ID: 954294148

View in Genome Browser
Species Human (GRCh38)
Location 3:49664893-49664915
Sequence GGCCCGAGGCACTGGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 563
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 525}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294133_954294148 25 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294148 3:49664893-49664915 GGCCCGAGGCACTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 35
4: 525
954294140_954294148 -9 Left 954294140 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 954294148 3:49664893-49664915 GGCCCGAGGCACTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 35
4: 525
954294132_954294148 30 Left 954294132 3:49664840-49664862 CCATGCCCAGCATGGTGAGTACA 0: 1
1: 0
2: 3
3: 24
4: 222
Right 954294148 3:49664893-49664915 GGCCCGAGGCACTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 35
4: 525
954294137_954294148 2 Left 954294137 3:49664868-49664890 CCTGTACCTTGCCTCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954294148 3:49664893-49664915 GGCCCGAGGCACTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 35
4: 525
954294134_954294148 24 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294148 3:49664893-49664915 GGCCCGAGGCACTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 35
4: 525
954294139_954294148 -4 Left 954294139 3:49664874-49664896 CCTTGCCTCTTCTGGGAAAGGCC 0: 1
1: 0
2: 1
3: 21
4: 229
Right 954294148 3:49664893-49664915 GGCCCGAGGCACTGGGGGTGGGG 0: 1
1: 0
2: 2
3: 35
4: 525

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294148 Original CRISPR GGCCCGAGGCACTGGGGGTG GGG Intronic
900181313 1:1312186-1312208 GGCCCAAGGGAGTGGGGGGGGGG + Intronic
900512078 1:3065516-3065538 GGCCTGAGGGGCTGGGGGTAGGG + Intergenic
900521213 1:3106335-3106357 GGGCCGGGGCACTGGGCCTGAGG + Intronic
900720432 1:4172366-4172388 TGACCGAGGCACCGGGGGAGGGG - Intergenic
901088859 1:6628472-6628494 GGGCAGAGGCACGGGGTGTGAGG - Intronic
901511929 1:9721865-9721887 GGCCCAAGGCCCTGGGGGGCGGG + Intronic
901813378 1:11780025-11780047 GGTCGGGGGCACTGCGGGTGAGG + Intronic
901882590 1:12202947-12202969 GGTCTGAGGCACTGGGACTGTGG + Intronic
902332074 1:15735589-15735611 AGCCAGAGGCAGTGGGGGTGGGG + Intergenic
902511061 1:16967393-16967415 GGCCAGAGGCCTTGGGGGCGGGG - Intronic
902783990 1:18721326-18721348 GGTCCCAGGCCTTGGGGGTGGGG - Intronic
902784333 1:18723239-18723261 CCCCCGAGGCCCTGGGGGTGGGG + Intronic
903435081 1:23343764-23343786 GGCCTGAGGGGATGGGGGTGGGG - Intronic
903859759 1:26357478-26357500 CGCCAGGGGGACTGGGGGTGTGG - Intergenic
904236720 1:29121700-29121722 CGCCCGAGCCTCTGCGGGTGCGG - Exonic
904334751 1:29789656-29789678 GGGAAGTGGCACTGGGGGTGGGG + Intergenic
904354034 1:29926949-29926971 TGCCCGAAGCCCTGGGGGAGGGG + Intergenic
906215434 1:44035614-44035636 GACCCGAGGTACTGAGGGTCAGG + Intergenic
906243534 1:44257399-44257421 TGACTGAGGCACTGGGAGTGGGG - Intronic
906919542 1:50048627-50048649 GTCCCGAGGCGCTGGGCGCGCGG + Intronic
907297497 1:53464721-53464743 GGCGGGAGGAACTGGGGCTGCGG - Exonic
907683404 1:56586112-56586134 GGCCCAAGGCACTGTGGTTGTGG - Intronic
910063670 1:83125133-83125155 GGCCCGAGACCCTGGAGGTGAGG + Intergenic
911102503 1:94105633-94105655 GGCCCCAGGAGCTGAGGGTGGGG + Intronic
911674740 1:100646805-100646827 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
915213327 1:154325564-154325586 GGGCCGAGGCCCCGGGGGAGCGG + Intronic
915491302 1:156251367-156251389 GGCCTGAGGTTCTAGGGGTGAGG + Intronic
916594909 1:166234357-166234379 GGCTCAAGGCCCTGGTGGTGTGG + Intergenic
917062489 1:171056031-171056053 GGCCCTAGGCCCCGGTGGTGTGG - Intronic
919565104 1:199174576-199174598 GGCCCTTGGGACTGGGGCTGAGG - Intergenic
919892011 1:201982597-201982619 GGCCCGCGGCGCTCGGGGCGGGG + Intronic
919944155 1:202307650-202307672 GGACCGAGGCAGGGGGGATGAGG - Intronic
919980125 1:202637750-202637772 GGCCCCGGGCACTGAGGGAGGGG - Intronic
920002254 1:202808009-202808031 GGCCCGAGGCGCGGGGGGCGGGG - Intronic
920757600 1:208749102-208749124 AGCCAGCGGCAATGGGGGTGGGG + Intergenic
920868801 1:209775736-209775758 GGTACCAGGCACTGGGGGTGGGG + Exonic
920922713 1:210311486-210311508 GGCCAAAGGCAGTGGGCGTGAGG + Intergenic
921089517 1:211830276-211830298 GGCCCGAGGCGCTGCGCGAGCGG + Intronic
921880804 1:220252727-220252749 GACCCAAGGCCCTGGTGGTGTGG - Intronic
922516086 1:226209336-226209358 AGCCTCAGACACTGGGGGTGCGG + Intergenic
922817870 1:228463845-228463867 GCCAGGAGGCACTGGGGGCGGGG + Intergenic
923380343 1:233411240-233411262 GCTCCAAGGCACTGGGGGGGGGG + Intergenic
923790317 1:237106052-237106074 GGCCAGAGGGGCTGCGGGTGTGG + Intronic
1062877495 10:954631-954653 GACCCGTGGGTCTGGGGGTGCGG + Intergenic
1063956464 10:11272061-11272083 GGCACTGGGCACTGGGGGTGGGG - Intronic
1065073170 10:22048918-22048940 GGCCCATGGCCCTGGGGTTGGGG - Intergenic
1065382563 10:25104271-25104293 GGTCCTAGGCTCTGGGGATGTGG - Intergenic
1067167789 10:43879260-43879282 GGCGAGAGGCACTGTGGGTCTGG - Intergenic
1067219323 10:44332515-44332537 AGCCCTAGGCACTGGGGGATGGG + Intergenic
1067469167 10:46523656-46523678 GCCCTGAGGGACTGTGGGTGTGG - Intergenic
