77493351 AAGGCCTGAGAACCTGGGGGGGG - Intronic
910488641 1:87744145-87744167 AAAGCAGGAGGCAGTGGGGGAGG - Intergenic
915974304 1:160375025-160375047 AGGGGACCAGGCACTGGGGGAGG + Intergenic
915974401 1:160375429-160375451 AAGGCCCCAGGGGCTGGGTGGGG + Intergenic
917456877 1:175193045-175193067 AAGGCCAGAGGCACCCGAGGTGG - Intergenic
918097574 1:181347611-181347633 AAACCCCGAGTCACTGGTGGAGG - Intergenic
918961492 1:191283370-191283392 AAGTCCTCAGGCACTGGTGGTGG - Intergenic
920002256 1:202808011-202808033 GAGGCCCGAGGCGCGGGGGGCGG - Intronic
920367591 1:205456315-205456337 AAGGCGCGAGGCTGTGGAGGTGG - Intergenic
920757598 1:208749100-208749122 AAAGCCAGCGGCAATGGGGGTGG + Intergenic
920868799 1:209775734-209775756 CAGGTACCAGGCACTGGGGGTGG + Exonic
922566763 1:226606183-226606205 AAGGCCCGAGGTTCTTGAGGAGG + Exonic
923380341 1:233411238-233411260 TAGCTCCAAGGCACTGGGGGGGG + Intergenic
1063104650 10:2982355-2982377 GAGGAACGAGGCACTGGGAGTGG - Intergenic
1063153675 10:3358667-3358689 AAGGCCAGAGGCAGAGGGAGGGG - Intergenic
1063240206 10:4161403-4161425 AAGGCCCCATTCACTGTGGGTGG - Intergenic
1063758327 10:9041702-9041724 ACTGGCCTAGGCACTGGGGGTGG - Intergenic
1066320257 10:34295998-34296020 AATGCCAGAGGCAGTGGGGCAGG + Intronic
1067058528 10:43066000-43066022 AAGGGCTGAGGAGCTGGGGGTGG - Intergenic
1067105815 10:43365642-43365664 CAGGCACGAGCCACTGGGTGTGG - Intergenic
1067269071 10:44773920-44773942 ACGGCCCGAGGGCCTGGGGAAGG - Intergenic
1067375776 10:45727000-45727022 AAGGCCCGAGGCAGCGGCGCGGG - Intergenic
1067837043 10:49648001-49648023 AAGGCAGGGGACACTGGGGGCGG + Intronic
1067883486 10:50067688-50067710 AAGGCCCGAGGCAGCGGCGCGGG - Intergenic
1069688946 10:70337066-70337088 AAGGCCCAAGGCCCTGGCAGGGG - Intronic
1070792998 10:79200780-79200802 AAAGCCTGAGGGACTGGGGGAGG + Intronic
1072099560 10:92216358-92216380 AGGGCCCGAGGCTCAGGCGGAGG + Intronic
1072695274 10:97598913-97598935 AATGCCCTGGGCCCTGGGGGTGG + Intronic
1072731391 10:97849620-97849642 TAGAGCCGGGGCACTGGGGGTGG + Intergenic
1073994424 10:109299419-109299441 AAGGCTTGAGGCACAAGGGGAGG - Intergenic
1075091525 10:119446586-119446608 AAGGCTCAAGGCACTGGGTTGGG - Intronic
1075578990 10:123602707-123602729 ATGGCCAGAGTCATTGGGGGAGG - Intergenic
1076840744 10:133043973-133043995 AAGGCCCCAGTCCCTGGGGCAGG - Intergenic
1077116172 11:885583-885605 AAGGGCCCAGGCACTGAGGGAGG - Intronic
1077285168 11:1762367-1762389 AAGGCCAGTGGCCCTGGGGGAGG - Intronic
1077380542 11:2235001-2235023 AAGGCCAGAGCTGCTGGGGGCGG - Intergenic
1077400706 11:2355500-2355522 AAGGCCAGTACCACTGGGGGAGG - Intergenic