1069581606 10:69570562-69570584 GGCCCCAGGAACTGGTGGAGAGG - Intergenic
1069695348 10:70381970-70381992 GGCTGCAGGCACCGGGGGTGAGG - Intronic
1070537364 10:77389738-77389760 GGCCTGAGGCACTGGGCAGGGGG - Intronic
1071567933 10:86681146-86681168 GGCCCGAGGAAGTGGGTGTAGGG - Intronic
1071695447 10:87864153-87864175 AGCCCGGGCCACGGGGGGTGCGG - Exonic
1072039282 10:91591766-91591788 GGCCCGAGTGACTTGGGTTGGGG + Intergenic
1072090184 10:92119526-92119548 TGCCCTGGGGACTGGGGGTGAGG + Intronic
1073754881 10:106571029-106571051 GGCCAGAGTGACTAGGGGTGGGG - Intergenic
1074428437 10:113372438-113372460 GGCTCAAGGAAATGGGGGTGGGG + Intergenic
1075659276 10:124182168-124182190 GGCCCGAGGCATTGGAGCAGTGG + Intergenic
1075689085 10:124383701-124383723 GGCCAGAGGGGCTGGCGGTGTGG - Intergenic
1076332248 10:129678656-129678678 CGCCCCAGGCACTGAGGGTTTGG - Intronic
1076501294 10:130938219-130938241 GTCCTGAGGCACTGGGGCGGCGG - Intergenic
1076829972 10:132989146-132989168 GGCCCGAGGCCCGGTGGGGGGGG + Intergenic
1076853193 10:133103057-133103079 GGCGCCGGTCACTGGGGGTGGGG + Intronic
1077059333 11:610879-610901 GGCCAGAGGCACTGTGGTTCTGG - Intronic
1077095909 11:799037-799059 GGCCCCAGGCACAGTGGGAGAGG + Exonic
1077152033 11:1076919-1076941 GGACCGAGGCACAGAGGCTGGGG + Intergenic
1077516266 11:3003820-3003842 GGCCCGAGGCACCATGGGGGAGG - Intronic
1078062771 11:8059177-8059199 GGCCGGGGGCACTGGGGCTCAGG + Intronic
1080513892 11:33001872-33001894 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1081621944 11:44623953-44623975 GGCCCAAGGGGCTGGGGCTGGGG + Intergenic
1082090560 11:48085952-48085974 GGCCCAGGGGTCTGGGGGTGGGG + Intronic
1083062819 11:59892142-59892164 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1083516443 11:63263316-63263338 GTCCCAAGGCCCTGGTGGTGTGG + Intronic
1083899955 11:65638700-65638722 GGCCTGTGTCACTAGGGGTGGGG - Intronic
1083933403 11:65857988-65858010 CGCCCGGGGCGCTGGGGGAGGGG + Intronic
1084000345 11:66292396-66292418 ACCCCGCGGCCCTGGGGGTGGGG - Intronic
1084189795 11:67493776-67493798 GGCCCGCGGCACGGAGGCTGTGG - Exonic
1084732722 11:71083723-71083745 GGCCCTGGCCACAGGGGGTGTGG - Intronic
1084939027 11:72602461-72602483 TGCCCGAGGAGGTGGGGGTGTGG - Intronic
1084994608 11:72963868-72963890 GGTCCAAGGCCCTGGGGTTGGGG + Intronic
1085507411 11:77068186-77068208 GTCCCCAGGGTCTGGGGGTGGGG + Intronic
1086417721 11:86605924-86605946 GGCCCATGGGACTTGGGGTGAGG - Intronic
1087881254 11:103418855-103418877 GACCCAAGGCCCTGGTGGTGTGG - Intronic
1087887675 11:103498489-103498511 GCCACCAGGAACTGGGGGTGTGG - Intergenic
1088525188 11:110745465-110745487 GGTCCCAGGCAGTGGTGGTGGGG + Intergenic
1088613678 11:111602579-111602601 GGCCCGAGGCACTTGCAGCGCGG + Exonic
1088808003 11:113369421-113369443 GGCACAATGCACGGGGGGTGGGG - Intronic
1089046437 11:115504825-115504847 GGCCAGATGCACTCGGTGTGCGG - Intronic
1089196165 11:116695053-116695075 ACACCGAGGCCCTGGGGGTGAGG - Intergenic
1089757624 11:120697972-120697994 TTCCCGAGTCTCTGGGGGTGGGG + Intronic
1089833730 11:121351567-121351589 GGGCGGAGGCAGTGGGGGCGAGG - Intergenic
1090572396 11:128061537-128061559 AGCCTCAGGCACTGGAGGTGGGG + Intergenic
1091797541 12:3305853-3305875 GGCCCCAGGCCCAGGGGGTGAGG + Intergenic
1091816970 12:3446076-3446098 TGCCCAAGGAACTGAGGGTGGGG - Intronic
1092124231 12:6064470-6064492 GGCCAGAGGCTCTCGGGTTGAGG - Intronic
1092256427 12:6928554-6928576 GGCCGGGGGCTCAGGGGGTGGGG + Intronic
1092257302 12:6934343-6934365 TGCCCAAGGCACTGGGGCTGAGG + Intronic
1092794376 12:12095515-12095537 GACCTGAGGAACTGGGGATGAGG - Intronic
1094856929 12:34407026-34407048 GGCCCCAGGCACGTGCGGTGGGG - Intergenic
1095960855 12:47833411-47833433 GCTTCGAGGCTCTGGGGGTGGGG + Intergenic
1096121023 12:49089608-49089630 GGGCTGAAGCACTGGGGGAGAGG + Exonic
1097184575 12:57189703-57189725 GGCCAGAGGCACTGGGGTGGGGG + Intronic
1097910688 12:64966079-64966101 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1098201877 12:68064505-68064527 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1100941126 12:99723497-99723519 GGCCGGAGCCACTAGGGGTAGGG + Intronic
1103007720 12:117435441-117435463 GGCTCGGGGCTCTGGGAGTGAGG + Intronic
1103963964 12:124626390-124626412 GGCCTGGGCCCCTGGGGGTGGGG - Intergenic
1104598341 12:130134801-130134823 GGCCTGGGGCCCGGGGGGTGTGG + Intergenic
1104971031 12:132530761-132530783 GGCCTGCTGCACTGGGGATGGGG + Intronic
1105266139 13:18817620-18817642 TGACCAAGGCACTGGAGGTGGGG + Intergenic
1106122325 13:26870862-26870884 GGCCAGAGGGACTGGAGTTGGGG - Intergenic
1106457140 13:29937407-29937429 TGCCCGAGGCTGTGGGGTTGGGG - Intergenic
1111259967 13:85724549-85724571 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
1112185744 13:97126306-97126328 GGCCTCAGGCGCTGAGGGTGTGG + Intergenic
1112268233 13:97945594-97945616 GGCCAGTGGAGCTGGGGGTGGGG - Intergenic
1113810828 13:113141454-113141476 GGCCCGAGGAACTGGAGCTAAGG + Intronic
1113892336 13:113743073-113743095 GGCAGGAGGAATTGGGGGTGTGG - Intergenic
1114032822 14:18590710-18590732 GGCCAGAGGCATCTGGGGTGAGG - Intergenic
1114077610 14:19169757-19169779 GGCCAGAGGCATCTGGGGTGAGG - Intergenic
1114084554 14:19229826-19229848 GGCCAGAGGCATCTGGGGTGAGG + Intergenic
1114644795 14:24249387-24249409 GGCCCCAGCCCCTGGGGATGGGG - Exonic
1115174614 14:30547797-30547819 GGCCGGAGGCTCTGAGTGTGGGG + Intergenic
1115658633 14:35468084-35468106 AGGCTGAGGCAGTGGGGGTGGGG + Intergenic
1115993332 14:39171489-39171511 AGGCCGAGGCACGGGGGGTGGGG + Intergenic
1118892801 14:69923884-69923906 GGCCTGAGCCACTGGTGGGGTGG + Intronic
1119046033 14:71320133-71320155 TGCCCGGCGCACTGGCGGTGGGG - Intergenic
1119856501 14:77904951-77904973 GGCAGGAGGACCTGGGGGTGTGG - Intronic
1121613773 14:95299209-95299231 GGCCTGCGGCAGTGGTGGTGGGG - Intronic
1122504397 14:102222411-102222433 GCTCCGAGGGACTGGGTGTGCGG + Intronic
1122793354 14:104193640-104193662 GGGTGGAGGCACTGAGGGTGAGG - Intergenic
1122843224 14:104476838-104476860 GGACTGAGGCACCTGGGGTGGGG + Intronic
1122843256 14:104476951-104476973 GGACTGAGGCACCTGGGGTGGGG + Intronic
1122843288 14:104477064-104477086 GGACTGAGGCACCTGGGGTGGGG + Intronic
1202896151 14_GL000194v1_random:11658-11680 GGCCAGAGGCATCTGGGGTGAGG + Intergenic
1123449615 15:20351647-20351669 GGCCCAAGGCAGTGGGGCTGGGG + Intergenic
1123469789 15:20541429-20541451 GCCCAGAGGCACTGGGGTGGGGG + Intronic
1123648274 15:22459270-22459292 GCCCAGAGGCACTGGGGTGGGGG - Intronic
1123667286 15:22617580-22617602 AGCCCAAGGCACCGGGGTTGGGG + Intergenic
1123719200 15:23048009-23048031 GGCCGGAGGTGCTGGGGGTTGGG + Intergenic
1123730067 15:23136415-23136437 GCCCAGAGGCACTGGGGTGGGGG + Intronic
1123748237 15:23333897-23333919 GCCCAGAGGCACTGGGGTGGGGG + Intergenic
1124302097 15:28553863-28553885 GCCCAGAGGCACTGGGGTGGGGG - Intergenic
1124321127 15:28712147-28712169 AGCCCAAGGCACCGGGGTTGGGG + Intronic
1124495739 15:30185795-30185817 GGCCCCGGGCACTGAGGGAGGGG - Intergenic
1124522224 15:30413986-30414008 AGCCCAAGGCACCGGGGTTGGGG + Intronic
1124536441 15:30552232-30552254 AGCCCAAGGCACCGGGGTTGGGG - Intronic
1124747834 15:32352851-32352873 GGCCCCGGGCACTGAGGGAGGGG + Intergenic
1124762210 15:32455360-32455382 AGCCCAAGGCACCGGGGTTGGGG + Intronic
1124776419 15:32593708-32593730 AGCCCAAGGCACCGGGGTTGGGG - Intronic
1125672507 15:41484328-41484350 AGCCTCAGGCACTGGGGATGGGG - Intergenic
1125717605 15:41828001-41828023 GGGGCGAGGGTCTGGGGGTGTGG + Intergenic
1127012051 15:54641971-54641993 GACCCAAGGCTCTGGTGGTGTGG - Intergenic
1127234670 15:57036050-57036072 GGCACCAGGAGCTGGGGGTGGGG - Intronic
1128094251 15:64941922-64941944 GTACCTAGGTACTGGGGGTGGGG + Intronic
1129235918 15:74223640-74223662 GGCCTGAGGCCCAGAGGGTGGGG - Intergenic
1129384565 15:75188804-75188826 AGCACATGGCACTGGGGGTGTGG + Intergenic
1130115230 15:81000707-81000729 GGGCCGAGAGACTGGGGGAGCGG - Intergenic
1131118029 15:89806286-89806308 GGCCCCTGTCATTGGGGGTGAGG + Exonic
1132227051 15:100150806-100150828 GGCCCCAGACACTGGGGCTGGGG - Intronic
1132406480 15:101544298-101544320 GGCCCGTGACACTGGGGGACTGG - Intergenic
1132668398 16:1092118-1092140 GGCCTGTGGTACTGGGTGTGCGG - Intronic
1132669881 16:1098170-1098192 GGTGCCAGGCACTGGGGGAGGGG + Intergenic
1132674085 16:1114538-1114560 GGCCTGAGCCACTGGGGGCAGGG + Intergenic
1132678687 16:1130963-1130985 GGCCAGATGCAGTGGAGGTGGGG + Intergenic
1133063200 16:3188645-3188667 GGCCCCGGGGTCTGGGGGTGGGG - Intergenic
1133090674 16:3401430-3401452 GGCCGGAGCCACTGGGCCTGCGG + Exonic
1133229066 16:4357943-4357965 GCACCGAGGGACTGGGTGTGGGG - Intronic
1133287715 16:4698282-4698304 GGCCTGATGAAATGGGGGTGGGG + Intronic
1135375558 16:21944048-21944070 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1136395102 16:29988228-29988250 GGCCTGAGTCAATGAGGGTGAGG - Exonic
1136455758 16:30378824-30378846 GGCCGGAGGCAAAGCGGGTGGGG + Intronic
1136762031 16:32741469-32741491 GGCGGGAGGCACAAGGGGTGGGG + Intergenic
1136806069 16:33128919-33128941 GGCGGGAGGCACAAGGGGTGGGG - Intergenic
1137268065 16:46884757-46884779 GGCCCCAGGAGCTGGGGGTCCGG - Exonic
1137565880 16:49532285-49532307 AGCCCCTGGCACTGGGGGTCGGG - Intronic
1137670649 16:50276312-50276334 AGCCAGCAGCACTGGGGGTGAGG - Intronic
1138092823 16:54190487-54190509 GTCCCCATGGACTGGGGGTGGGG + Intergenic
1138248610 16:55485354-55485376 CGCCCCAGGCACTGGTGTTGGGG + Exonic
1138505208 16:57475069-57475091 GGGCCCTGGCCCTGGGGGTGGGG - Intronic
1139691877 16:68646360-68646382 GGCCCCAGACGCTGGGGGCGGGG - Intronic
1140927605 16:79599254-79599276 GGCCGGTGGCGCTGGGGGCGCGG - Exonic
1140939494 16:79708149-79708171 GGCTGGAGGCCCTGGCGGTGTGG + Intergenic
1141278087 16:82606113-82606135 GGACCGGGCCTCTGGGGGTGAGG + Intergenic
1141841665 16:86577761-86577783 GGCCTAAGGCACTGGGGGCCTGG - Intronic
1142004955 16:87685292-87685314 TGCCCAAGGCGGTGGGGGTGCGG - Intronic
1142175116 16:88641637-88641659 GGACAGAGGCTCTGGGGGAGGGG + Intergenic
1142287552 16:89177557-89177579 GGCCCGGGGCACAGGGGACGGGG + Intronic
1142493489 17:293468-293490 GGGCCGGGGCTCCGGGGGTGGGG + Intronic
1142567115 17:847561-847583 GGTCCGTGGCAGTGGGGCTGAGG - Intronic
1142759666 17:2035246-2035268 GGCCTGAATCACTGGGGGAGGGG - Intronic
1143786334 17:9258540-9258562 GAAACCAGGCACTGGGGGTGTGG + Intronic
1143953805 17:10653610-10653632 GACCTCAGGCACAGGGGGTGGGG + Intronic
1144834542 17:18150133-18150155 TGCCAGGGGCAGTGGGGGTGGGG - Intronic
1144940640 17:18937579-18937601 GGCCCGTGGTCCTGGGGGTTGGG + Intergenic