1077635854 11:3840968-3840990 GAGGCCGGAGGAAGTGGGGGGGG + Exonic
1078528707 11:12120143-12120165 AAGCCCCAAGGCTCTGGGGGAGG - Intronic
1081483145 11:43507287-43507309 TAGGGCCCAGGCACTGGGGCTGG + Intergenic
1081570199 11:44286078-44286100 AAGGCCCCAGGCCCTGGAGCTGG + Intronic
1081779304 11:45699005-45699027 CAGACCCAAGGCCCTGGGGGTGG - Intergenic
1082226765 11:49717222-49717244 AAGGCAGGAGGCAGTGGTGGGGG - Intergenic
1082296372 11:50445350-50445372 AATGTCCGAGGCACAGAGGGGGG - Intergenic
1083199159 11:61109401-61109423 GAGGCCCCAGGCAGTGGCGGTGG - Intronic
1083319790 11:61838648-61838670 AAAGCCAGAGGCAATGGGGGTGG - Intronic
1083674738 11:64319038-64319060 AAGGTCCAAGGCCCTGGGGACGG - Intronic
1084265976 11:68005307-68005329 AGGGCCCGAGGCGCAGGGGCAGG + Intergenic
1084483370 11:69434598-69434620 CAGGCCCCAGGCCCTGGGGAGGG + Intergenic
1084690840 11:70725447-70725469 AAGGCCCCAGGCCCTTTGGGAGG - Intronic
1084841551 11:71855523-71855545 AAGGCCTGAGCCACTGCGGCCGG - Intergenic
1084915979 11:72429446-72429468 AGGGCCTGTGGCACTGGGTGTGG + Intronic
1084939002 11:72602354-72602376 GAGGCCCGAGGCAATGGGCAGGG - Intronic
1085459688 11:76686120-76686142 AGGGCCCAAGGCCCAGGGGGAGG - Intergenic
1086381278 11:86257320-86257342 AAGACCCCAGGCACAGTGGGTGG - Intronic
1086622661 11:88905858-88905880 AAGGCAGGAGGCAGTGGTGGGGG + Intronic
1088808005 11:113369423-113369445 AAGGCACAATGCACGGGGGGTGG - Intronic
1089142327 11:116295816-116295838 AAGACCTGAGGCATTGTGGGAGG + Intergenic
1089554723 11:119310105-119310127 AATGCCCGTGGCTCTGGGTGTGG - Intronic
1089681553 11:120121674-120121696 CAGGCCCTAGGCCCTCGGGGTGG + Intronic
1090351283 11:126110114-126110136 AAAGCCTGAGTCACTGGGAGGGG + Intergenic
1090589125 11:128246501-128246523 AAGGTCCTCGGCAGTGGGGGAGG - Intergenic
1090647456 11:128777239-128777261 GAGCCCCGAGGCCCCGGGGGAGG + Intronic
1091290368 11:134436085-134436107 GAGGGCAGAGGCCCTGGGGGAGG + Intergenic
1091448835 12:560248-560270 AAGGTCAGGAGCACTGGGGGCGG + Intronic
1092883149 12:12903562-12903584 AAGGCCTGAGCCACTGCGGCTGG + Intronic
1092952818 12:13524073-13524095 AATGACTCAGGCACTGGGGGAGG + Intergenic
1093206653 12:16259409-16259431 AAGGAGGGAGGAACTGGGGGAGG - Intronic
1095785695 12:46106637-46106659 AAGGCCCGAGAACCAGGGGGAGG + Intergenic
1096819148 12:54220393-54220415 AAGACAGGAAGCACTGGGGGAGG - Intergenic
1097184573 12:57189701-57189723 GAGGCCAGAGGCACTGGGGTGGG + Intronic
1098250156 12:68560800-68560822 TAGGCCTGTGGCACTGGAGGAGG + Intergenic
1100515030 12:95319347-95319369 CAGGCATGAGCCACTGGGGGTGG - Intergenic
1100539859 12:95548228-95548250 AAGCCCCGGGGCACTTCGGGAGG - Intronic
1100982564 12:100172993-100173015 GAGCCCAGAGGCACTGGGTGGGG + Intergenic
1102678471 12:114674267-114674289 CAGGCCCGAGACACCGGTGGAGG + Exonic
1103148127 12:118613021-118613043 AGGGCCAGAGGCACAGGGGTTGG + Intergenic
1103854692 12:123958460-123958482 AAGGCACGAGGCAGAGGAGGTGG - Intronic
1103926209 12:124424726-124424748 AAAGCCCAGGGCACTGGGGAAGG + Intronic
1105747480 13:23391599-23391621 TAGACCCGAGGGACTAGGGGAGG - Intronic
1110339298 13:74370302-74370324 AAGGGCCGAGGGGCTGGGTGGGG - Intergenic
1111465983 13:88611444-88611466 AAGGGGCGAGGGACTAGGGGAGG - Intergenic
1112047962 13:95616668-95616690 GAGGCCAGAGGCAATGGGGTAGG + Intronic
1113335460 13:109372374-109372396 TTGGCATGAGGCACTGGGGGGGG + Intergenic
1113473774 13:110565099-110565121 AAGGGACAAGGCACTGGGTGAGG - Intergenic
1113846460 13:113394310-113394332 ACCGCACGAGTCACTGGGGGAGG - Intergenic
1114664639 14:24370296-24370318 CGGGCCAGAGGCAATGGGGGTGG - Exonic
1114985684 14:28225878-28225900 AAGGCCTGAGGGACTGGGGCAGG + Intergenic
1117790109 14:59331374-59331396 AAGGGAGGAGGCCCTGGGGGAGG - Exonic
1121267462 14:92613694-92613716 AAGGACAGAGGCACTGAGGGGGG + Intronic
1122131374 14:99605873-99605895 AAGGCCAGTGGGGCTGGGGGTGG + Intergenic
1122807519 14:104267533-104267555 CAGCCCCCGGGCACTGGGGGTGG + Intergenic
1122817180 14:104319536-104319558 GAGGCCAGAGACACTGGGGAGGG - Intergenic
1123449613 15:20351645-20351667 GAGGCCCAAGGCAGTGGGGCTGG + Intergenic
1123469787 15:20541427-20541449 GAGCCCAGAGGCACTGGGGTGGG + Intronic
1123648276 15:22459272-22459294 GAGCCCAGAGGCACTGGGGTGGG - Intronic
1123718569 15:23045797-23045819 CAGGCCAGAGGTGCTGGGGGTGG + Intergenic
1123730065 15:23136413-23136435 GAGCCCAGAGGCACTGGGGTGGG + Intronic
1123748235 15:23333895-23333917 GAGCCCAGAGGCACTGGGGTGGG + Intergenic
1124302099 15:28553865-28553887 GAGCCCAGAGGCACTGGGGTGGG - Intergenic
1124334732 15:28848367-28848389 GAGCCCAGAGGCACTGGGGGGGG + Intergenic
1126328502 15:47507341-47507363 AAGGCCCGGGGGGGTGGGGGGGG - Intronic
1126697972 15:51341685-51341707 ATGGCCCGAGGCGCTGAGGGAGG + Exonic
1127371059 15:58342131-58342153 AAGGTCCGAGCCAGTGGGCGAGG + Intronic
1127500628 15:59550726-59550748 AAGAACAGAGGCACTGGGGTAGG - Intergenic
1128315149 15:66655225-66655247 CAGGCCCCAGGCGCTGCGGGCGG - Intronic
1131336761 15:91556294-91556316 GAGGCCCGAGGCACCTCGGGTGG + Intergenic
1132196660 15:99918841-99918863 AATGCAAGGGGCACTGGGGGTGG - Intergenic
1132227053 15:100150808-100150830 AGGGCCCCAGACACTGGGGCTGG - Intronic
1132373694 15:101314599-101314621 AAGGCCCTGGGCTCTGGGGCTGG + Intronic
1132625287 16:888722-888744 AAGGCCAGAAGCACTGGGGGGGG + Intronic