1145200293 17:20938689-20938711 GGGCCGAGGCACAGGGAGAGAGG + Intergenic
1145261163 17:21355636-21355658 GGCCTGAGGCTCTGGAGGGGTGG - Intergenic
1146339545 17:32007495-32007517 GGCCCGAGGGGCTGGGCGGGAGG - Intergenic
1146693616 17:34893000-34893022 GGCCAGTTGCACTGAGGGTGAGG - Intergenic
1147159327 17:38561423-38561445 GGCCTCAGGGACTGGGGGTGGGG - Intronic
1147989309 17:44323493-44323515 GGCCTCAGGCACCGGGGCTGTGG - Exonic
1148049245 17:44761012-44761034 GCCCGCAGTCACTGGGGGTGGGG + Intronic
1148484506 17:47982045-47982067 GGCCAGAAGCCCTGGGGGAGCGG + Intergenic
1148562126 17:48612179-48612201 GCCCAGGGGCGCTGGGGGTGAGG - Intronic
1148756497 17:49975800-49975822 GGCCTGAGGGGCTGGGGGAGGGG + Intergenic
1150747309 17:67825976-67825998 GGCCCGGGGCGCTGGTGCTGGGG - Exonic
1151164631 17:72193156-72193178 GGCTGGAGGCACTGTGTGTGTGG - Intergenic
1151850473 17:76686885-76686907 GGCAGGAGGCGCTGGGGGTGGGG + Intronic
1151990528 17:77571293-77571315 GGCTAGGGGCAGTGGGGGTGGGG - Intergenic
1152078407 17:78172098-78172120 GGGCACAGGCACTTGGGGTGTGG - Exonic
1152260401 17:79263646-79263668 GGCTCGGGGCAGAGGGGGTGTGG - Intronic
1152337537 17:79707042-79707064 GGCCCAAGGCAGTGGAGGTCTGG - Intergenic
1152339017 17:79714244-79714266 GGCCCAAGGCAGTGGGGCTGGGG - Intergenic
1152544104 17:80992147-80992169 GGCCCGAGGCCCCGCGGGCGAGG - Intronic
1152748963 17:82053796-82053818 GGCCCCAGGCCCTGAGGGTCAGG - Intronic
1152863616 17:82709696-82709718 GGCCGGAGGAGCTGGGGGTGAGG + Intergenic
1153219387 18:2847969-2847991 GGGCCGGGGCGGTGGGGGTGGGG + Intronic
1153932978 18:9895333-9895355 GGCCCCACCCACTGGGGTTGAGG - Intergenic
1154422272 18:14243857-14243879 TGACCAAGGCACTGGAGGTGGGG - Intergenic
1155479750 18:26272395-26272417 CGCCCGCGGCACAGGGGTTGGGG + Intronic
1156250222 18:35345247-35345269 GGCGCCAGGGTCTGGGGGTGCGG - Intronic
1156489133 18:37485975-37485997 GGCTAGAGGTGCTGGGGGTGAGG - Intronic
1156519127 18:37706504-37706526 GGCTTGAGGCAATGGGGGTGGGG + Intergenic
1156664520 18:39389807-39389829 GACCCTAGGCCCTGGTGGTGTGG - Intergenic
1157243608 18:46034184-46034206 GTCCTGAGGCACCGGGGCTGTGG + Intronic
1157697999 18:49738962-49738984 AGCCCTGGGAACTGGGGGTGGGG + Intergenic
1158677026 18:59529468-59529490 GACCCAAGGCCCTGGTGGTGTGG + Intronic
1158729233 18:60004072-60004094 GGCGCTAGGCCCTGGAGGTGTGG + Intergenic
1160178661 18:76615941-76615963 GGCCCAAGGCTGTGGGGGAGAGG + Intergenic
1160744416 19:704010-704032 AGGCCGAGGCACAGGGGGCGGGG + Intergenic
1160781037 19:878086-878108 GGCACGTGGCGCTGGGGCTGGGG - Intronic
1160781080 19:878242-878264 GGCCCGTGGGGCTGGGGCTGGGG - Intronic
1160789862 19:918393-918415 GGCCAGGGGCGCTGGGGGAGGGG + Intronic
1160869572 19:1271052-1271074 GGCCCGCGGCCCTGGGCGGGGGG + Intronic
1160965951 19:1747044-1747066 GGCCCGAGGGACTGGGCGGCGGG - Intergenic
1161210227 19:3062063-3062085 GGCCGGAGGCACCGGGCCTGGGG + Intronic
1161280486 19:3442944-3442966 GGCCAGTGTCCCTGGGGGTGGGG - Intronic
1161567777 19:5013050-5013072 GGCTGGAGGCTCTGGGGCTGAGG - Intronic
1161575478 19:5052340-5052362 TGCTCCAGACACTGGGGGTGGGG + Intronic
1161589120 19:5120852-5120874 GGCCTCAGGCACTGTGGCTGGGG - Intronic
1161697215 19:5776112-5776134 GGCCCTAGGGACTGGGGAGGGGG - Intronic
1161716757 19:5880595-5880617 GCCCTGTGTCACTGGGGGTGAGG - Intronic
1162421050 19:10566207-10566229 TGCCCGGAGCACAGGGGGTGGGG - Intergenic
1162475372 19:10896435-10896457 GGCAGGAGGCAATGGGGATGGGG - Intronic
1162833719 19:13302886-13302908 ACCTCGAGGCACTGGAGGTGGGG + Intronic
1163344214 19:16729639-16729661 GGGCCGAGGCACCTGAGGTGAGG + Intronic
1163370241 19:16897404-16897426 GGGCCGAGCCAGTGAGGGTGTGG - Intronic
1163425083 19:17236490-17236512 GTCCCCAGGAGCTGGGGGTGGGG - Intronic
1163446776 19:17351647-17351669 GGGTCCAGGCACTGGGGGTGAGG + Exonic
1163478372 19:17539964-17539986 TGGTCGAGGCACTGGGGGCGGGG + Intronic
1163849882 19:19656791-19656813 GGCCAGAGGCCCTGAGGCTGGGG + Intronic
1164028874 19:21381932-21381954 GGCCTGAGGCACTGGGGCATTGG - Intergenic
1165333445 19:35154118-35154140 GGCCTGAGGCCCTGGGTCTGGGG - Exonic
1165712283 19:38020568-38020590 GGCCCCAGGCTCAGGGGCTGCGG - Intronic
1165743539 19:38217412-38217434 GGCCAGGGGCCCTGGGAGTGGGG - Intronic
1165830663 19:38728777-38728799 GGCCTGGGGCACTGGGGGCTTGG + Intronic
1165900781 19:39168335-39168357 GGCCCGGGGCAGCTGGGGTGGGG + Intronic
1165925008 19:39321107-39321129 GGCCGGCGGGGCTGGGGGTGGGG - Intergenic
1166059750 19:40318803-40318825 TGTCCCAGGCACTGGGGATGGGG - Intergenic
1166304278 19:41928734-41928756 GGACTGAGGGAGTGGGGGTGGGG + Intronic
1166743080 19:45125982-45126004 AGCCTGGGGCACAGGGGGTGTGG - Intronic
1166743800 19:45130328-45130350 GACCGGAGCCACTGGGGGCGAGG - Intronic
1166773667 19:45299696-45299718 GCCCGGAGGGACTGGGGTTGAGG + Intronic
1166777927 19:45323662-45323684 GACCCGAGGCGCTGGGTATGGGG + Intergenic
1166809577 19:45507418-45507440 GGCGCGGGGCATTGTGGGTGCGG + Exonic
1167019182 19:46861344-46861366 GGCCCGGGGGGCTGGGGGGGGGG - Intergenic
1167219272 19:48186921-48186943 ACCCCCAGTCACTGGGGGTGGGG + Intronic
1167645455 19:50703024-50703046 GTCCCGAGGAAGTGGGGGAGAGG - Intronic
1167741370 19:51326629-51326651 TGCCCGGGTCAATGGGGGTGGGG - Intronic