1132669879 16:1098168-1098190 GAGGTGCCAGGCACTGGGGGAGG + Intergenic
1132701460 16:1223914-1223936 AAGGCCCGGGGTGCTGGGGGTGG + Intronic
1133001408 16:2853354-2853376 AACCCCCGTGGCACAGGGGGTGG + Intronic
1133063202 16:3188647-3188669 AAGGCCCCGGGGTCTGGGGGTGG - Intergenic
1133129350 16:3667013-3667035 AAGGACTGAGTCACTGGGGATGG - Intronic
1133713302 16:8422550-8422572 AGGGCAAGAGGCAATGGGGGAGG - Intergenic
1133746591 16:8691729-8691751 AAGTCCCTTGGCACTGGGCGCGG - Intronic
1133805589 16:9124005-9124027 AAAGCCCAAGGGACTGAGGGTGG - Intergenic
1133924802 16:10183511-10183533 CCAGCGCGAGGCACTGGGGGAGG - Intergenic
1134094534 16:11410974-11410996 CAGGCGCCAGGCACTGGGTGAGG + Intronic
1135932982 16:26755105-26755127 AAAGCCAGAAGCACTGGGGTAGG - Intergenic
1136316181 16:29455739-29455761 AAGGCCAGAGGCACGTGCGGCGG - Exonic
1136334945 16:29605177-29605199 AGGGAAGGAGGCACTGGGGGGGG + Intergenic
1136430758 16:30195081-30195103 AAGGCCAGAGGCACGTGCGGCGG - Exonic
1139691879 16:68646362-68646384 CAGGCCCCAGACGCTGGGGGCGG - Intronic
1140209658 16:72960198-72960220 AAGGGCAGAGGCAAGGGGGGAGG + Intronic
1141227727 16:82134972-82134994 AAGGCGCGAGGCAGTTGAGGTGG - Intergenic
1142175114 16:88641635-88641657 CAGGACAGAGGCTCTGGGGGAGG + Intergenic
1142284391 16:89165789-89165811 GAGGCCTGGGGCACTGAGGGAGG + Intergenic
1142287550 16:89177555-89177577 CAGGCCCGGGGCACAGGGGACGG + Intronic
1142622520 17:1173851-1173873 AAGCCTCGAGGGACTGGGAGAGG - Intronic
1142759668 17:2035248-2035270 CAGGCCTGAATCACTGGGGGAGG - Intronic
1143027848 17:3951561-3951583 CAGGTGGGAGGCACTGGGGGTGG - Exonic
1144947896 17:18979119-18979141 AAGGCCCTGGACACTGTGGGGGG + Intronic
1146522834 17:33539622-33539644 GAGGCCCCAGGCACAGGGGCTGG - Intronic
1147159329 17:38561425-38561447 CAGGCCTCAGGGACTGGGGGTGG - Intronic
1147183118 17:38699327-38699349 AAGGTTCCAGGCACTGGTGGTGG - Intergenic
1147183994 17:38704085-38704107 ACGGGCCGGGGGACTGGGGGTGG - Intergenic
1147616974 17:41835614-41835636 AAGGCCCTAGGTACTGGTGTGGG + Intronic
1147660697 17:42115443-42115465 CAGGCCGGAGGAACTGGGGGGGG - Intronic
1148000702 17:44385464-44385486 AAGGGCTGCGGCGCTGGGGGCGG + Intronic
1148756495 17:49975798-49975820 ATGGCCTGAGGGGCTGGGGGAGG + Intergenic
1150040019 17:61850548-61850570 AAGGCGTGAGCCACTGGGGCCGG - Intronic
1150083366 17:62260920-62260942 AAGACTCAAGGCACTGAGGGAGG + Intergenic
1150213707 17:63455619-63455641 AAGGCCTGAGGAAATGGAGGAGG + Intergenic
1151285388 17:73107454-73107476 AAGGCCCCAGGGAATGGGGAAGG + Intergenic
1151301761 17:73232185-73232207 AAGGCCCGAGGGGGTGGGCGTGG - Exonic
1151669350 17:75563491-75563513 AATCCAGGAGGCACTGGGGGTGG - Intronic
1151850471 17:76686883-76686905 ATGGCAGGAGGCGCTGGGGGTGG + Intronic
1152097005 17:78278323-78278345 GTGGCCTGAGGCCCTGGGGGTGG - Intergenic
1152339019 17:79714246-79714268 GAGGCCCAAGGCAGTGGGGCTGG - Intergenic
1152433676 17:80262752-80262774 AGGGACGGAGGCACTGGGTGGGG - Intronic
1152841894 17:82574718-82574740 AAGGTCTGAGGCACTGGGAAGGG - Intronic
1153515347 18:5895976-5895998 AAAGACCGAGGCACGAGGGGAGG - Intergenic
1154196517 18:12271347-12271369 AAGGCCAGAGGCAGAGGAGGAGG + Intronic
1155038704 18:22046964-22046986 ACGGCACTAGGCACTGGAGGGGG - Intergenic
1156494965 18:37519696-37519718 AAGGCCCAGGCCACTGAGGGGGG - Intronic
1159923029 18:74243377-74243399 GAGGGCCGTGGCACTGGAGGTGG + Intergenic
1160207702 18:76848934-76848956 AAGGCACGAGCCACTGTGCGTGG + Intronic
1160613663 18:80108414-80108436 AAGGTTAGGGGCACTGGGGGAGG + Intergenic
1160679621 19:406774-406796 AAGGCGCGAGGCAGTGTGGAGGG + Exonic
1160789860 19:918391-918413 GAGGCCAGGGGCGCTGGGGGAGG + Intronic
1161455134 19:4366161-4366183 CAGGCCAGGGGCACTGGGGAGGG + Intronic
1161490786 19:4559992-4560014 AAGGCCCGTGGCATGAGGGGAGG - Intergenic
1161849413 19:6730944-6730966 AGGGCCGGCGGCTCTGGGGGTGG - Intronic
1162139531 19:8577480-8577502 AGGGGCCGAGGCCATGGGGGAGG + Exonic
1164771026 19:30809097-30809119 CAAGCCAGAGGCACTGGGGAGGG + Intergenic
1164941077 19:32252592-32252614 AGGGCCAGAGGCACGGGTGGGGG + Intergenic
1165353186 19:35288036-35288058 AAGAACAGAGGCACTGGGCGTGG + Intergenic
1166219602 19:41355957-41355979 AAGTGCCAAGGCCCTGGGGGGGG + Intronic
1166417538 19:42607050-42607072 AGGGCCCAAGTCACTGGGGAGGG + Intronic
1167219270 19:48186919-48186941 AAACCCCCAGTCACTGGGGGTGG + Intronic
1167636533 19:50659100-50659122 CATGCTCGAGGCCCTGGGGGCGG + Exonic
1168313787 19:55474918-55474940 ATGGCCCGAGGCAAGGGGGACGG + Intergenic
925023342 2:588500-588522 CACGGCCGAGGCCCTGGGGGAGG - Intergenic
927679832 2:25132054-25132076 AAGGGGCGGGGCACCGGGGGCGG + Intronic
929576888 2:43057559-43057581 ACGGCCGAAGGCACTAGGGGAGG + Intergenic
931255680 2:60569977-60569999 AAGACCCGAGGCATTGGGGCAGG - Intergenic
932571433 2:72940446-72940468 AAGGCCCAGGGAACTGGGGTGGG + Intergenic
933913380 2:86964014-86964036 CAGGCCCGAGGCACTGTGCCTGG + Intronic
934009616 2:87805884-87805906 CAGGCCCGAGGCACTGTGCCTGG - Intronic
934563970 2:95328221-95328243 AAGGCCAGAGGGGCCGGGGGAGG - Intronic
936093660 2:109516256-109516278 CAGGCCCTGGGCACAGGGGGTGG - Intergenic
936479167 2:112869113-112869135 AAGAACTGAGGAACTGGGGGAGG - Intergenic
936610185 2:113994975-113994997 AAGGCCTGAGGAACTGGGTTGGG + Intergenic