1168307260 19:55442404-55442426 CGCCGGGGGCGCTGGGGGTGCGG - Exonic
1168326523 19:55541320-55541342 GGGCAGAGGCACTGGTGGGGCGG + Exonic
1168721855 19:58558658-58558680 GGCCCCGGGCAGTGGGGGCGGGG - Exonic
925025051 2:601031-601053 GGCCTGAGGCACTGGGCATGTGG + Intergenic
925069717 2:956568-956590 GGGCCGGGGCCCTGGGGGAGCGG - Intronic
925126566 2:1461415-1461437 GGCCCTAGGCACTGTGGCTATGG + Intronic
926170610 2:10550570-10550592 GGCCCCAGGCACTGGGGAGCTGG + Intergenic
927545024 2:23944714-23944736 TGCCCTGGGGACTGGGGGTGAGG + Intronic
927600378 2:24435293-24435315 GTCCCACGGAACTGGGGGTGAGG + Intergenic
927864122 2:26577855-26577877 GGCCAGATGCACTGGGAGTTTGG + Intronic
927928158 2:27027121-27027143 TGCCCGAGGGGCAGGGGGTGGGG - Exonic
927971047 2:27306577-27306599 GGCCTGAGGGGCTTGGGGTGGGG + Intronic
928373379 2:30757125-30757147 CGCCCGTGGGGCTGGGGGTGGGG - Intronic
929195405 2:39179715-39179737 GAATCGAGGCACTGGAGGTGGGG + Intronic
929576890 2:43057561-43057583 GGCCGAAGGCACTAGGGGAGGGG + Intergenic
930025920 2:47029098-47029120 AGCCCCAGGCACTGGGGGCAGGG - Intronic
932419427 2:71592710-71592732 GGTCAGAGGCACTGGGAGAGTGG - Intronic
933346507 2:81092761-81092783 GCCACCAGACACTGGGGGTGGGG - Intergenic
933720385 2:85393977-85393999 GTCCAGAGGACCTGGGGGTGAGG + Intergenic
934556605 2:95289881-95289903 GGCCCAAGGCCCTGGGGCAGTGG - Exonic
934923729 2:98366862-98366884 GACCCAAGGCCCTGGTGGTGTGG + Intronic
935593415 2:104861983-104862005 GGCTGGAGGAGCTGGGGGTGGGG + Intergenic
935952692 2:108345344-108345366 GTCCCAAGGCCCTGGTGGTGTGG + Intergenic
936006370 2:108892481-108892503 GCCCAGAGGCACTGGGACTGAGG - Intergenic
937122336 2:119449572-119449594 GGCACTGGGCACTGGGGTTGGGG - Intronic
937221594 2:120345611-120345633 GGCGCGAGGCAGTGAGGGCGAGG + Intergenic
937226880 2:120375319-120375341 GGGCCTGGGGACTGGGGGTGGGG - Intergenic
937305052 2:120865936-120865958 GGCCCCAGGCACAGGGTGTTGGG - Intronic
937884415 2:126890147-126890169 GGCCAGGGGCATTGGGGATGAGG + Intergenic
938104171 2:128519188-128519210 GGCCCGAGGCACCGGGGCATCGG - Intergenic
938492034 2:131766284-131766306 GGCCAGAGGCATCTGGGGTGAGG - Intronic
938495533 2:131796059-131796081 GGCCAGAGGCATCTGGGGTGAGG + Intronic
939968464 2:148634411-148634433 TGCCACAGGCACTGGTGGTGTGG + Intergenic
940004473 2:148998517-148998539 GGCCCAGGGCACCAGGGGTGTGG + Intronic
940057214 2:149525810-149525832 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
941086218 2:161121441-161121463 GCACCCAGGCACTGGGGGTTGGG + Intergenic
942444427 2:176068560-176068582 GGCCCGAGGTTCTGGAGGCGGGG - Intergenic
943349912 2:186785239-186785261 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
943960162 2:194254212-194254234 GGGCCGAGGCAGTAGGGGTCTGG - Intergenic
944439447 2:199727385-199727407 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
946391259 2:219418252-219418274 GGCCCGTGGCCGTGGGGGCGGGG - Intergenic
946416921 2:219544308-219544330 GGCCCGAGGGGCCGGGGTTGCGG - Exonic
946456441 2:219830471-219830493 AGCCAGAAGCTCTGGGGGTGGGG - Intergenic
946958494 2:224957919-224957941 GGCCCAAGGAATTGGGGATGAGG + Intronic
947701991 2:232242349-232242371 GGCCTGAGGGAGTGTGGGTGGGG + Intronic
948822629 2:240557749-240557771 GGGCCGAGGGGCTGGGGGCGTGG - Intronic
949032706 2:241804515-241804537 GGTCCTGGGCACTGGGGCTGTGG + Intergenic
1169345135 20:4823274-4823296 GGCGCGGGGCACTGGGAGCGAGG - Intronic
1171119677 20:22557729-22557751 AGCCCCAAGCCCTGGGGGTGGGG - Intergenic
1172201085 20:33126384-33126406 GGCCAGAGGAGGTGGGGGTGAGG + Intergenic
1172443738 20:34982387-34982409 GGGGTGAGGCATTGGGGGTGGGG + Intronic
1172840949 20:37902711-37902733 GGCCAGTGGGGCTGGGGGTGAGG - Intergenic
1172876067 20:38165131-38165153 GCCCCGGGGCATTGGGGGTCAGG - Intronic
1172944096 20:38674561-38674583 GCCCCGGGGCTCTGGGGGCGGGG - Intergenic
1173322561 20:42001447-42001469 GGCACTAGGCACTGTGAGTGAGG + Intergenic
1173383971 20:42571749-42571771 GCCCCGGGGCAGTGGGGGTTGGG - Intronic
1174144385 20:48440944-48440966 GGCCCGTGGCCCAGGGGTTGGGG - Intergenic
1174167061 20:48592580-48592602 GGCCCGTGGCCCAGGGGCTGGGG + Intergenic
1174525602 20:51168142-51168164 GCCCCTGAGCACTGGGGGTGAGG - Intergenic
1174747757 20:53080770-53080792 GGCCCGCGGCCCAGGGGCTGGGG + Intronic
1175821808 20:61914076-61914098 GGCAGGAGGCACAGGTGGTGGGG - Intronic
1175961980 20:62642062-62642084 GGCCCGCGGCAGAGGGGCTGGGG - Exonic
1176135631 20:63520927-63520949 GGCCCGAGGGGCGGGGGGCGAGG + Intronic
1176615831 21:9027641-9027663 GGCCAGAGGCATCTGGGGTGAGG + Intergenic
1176851208 21:13916092-13916114 TGACCAAGGCACTGGAGGTGGGG + Intergenic
1178673991 21:34615239-34615261 GGCCCTAGGGGCTGGGGGGGCGG - Intergenic
1179337712 21:40473663-40473685 ATCCCGAGGTACTGGGGGTTGGG - Intronic
1179364109 21:40739658-40739680 ATCCCGAGGTACTGGGGGTTAGG + Intronic
1179440142 21:41387886-41387908 GGCCTGAGCCACTGGGAGGGTGG - Intronic
1179545394 21:42109739-42109761 TGCCCGAGAATCTGGGGGTGGGG + Intronic
1179574580 21:42299782-42299804 TGTCCCAGGCCCTGGGGGTGAGG + Intergenic
1180005513 21:45018893-45018915 GGGCCGGGGCCCTGCGGGTGGGG - Intergenic
1180293416 22:10863375-10863397 GGCCAGAGGCATCTGGGGTGAGG - Intergenic
1180456937 22:15517766-15517788 GGCCAGAGGCATCTGGGGTGAGG - Intergenic
1180496222 22:15892791-15892813 GGCCAGAGGCATCTGGGGTGAGG - Intergenic
1180650286 22:17370488-17370510 GGCGCGGGGCTCTGGAGGTGTGG + Intronic
1180842197 22:18964680-18964702 AGCCCGGGGCCCTCGGGGTGTGG - Intergenic
1181013683 22:20056471-20056493 GGCTCGAGGCCCTGAGGATGGGG - Intronic
1181044427 22:20207829-20207851 GGTCCCAGGAGCTGGGGGTGGGG + Intergenic
1181465046 22:23106450-23106472 GGGCCCTGGCACTGTGGGTGGGG + Intronic
1182556974 22:31134405-31134427 GGCCTGGGGCCCTGAGGGTGGGG + Exonic
1182696371 22:32201821-32201843 GGCCTGTGTCACTGTGGGTGGGG + Intronic
1182984132 22:34700500-34700522 GGCTCAAGGAACAGGGGGTGGGG + Intergenic
1183038317 22:35157187-35157209 GGTCAGAAGCACTGAGGGTGGGG + Intergenic
1183343822 22:37296082-37296104 GGCCCGGGCCACAGGGTGTGGGG + Intronic
1183562467 22:38586377-38586399 GGATGGAGGCACTGGGGATGTGG - Intronic
1183734366 22:39635706-39635728 GGCCTGGGGCAGTGGGGCTGGGG + Intronic
1184519130 22:44982045-44982067 GCCCCGAGGGAACGGGGGTGTGG + Intronic
1184695743 22:46138175-46138197 AGCAAGAGGCACTGGGGCTGAGG + Intergenic
1184731058 22:46371345-46371367 GGCCAGAGGCACTGGGGTGGGGG - Intronic
1184775240 22:46619827-46619849 GGCCCACTGCAGTGGGGGTGGGG + Intronic
1184955141 22:47880991-47881013 TGCAGGAGGCACTAGGGGTGTGG + Intergenic
1185319933 22:50195999-50196021 GGCCCCAGGCTCTGGTGGGGAGG - Intronic
950480365 3:13239859-13239881 GCCCCGAGGGGCTGCGGGTGGGG + Intergenic
950527468 3:13532835-13532857 GGCCTGAGGCACCAGGGATGGGG + Intergenic
950790727 3:15469731-15469753 AGGCCTAGGCACTGGGGATGAGG + Intronic
952374657 3:32755972-32755994 GACTCGAGGAAGTGGGGGTGGGG + Intronic
952673766 3:36001357-36001379 GACCCGAGGCCCTGATGGTGTGG + Intergenic
952934294 3:38383655-38383677 GGTCCCAGCTACTGGGGGTGGGG + Intronic
953326241 3:42014139-42014161 GGCCCGAGGCGCAGGCGGCGCGG - Intronic
954294148 3:49664893-49664915 GGCCCGAGGCACTGGGGGTGGGG + Intronic
954392484 3:50274941-50274963 GTCCCGGGCGACTGGGGGTGAGG - Intronic
954766038 3:52917569-52917591 GGTCCGTGGCCCTGGGGTTGGGG - Intronic
954779089 3:53046106-53046128 GGACCGCGGAGCTGGGGGTGGGG - Intronic
955484062 3:59417991-59418013 GGACCTGGGCAATGGGGGTGTGG + Intergenic
957690228 3:83556777-83556799 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
958817010 3:98927805-98927827 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
959504191 3:107139941-107139963 GGACAGTGGCAGTGGGGGTGGGG - Intergenic
960534313 3:118799879-118799901 GACCTGAGGCATTTGGGGTGTGG - Intergenic
961017366 3:123478625-123478647 GTCCAGTGGCACTGGAGGTGTGG - Intergenic
962950692 3:140215960-140215982 GGCCCGAGGCCCCAGGGGTTGGG - Intronic
964339255 3:155690955-155690977 GGGCTGAGGAACTAGGGGTGAGG - Intronic
965597375 3:170422059-170422081 TGCCCAGGGCACTGTGGGTGAGG + Intronic
965909433 3:173753386-173753408 GGCCCGAGCCACTGGAAGTTTGG - Intronic
966182292 3:177197851-177197873 GGCCCGCGGCGGTGGGGGCGGGG - Intergenic
967078629 3:186028035-186028057 GGCCCCACGCACTGGGGGTTAGG - Intergenic
967316193 3:188154039-188154061 GGCCCGGGGCGCGGGGCGTGGGG + Intronic
967817705 3:193813282-193813304 GGTCTGAGGTAGTGGGGGTGAGG - Intergenic
968007656 3:195254196-195254218 GGTCCCAGGCCCTGGGGCTGAGG - Intronic
968437301 4:600409-600431 GGCCCAAGGCACTGGTGGTGGGG + Intergenic
968441784 4:627976-627998 CGGCCATGGCACTGGGGGTGGGG - Intronic
968505435 4:969065-969087 GTCCCCAGGACCTGGGGGTGTGG - Intronic
968512528 4:1001920-1001942 GGCCCGGGGCACAGCGGCTGAGG - Intronic
968534455 4:1114081-1114103 GGCGTGAGGCGGTGGGGGTGGGG + Intergenic
968615358 4:1575286-1575308 GGCCAGAGAGACTTGGGGTGTGG - Intergenic
968756229 4:2417826-2417848 GGCCCAGGACAATGGGGGTGGGG + Intronic
968804511 4:2763652-2763674 GTCCCGGGGCACTGGAGCTGCGG - Intergenic
968921427 4:3524102-3524124 GGCCCGTGGGACTGGGGTTGGGG - Intronic
968975747 4:3821284-3821306 GGGCAGAGGCACCGGGCGTGGGG + Intergenic
969378215 4:6777230-6777252 GGTCAGAGGCACCGGGGATGTGG - Intergenic
969437234 4:7195049-7195071 GGGATGGGGCACTGGGGGTGGGG + Intronic
969502057 4:7559216-7559238 AGCCCGAGGCACTGCGGGCACGG - Intronic
969668872 4:8578631-8578653 GGCCAGAAGCACTGGGGCTTTGG + Intronic
975629874 4:76388767-76388789 GCCACGTGGAACTGGGGGTGTGG - Intronic
975633152 4:76421510-76421532 GGCCCGAGGCGCTCGGGTGGGGG - Intronic
976078054 4:81321491-81321513 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
980107500 4:128601567-128601589 GACCCAAGCCACGGGGGGTGAGG + Intergenic
980503127 4:133682514-133682536 GCCCAGTGGCACTGGGGCTGAGG - Intergenic
984697546 4:182794474-182794496 GTCCTGAGGCAATGGTGGTGAGG - Intronic
985809955 5:2075567-2075589 GGTCCAAGGCTGTGGGGGTGGGG + Intergenic
985820755 5:2158493-2158515 GGCCCTGGGCACTGTGGGTCAGG + Intergenic
985851414 5:2391439-2391461 GGCCCAAGGAAATGAGGGTGAGG - Intergenic
989698402 5:44232061-44232083 GGGCAGTGGCAGTGGGGGTGGGG + Intergenic
992484254 5:77180337-77180359 GGCACGAGGCCCGGGGAGTGGGG + Intergenic
993587383 5:89747315-89747337 GACCCTAGGCCCTGGTGGTGTGG + Intergenic
993837714 5:92835423-92835445 GCCCCAAGGCACTGGTGGCGTGG + Intergenic
995052160 5:107719277-107719299 GACCCAAGGCTCTGGTGGTGTGG - Intergenic