936666493 2:114603057-114603079 AGGGCCCCAGGAACTGGGGATGG - Intronic
938081153 2:128370888-128370910 AAGGCCCGATGCGCAGGTGGCGG + Intergenic
938703120 2:133897083-133897105 ATGGCCCAAGACACTGGAGGGGG - Intergenic
942292636 2:174487243-174487265 GAGGCCCGAGGCTGTGGGTGGGG - Intergenic
946727150 2:222671889-222671911 AAGCCCCGCGGCCCGGGGGGCGG - Intronic
947701989 2:232242347-232242369 AAGGCCTGAGGGAGTGTGGGTGG + Intronic
947792801 2:232877419-232877441 AAGGCCCTGGGGACTGGGGTAGG - Intronic
948825620 2:240572321-240572343 AAGGCAGGAGGCTCTGGGAGGGG - Intronic
948990677 2:241552380-241552402 GAGGCCAGAGGGACTGGGTGGGG - Intergenic
949013778 2:241697790-241697812 AATGCACAAGGCACTGGGCGTGG + Intergenic
1169061066 20:2660672-2660694 GAGGCCCCAGAAACTGGGGGAGG - Intronic
1169285886 20:4306776-4306798 AAGCTCCGAGGCTCTGGGGTGGG + Intergenic
1170056654 20:12212642-12212664 TAGGCCCAATGCACTTGGGGTGG + Intergenic
1172006875 20:31823946-31823968 CAGGCCCTGGGCCCTGGGGGAGG - Intronic
1174400678 20:50274200-50274222 AAGGCCTGAGTCAGTGGGGAAGG - Intergenic
1175839152 20:62015628-62015650 AAGCCACGGGGCACAGGGGGCGG + Intronic
1175854661 20:62113968-62113990 AAGGCCCTGGGCACAAGGGGTGG + Intergenic
1176020132 20:62958568-62958590 ATGGCCCAGGACACTGGGGGAGG - Intronic
1178910183 21:36667803-36667825 AAGCCCCCAGGAATTGGGGGAGG - Intergenic
1179474598 21:41635143-41635165 AAGGCACCAGGCCCTCGGGGCGG + Intergenic
1180196210 21:46195859-46195881 AATGCCTGAGGCACTGGAGTTGG - Intronic
1180226365 21:46394962-46394984 AGGGCCAGGGGCACTGGGGCAGG - Intronic
1180676609 22:17590808-17590830 AAGACCCTGGGCTCTGGGGGAGG - Exonic
1180801952 22:18636098-18636120 GGGGACCGAGGCTCTGGGGGAGG + Intergenic
1180904359 22:19398262-19398284 AAGGAGTGAGGCACTGGGGTCGG - Intronic
1180948638 22:19710378-19710400 GAGCCCCCAGGTACTGGGGGTGG + Intergenic
1181219768 22:21359163-21359185 GGGGACCGAGGCTCTGGGGGAGG - Intergenic
1182585508 22:31342400-31342422 AGGGCACAAGGCAGTGGGGGAGG - Intronic
1183747511 22:39700111-39700133 AAGGCTCCAGGGCCTGGGGGAGG - Intergenic
1184392019 22:44208081-44208103 AAGGCCCCAGGAAGTGGGGCTGG - Exonic
1184512542 22:44942020-44942042 ATGGCCCGAGGCCCAGTGGGGGG + Intronic
1184731060 22:46371347-46371369 GAGGCCAGAGGCACTGGGGTGGG - Intronic
1184947677 22:47815803-47815825 AAGGCAGGAGGCACGGGGAGGGG - Intergenic
1185038329 22:48490827-48490849 GAGGCCCGGGGCTCTGGAGGAGG - Intronic
951227878 3:20142262-20142284 AAGGCTGGAGGCAGAGGGGGAGG - Intronic
952953935 3:38545063-38545085 CAGGCCAGCTGCACTGGGGGTGG + Intergenic
953407374 3:42666082-42666104 GAGGCCCATGGCACTGGGGCAGG + Intergenic
954140297 3:48601502-48601524 AGGGCCCAAGGCACAGGGTGGGG + Intronic
954294146 3:49664891-49664913 AAGGCCCGAGGCACTGGGGGTGG + Intronic
954389307 3:50260479-50260501 AAGGCCCGAGGAACTGGGGCGGG - Intergenic
954426887 3:50448030-50448052 AGGGCTCAAGGCCCTGGGGGAGG - Intronic
961362624 3:126377617-126377639 AAAGACGGAGGCACTGGGGAGGG - Intergenic
968437299 4:600407-600429 CGGGCCCAAGGCACTGGTGGTGG + Intergenic
969218358 4:5741608-5741630 AAGGAGAGAGGCAGTGGGGGAGG + Intronic
969516240 4:7649635-7649657 AAGGCCCTGGGCACTGGGCTTGG + Intronic
969680071 4:8638093-8638115 CAGGCGTGAGCCACTGGGGGTGG - Intergenic
970236811 4:13967043-13967065 CAGGCCAGAGGCAGTGGGAGGGG + Intergenic
975870728 4:78776241-78776263 GACGCCCGGGGCACTGGCGGAGG + Intergenic
976126020 4:81834513-81834535 AAGGTGCGAGGGAGTGGGGGAGG + Intronic
976269750 4:83218907-83218929 CAGGCCTGAGCCACTGCGGGCGG + Intergenic
977983473 4:103354183-103354205 AATGCCCAAGGCACTTGGTGTGG - Intergenic
981660760 4:147164027-147164049 AATGCCCAAGGCACTGCGAGTGG - Intergenic
985712622 5:1438245-1438267 AAGGCTCGTGGCCCTGCGGGCGG - Intronic
992202907 5:74401605-74401627 AAGGCCCCAGGGACTGGTTGGGG - Intergenic
997651890 5:135528109-135528131 AAGGCCAGAGTCACTGGGACAGG + Intergenic
998225550 5:140323615-140323637 AAGGCCTGAGACAATGGGGTTGG + Intergenic
998613081 5:143710598-143710620 CAGGCCAGAGGCACAGGGAGAGG + Intergenic
1001281260 5:170388019-170388041 ATGGCCCTGGGCGCTGGGGGGGG - Intronic
1002333448 5:178461389-178461411 AAAGCTAGAGGCACTGGGGATGG - Intronic
1007622144 6:43221781-43221803 AAGGCGCTGGGCACTAGGGGAGG + Intronic
1007699774 6:43759753-43759775 CTGGCCCCAGGCACTGGGGAGGG - Intergenic
1007714160 6:43844842-43844864 AAAGCCCCAGGCACATGGGGAGG + Intergenic
1008616358 6:53230197-53230219 AATGCCCGAGGCACTGGCCTAGG + Intergenic
1008686363 6:53930082-53930104 AATGCCAGAGGCACTCGGGAAGG + Intronic
1010204478 6:73310140-73310162 AAAGCCCGAGGCACTGTAGCAGG + Exonic
1011128955 6:84034512-84034534 AAGGCACGGGGCACGGGGCGCGG - Intronic
1013173036 6:107654720-107654742 AAGAATCGAGGCTCTGGGGGAGG + Intronic
1013173094 6:107654977-107654999 AAGAATCGAGGCTCTGGGGGAGG + Intronic
1016997384 6:149970064-149970086 AAGGCTCCAGGGACTGAGGGTGG - Exonic
1017340538 6:153316706-153316728 AAGGCACTAGGCATTTGGGGTGG + Intergenic
1017755561 6:157526362-157526384 AAGGCCTCAGGCACTGGGAGTGG - Intronic
1018247325 6:161835540-161835562 AAGGCCCGAGACACTGGCAGCGG + Intronic
1019277776 7:184956-184978 ACAGCCCGAGGAACTGGAGGAGG - Intergenic
1019612883 7:1945833-1945855 AAGTCTGGAGGCAGTGGGGGAGG + Intronic
1021198248 7:17696583-17696605 AAGGCCCGAGGCACTCAGAGAGG + Intergenic