995264134 5:110138717-110138739 GGCCTGAGCCACAGGGGGAGAGG - Intergenic
997722233 5:136088502-136088524 GCCCTGAGGCTCTGGGGCTGGGG + Intergenic
998226779 5:140333223-140333245 GGCCTGGGGCCATGGGGGTGAGG + Exonic
999596846 5:153214597-153214619 GACCCTAGGCCCTGGTGGTGTGG - Intergenic
1001335967 5:170796938-170796960 GGCCCCAGGCACTGTGGCTTTGG - Intronic
1001572130 5:172736834-172736856 TGCCAGAGTCACTGGGGGTGGGG - Intergenic
1001584737 5:172826189-172826211 GGCCCAAGTCAGTGGGAGTGGGG - Intergenic
1001639927 5:173236934-173236956 GGCCCCAGGTCCTGGGAGTGTGG - Intergenic
1002043966 5:176531971-176531993 GGCCAGGGGCACAGGGGATGGGG + Intronic
1002756817 6:168875-168897 TGACCAAGGCACTGGAGGTGGGG + Intergenic
1003112960 6:3264351-3264373 GGCCACAGGCACTGGGGCTGGGG - Intronic
1003849817 6:10210066-10210088 GGCCCGAAGTACTGGGCATGGGG - Intronic
1004311955 6:14553808-14553830 GGCCCGTGGCCCAGGGGTTGGGG + Intergenic
1005121106 6:22390058-22390080 GACCCTAGGCCCTGGTGGTGTGG + Intergenic
1005987751 6:30884744-30884766 GGCCTGGGGCTCTTGGGGTGGGG + Intronic
1006359358 6:33578875-33578897 GGCCCTGGGCGGTGGGGGTGGGG - Intronic
1006805839 6:36788424-36788446 GGCTCGAGGCTCCAGGGGTGAGG + Intronic
1006898782 6:37486826-37486848 GGCCTGAGGCACTGGGCATGGGG - Intronic
1006945745 6:37783550-37783572 GGGCCTGGGCCCTGGGGGTGTGG - Intergenic
1007400184 6:41598861-41598883 GCCCCGAGGCGCTGGGGTTAGGG - Exonic
1007844211 6:44740363-44740385 GGACCTAGGCACTGGGGATTTGG + Intergenic
1008834457 6:55808581-55808603 GACCCTAGGCACTGGTGGCGTGG + Intronic
1009324769 6:62337334-62337356 GGCTAGAAGCACTGGTGGTGAGG + Intergenic
1011697424 6:89924836-89924858 GACCAGAGGCAGCGGGGGTGGGG + Intergenic
1014564452 6:122930746-122930768 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1017070703 6:150573363-150573385 GGCCCCAGGCAGGGGGGCTGGGG + Intergenic
1017890216 6:158631633-158631655 GGCCCTGGGAACTGGGGGTCAGG + Intronic
1019279129 7:191552-191574 GGCTTGAGGCACAGGGGATGTGG + Intergenic
1019492178 7:1320555-1320577 AGCCTGAGGCTCTGGGGGGGTGG + Intergenic
1019658303 7:2209676-2209698 GGCCCGAGGCCCCGTGGGTGTGG - Intronic
1020071072 7:5227369-5227391 GGCCTGAGGCACACGGGGTGGGG - Intronic
1020240750 7:6393073-6393095 GGCCGGAGGGATTGGGGTTGGGG + Intronic
1021717009 7:23469828-23469850 GGCCCGGCGCGCTGGGGGAGCGG - Intronic
1021931376 7:25584644-25584666 GGCCAGATGAAGTGGGGGTGGGG - Intergenic
1022095714 7:27139729-27139751 TGCGCGGGGGACTGGGGGTGCGG + Intronic
1022243215 7:28532551-28532573 GACCCGAGGCACTGTTGGTCTGG - Intronic
1022459722 7:30594110-30594132 GGCAGGAGGAACTGGGTGTGTGG + Intergenic
1022958658 7:35404117-35404139 GGACCCAGGAACTGGGAGTGGGG + Intergenic
1023081364 7:36529576-36529598 GGATGGGGGCACTGGGGGTGGGG + Intronic
1023965816 7:44962620-44962642 GGCCGGAGCCCCTGCGGGTGAGG + Intergenic
1024034441 7:45495428-45495450 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1024324282 7:48096526-48096548 GGCCTGAGGTACTGGGGAAGGGG - Intronic
1024621281 7:51159388-51159410 GGCCCGAGGCACTGTGATGGCGG + Intronic
1024705782 7:51958570-51958592 GCCACCTGGCACTGGGGGTGTGG + Intergenic
1026731193 7:72913275-72913297 GTCCCGACGCAGTGGAGGTGGGG - Intronic
1026845831 7:73698770-73698792 GGCCCGAGGGGCTGGGTGTCTGG + Intronic
1026930670 7:74221466-74221488 GGTCCCAGGAAGTGGGGGTGGGG + Intronic
1027112888 7:75454794-75454816 GTCCCGACGCAGTGGAGGTGGGG + Intronic
1027285134 7:76639405-76639427 GTCCCGACGCAGTGGAGGTGGGG + Intergenic
1028585449 7:92447492-92447514 GGCCCGAGGCACTGGGAAGCAGG - Exonic
1028600806 7:92598432-92598454 GTCCTTAGGCACTGGGGATGTGG - Intergenic
1028627109 7:92889526-92889548 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1029115254 7:98233363-98233385 GGCCAGGTGCCCTGGGGGTGTGG - Intronic
1029305577 7:99617188-99617210 GCCCCGAGGCCCTGCGGGTCTGG + Intronic
1029436867 7:100568516-100568538 GGCTCGAAGCACAGGTGGTGTGG - Intergenic
1029444352 7:100604307-100604329 GGCCCTAGGCACTGGGGCGCGGG - Intronic
1031895234 7:127340514-127340536 GGCGAGATGCAGTGGGGGTGTGG - Intergenic
1032271377 7:130410304-130410326 GGGGTGAGGCACTGGGCGTGAGG + Intronic
1032519130 7:132529530-132529552 GACCAGAGTTACTGGGGGTGGGG - Intronic
1033740730 7:144273924-144273946 GGGCAGAGGAGCTGGGGGTGGGG - Intergenic
1033753176 7:144375689-144375711 GGGCAGAGGAGCTGGGGGTGGGG + Intronic
1034272692 7:149811118-149811140 GTGCCGAGGGGCTGGGGGTGGGG - Intergenic
1034352934 7:150429044-150429066 GGGCCAAGGCACTGGGGCTTTGG + Intergenic
1034622113 7:152464170-152464192 TGCCCGCGGTAGTGGGGGTGGGG + Intergenic
1035156690 7:156920201-156920223 GGCCCGGGTCACTTGGGCTGTGG - Intergenic
1035562152 8:613872-613894 GGCCCGCTGCCCTGGAGGTGGGG - Intergenic
1035695127 8:1590236-1590258 GTTCTGAGGCACTGGGGGTGAGG + Intronic
1035729472 8:1844186-1844208 GCCCCTTGGCACTGTGGGTGTGG + Intronic
1035732579 8:1863260-1863282 TGCCCGAGGGGCTGGGGGGGTGG - Intronic
1037103581 8:15078010-15078032 GGCCCCATGCACTGGGGGACTGG + Intronic
1037703306 8:21295191-21295213 GCCCCCAGGCACTGGGGCAGCGG - Intergenic
1037768109 8:21784116-21784138 CTCCTGAGGCACTGTGGGTGTGG - Intronic
1038331820 8:26615055-26615077 TGCCAGAGGCACGGGAGGTGTGG + Intronic
1038537301 8:28362508-28362530 CCCCATAGGCACTGGGGGTGGGG - Intronic
1040814303 8:51491591-51491613 GGCCCATGGCAGTGGTGGTGGGG - Intronic
1040841769 8:51792439-51792461 GACCCAAGGCCCTGGTGGTGTGG - Intronic
1041108600 8:54465728-54465750 GACCTGTGGCACTGGGGCTGGGG - Intergenic
1041162701 8:55061239-55061261 GGACCAGGGCACTGGGGCTGAGG - Intergenic
1041890117 8:62859051-62859073 GACCCAAGGCCCTGGTGGTGTGG + Intronic
1041972794 8:63761824-63761846 GACCCAAGGCACTGGTGGTGTGG + Intergenic
1042201391 8:66282236-66282258 GGCTCTAGGCAGTGGGGGGGTGG - Intergenic
1043092493 8:75923845-75923867 GACCCAAGGCTCTGGTGGTGTGG - Intergenic
1043178445 8:77051892-77051914 TGTTCAAGGCACTGGGGGTGTGG + Intergenic
1043660833 8:82738326-82738348 ATTCTGAGGCACTGGGGGTGAGG - Intergenic
1043808614 8:84705294-84705316 GGCCCCAGGGGTTGGGGGTGGGG + Intronic
1045346104 8:101294989-101295011 GGACAGAGGCACTGGGGGTGAGG - Intergenic
1046406713 8:113781977-113781999 GGACAGAGACAGTGGGGGTGAGG + Intergenic
1046986745 8:120397184-120397206 GACCCAAGGCCCTGGTGGTGTGG - Intronic
1049190515 8:141284952-141284974 GGCCCCAGGGAGTCGGGGTGTGG - Intronic
1049987404 9:964641-964663 GGCCAGCTGCACTGGGGTTGGGG - Intronic
1049998506 9:1052213-1052235 GGCCCTGGGCGCGGGGGGTGTGG - Intronic
1050587210 9:7125114-7125136 GGGTCAGGGCACTGGGGGTGGGG - Intergenic
1051206428 9:14693508-14693530 GGTCCGCGGCTCTGGGGCTGCGG - Intergenic
1052876239 9:33567968-33567990 TGACCAAGGCACTGGAGGTGGGG - Intronic
1052888818 9:33676942-33676964 AGCCCGGGCCACGGGGGGTGCGG + Intergenic
1053499777 9:38576379-38576401 TGACCAAGGCACTGGAGGTGGGG + Intronic
1053661345 9:40283682-40283704 TGACCAAGGCACTGGAGGTGGGG - Intronic
1053839855 9:42182073-42182095 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
1053911720 9:42913028-42913050 TGACCAAGGCACTGGAGGTGGGG - Intergenic
1054118316 9:61188448-61188470 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
1054373464 9:64429900-64429922 TGACCAAGGCACTGGAGGTGGGG - Intergenic
1054523265 9:66092602-66092624 TGACCAAGGCACTGGAGGTGGGG + Intergenic
1054589439 9:66994116-66994138 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1054681093 9:67919671-67919693 TGACCAAGGCACTGGAGGTGGGG - Intergenic
1056406755 9:86282469-86282491 GGCCCGAGGCACCGGGGCGCCGG - Exonic
1057679200 9:97161079-97161101 TGACCAAGGCACTGGAGGTGGGG + Intergenic
1059414795 9:114155974-114155996 GGCCCGAGGCACAGCGGCGGCGG + Exonic
1059895125 9:118855852-118855874 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
1060508412 9:124215239-124215261 GCCCCCAGGGACTGGGGGGGAGG - Intergenic
1060548773 9:124475617-124475639 TGCTCAGGGCACTGGGGGTGTGG + Intronic
1061163930 9:128911644-128911666 GGCGGGAGGAGCTGGGGGTGGGG - Intronic
1061191389 9:129084798-129084820 GGGTGGGGGCACTGGGGGTGGGG - Intronic
1061485862 9:130920159-130920181 AGCCAGGGGCGCTGGGGGTGGGG + Intronic
1061840213 9:133354359-133354381 GGCCCAAGGCCCTGTGGCTGAGG - Intronic
1061870233 9:133516480-133516502 GGCACAAGCCCCTGGGGGTGGGG + Intronic
1061995034 9:134178873-134178895 GGGCCAAGGCACTGTGTGTGTGG - Intergenic
1062113184 9:134793534-134793556 TGCCCGAGGCACAGGCGCTGGGG - Intronic
1062250002 9:135589087-135589109 TGGCTGAGGAACTGGGGGTGTGG + Intergenic
1062286979 9:135777733-135777755 AGCCAGAGGAGCTGGGGGTGGGG - Intronic
1062465146 9:136677612-136677634 GGCGCGAAGGCCTGGGGGTGGGG + Intronic
1062484899 9:136769887-136769909 GGCCTGGGACACTCGGGGTGGGG - Intergenic
1062532808 9:137009235-137009257 GGCTGGGGGCACTGGGGCTGGGG - Intronic
1062533154 9:137010503-137010525 GGCCCTGAGCTCTGGGGGTGGGG - Intronic
1186467846 X:9797794-9797816 GGCCGGAGGCACAGTGGGTGGGG + Intronic
1187154704 X:16712289-16712311 GCGCCGAGGCCCTGGGGGTCTGG + Intronic
1187219278 X:17308152-17308174 GGCCAGAGGAGCAGGGGGTGGGG - Intergenic
1187425574 X:19174807-19174829 GGGCCGAGGGAATGTGGGTGGGG + Intergenic
1188739821 X:33764294-33764316 GCCCAGAGGCACTGGGGCTGAGG - Intergenic
1189297471 X:39929180-39929202 TGCCCGGGACACTGGGGGTGGGG + Intergenic
1190115601 X:47624438-47624460 GGCCTGAGGCATTAGGGGTGGGG + Exonic
1190759556 X:53428166-53428188 GGCCTGAGGCCCTGGGGTGGTGG + Intronic
1191768898 X:64733481-64733503 GGCCCAAGGCCCTGGTGGTATGG + Intergenic
1192436898 X:71148587-71148609 GGCCAAGGGCACTGGGTGTGTGG + Intronic
1192960598 X:76126786-76126808 GACCCAAGGCACTGGTTGTGTGG - Intergenic
1193271274 X:79531999-79532021 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1193909241 X:87281216-87281238 GACCCAAGGCCCTGGTGGTGTGG + Intergenic
1194281440 X:91958451-91958473 GACCCAAGGCCCTGGTGGTGTGG + Intronic
1197782397 X:130171519-130171541 CGCTCGAGCCAGTGGGGGTGGGG + Intergenic
1198841287 X:140860759-140860781 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
1199695006 X:150337531-150337553 GGCTCGTGGCAGTGGGGGTGGGG + Intergenic
1200064681 X:153498683-153498705 GGCCCCAGGCTCTGGGGGGCAGG + Intronic
1200102026 X:153692968-153692990 GACCGGAGGCGCTGGGAGTGGGG + Intronic
1200158598 X:153992312-153992334 GGCCCGAGACAGCGGTGGTGAGG - Intergenic
1200372113 X:155738738-155738760 GACCCAAGGCCCTGGTGGTGTGG - Intergenic
1200599031 Y:5183107-5183129 GACCCAAGGCCCTGGTGGTGTGG + Intronic
1201149225 Y:11086365-11086387 GGCCAGAGGCATCTGGGGTGAGG + Intergenic