1023362475 7:39430850-39430872 AAGGCCTAAGACACTGGGGAAGG + Intronic
1023880183 7:44313773-44313795 CAGGCCAGAGGCACTGGGGAGGG - Intronic
1025943517 7:66089727-66089749 TAGGTCCCAGGCACTGGGGTGGG + Intronic
1029413896 7:100431174-100431196 AAGGGCCGAGGGAGTTGGGGAGG + Exonic
1031980485 7:128121436-128121458 AAGGCCAGATTTACTGGGGGAGG - Intergenic
1036674735 8:10821112-10821134 AAGGCTTGAGGCTCTGGGCGAGG + Intronic
1036921043 8:12855676-12855698 AAAGGCCAAGGCAGTGGGGGGGG - Intergenic
1037555112 8:20014541-20014563 AAAGCCCTTGGCACTGGGGAGGG + Intergenic
1039053062 8:33512361-33512383 AATGCCGGAGACACTGGGGCAGG - Exonic
1039454596 8:37698388-37698410 CAGGCCCGAGGCCCCGGGGTAGG - Exonic
1040278530 8:46026014-46026036 AAGGCCCAAGTCACTGCTGGGGG + Intergenic
1042035987 8:64534254-64534276 AAGGCCCTAGGCATTGAGGAGGG + Intergenic
1043583228 8:81737390-81737412 AAGGCCGGAAGCACTGGGATAGG - Intronic
1046115585 8:109779648-109779670 AATGCCAGATGCACTGGAGGAGG - Intergenic
1047319699 8:123768183-123768205 AAAGCCGGAGGCACTGGGGTCGG - Intergenic
1049119318 8:140720040-140720062 ACTGTCCCAGGCACTGGGGGTGG + Intronic
1049401086 8:142427669-142427691 AAGAACCGAGGGCCTGGGGGTGG - Intergenic
1051466139 9:17380223-17380245 TAGACCTGAGGCATTGGGGGAGG + Intronic
1052974338 9:34400501-34400523 AAGGCCCAGGGCAGTGGGGACGG - Exonic
1053280756 9:36818651-36818673 AGGGCCAGAGGCACGGTGGGGGG - Intergenic
1053283461 9:36836219-36836241 AAGGTCAGAGGCGCTGGGGACGG - Exonic
1057194305 9:93108245-93108267 AAGCCCTGTGGCACTGGGGTGGG - Intronic
1057883124 9:98808097-98808119 GAGGCCCGGGGCTCTGAGGGCGG - Intronic
1061129787 9:128702547-128702569 AAGGCCAGAGGACCTGGGCGCGG + Exonic
1061202796 9:129147229-129147251 AAGGAGTGAGGAACTGGGGGAGG + Intronic
1061246262 9:129402530-129402552 AAGGCCCGAGGCCGAGGAGGAGG - Intergenic
1061593187 9:131612084-131612106 AAGGCGAGAGGCACTGGACGTGG + Intronic
1061680630 9:132241095-132241117 CAGGACCGAGGCAGTGGGCGGGG + Intronic
1061791599 9:133061956-133061978 AATACCCGAGGCCCAGGGGGAGG + Exonic
1062432499 9:136532324-136532346 AGGCCGCGAGGCACTGGGCGAGG - Intronic
1185653686 X:1667440-1667462 AAGCCCCCAGGAACTGGGAGAGG - Intergenic
1187425572 X:19174805-19174827 AAGGGCCGAGGGAATGTGGGTGG + Intergenic
1189297469 X:39929178-39929200 TATGCCCGGGACACTGGGGGTGG + Intergenic
1190204442 X:48391760-48391782 AAGGTCCGGGGCACTTGGGAGGG + Intronic
1190206094 X:48403643-48403665 AAGGTCCGGGGCACTTGGGAGGG - Intronic
1196418147 X:115495265-115495287 AAGGCCTGAGCCACTGTGGCTGG - Intergenic
1201674041 Y:16559162-16559184 ATGGACTGAGGCAGTGGGGGAGG - Intergenic