ID: 954294152

View in Genome Browser
Species Human (GRCh38)
Location 3:49664897-49664919
Sequence CGAGGCACTGGGGGTGGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1495
Summary {0: 1, 1: 0, 2: 11, 3: 151, 4: 1332}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
954294134_954294152 28 Left 954294134 3:49664846-49664868 CCAGCATGGTGAGTACAAGCAGC 0: 1
1: 0
2: 0
3: 7
4: 113
Right 954294152 3:49664897-49664919 CGAGGCACTGGGGGTGGGGGTGG 0: 1
1: 0
2: 11
3: 151
4: 1332
954294133_954294152 29 Left 954294133 3:49664845-49664867 CCCAGCATGGTGAGTACAAGCAG 0: 1
1: 0
2: 0
3: 10
4: 129
Right 954294152 3:49664897-49664919 CGAGGCACTGGGGGTGGGGGTGG 0: 1
1: 0
2: 11
3: 151
4: 1332
954294140_954294152 -5 Left 954294140 3:49664879-49664901 CCTCTTCTGGGAAAGGCCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 138
Right 954294152 3:49664897-49664919 CGAGGCACTGGGGGTGGGGGTGG 0: 1
1: 0
2: 11
3: 151
4: 1332
954294139_954294152 0 Left 954294139 3:49664874-49664896 CCTTGCCTCTTCTGGGAAAGGCC 0: 1
1: 0
2: 1
3: 21
4: 229
Right 954294152 3:49664897-49664919 CGAGGCACTGGGGGTGGGGGTGG 0: 1
1: 0
2: 11
3: 151
4: 1332
954294137_954294152 6 Left 954294137 3:49664868-49664890 CCTGTACCTTGCCTCTTCTGGGA 0: 1
1: 0
2: 0
3: 9
4: 155
Right 954294152 3:49664897-49664919 CGAGGCACTGGGGGTGGGGGTGG 0: 1
1: 0
2: 11
3: 151
4: 1332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
954294152 Original CRISPR CGAGGCACTGGGGGTGGGGG TGG Intronic
900123169 1:1058223-1058245 TCAGGCACTGGGGGTCGGGGAGG + Intergenic
900207982 1:1439728-1439750 CGGGGCACGGGGCGTGGGCGCGG - Exonic
900327120 1:2113839-2113861 CAAGGCACTGGTGTTGGGGCAGG + Intronic
900343615 1:2200446-2200468 GGAGGCTTTGGGGTTGGGGGTGG + Intronic
900357719 1:2272835-2272857 CGAGGCTCGGGGCGTGGGAGGGG - Intronic
900520892 1:3105041-3105063 AGAGGAGCGGGGGGTGGGGGCGG + Intronic
900636414 1:3668136-3668158 CTATGAACTAGGGGTGGGGGAGG + Intronic
900782757 1:4628754-4628776 CAAGGCCCTGGGGGAGGGGGAGG + Intergenic
900803309 1:4751079-4751101 AGAGGCACTGGGGGTTGTGCAGG - Intronic
900891843 1:5455070-5455092 CCAGGCTCTGGGTGTGAGGGTGG - Intergenic
901012364 1:6209046-6209068 CGGGGACTTGGGGGTGGGGGCGG + Intronic
901068128 1:6504308-6504330 GGAGGCAGTGGGGATGCGGGAGG - Intronic
901205535 1:7493635-7493657 CAGGGAACTGGGGGGGGGGGGGG + Intronic
901671279 1:10857748-10857770 CCATGTGCTGGGGGTGGGGGCGG - Intergenic
901791427 1:11655246-11655268 CGCGGGGCTGGGGGTGGGAGTGG + Intronic
902225864 1:14996190-14996212 CCAGGCACTGGGGGTGGAGTGGG - Intronic
902249476 1:15144593-15144615 AGAAGCCCTGGGTGTGGGGGAGG + Intergenic
902511058 1:16967389-16967411 AGAGGCCTTGGGGGCGGGGGTGG - Intronic
903025775 1:20429086-20429108 CGCAGCACTGGTGGTGGGGGAGG - Intergenic
903283856 1:22265064-22265086 TGGGGGTCTGGGGGTGGGGGAGG + Intergenic
903408272 1:23117499-23117521 GGAAGCCCTGGGGGGGGGGGCGG + Intronic
903829325 1:26165096-26165118 TGGGGAACTGGGGTTGGGGGTGG + Intergenic
903865036 1:26391851-26391873 CAGGCCACTGGGGGTGGGGACGG - Intergenic
904466773 1:30712705-30712727 CAGGGCAATGGCGGTGGGGGGGG - Exonic
904609367 1:31716602-31716624 AGAGGGACTGGGGCTGAGGGAGG - Intergenic
904610104 1:31721157-31721179 CCACTCACTGGGGGTGGGGTGGG - Intergenic
904832318 1:33312884-33312906 CCAGGCCCTGGGGGCGGGAGGGG + Exonic
904863425 1:33557734-33557756 AGAGACACTGGGGGCGGGGACGG + Exonic
904900507 1:33853637-33853659 ACAGGCATTGAGGGTGGGGGTGG + Intronic
905393255 1:37651396-37651418 CGAGGGACTGGGGATTGGAGGGG - Intergenic
905484358 1:38285045-38285067 GGAGGCTTTGGGGATGGGGGTGG - Intergenic
905597157 1:39217760-39217782 CCAGCTACTGGGGGTGGGGTTGG + Intronic
905655572 1:39684268-39684290 TGAGGCACCCGGGGTGGCGGGGG - Intronic
905655595 1:39684319-39684341 CGAGGCACCCGGGGTGGGAGGGG - Intronic
905655612 1:39684367-39684389 CGAGGAACCGGGGGTGAGGGAGG - Intronic
905797410 1:40823420-40823442 GGAAGATCTGGGGGTGGGGGTGG + Intronic
906079742 1:43077406-43077428 TGAGGCATGGTGGGTGGGGGAGG - Intergenic
906240821 1:44241124-44241146 CCAGGAACTGGGGGAGGGGCTGG + Intronic
906273748 1:44501039-44501061 GAAGGCTGTGGGGGTGGGGGTGG + Intronic
906285631 1:44586007-44586029 CAGGGCAATGGGGGTGGAGGTGG - Intronic
906490781 1:46266837-46266859 CAAGGCTCTGGAGGTGGGGCAGG + Intronic
906508085 1:46394618-46394640 CGAGGGACAGGGGATGGGGCGGG + Intronic
906615644 1:47231311-47231333 CGAGGCGCTGGTGGGGGCGGCGG - Intronic
906773652 1:48508735-48508757 TGAGGCACTAGTGCTGGGGGTGG + Intergenic
906960635 1:50417505-50417527 CGAGAAATAGGGGGTGGGGGTGG - Intergenic
907984907 1:59521022-59521044 CAAGAAATTGGGGGTGGGGGGGG + Intronic
908242436 1:62198690-62198712 CAAGGGACTGGGGGTTGGGAGGG - Intronic
908275911 1:62470928-62470950 AGAGGCAGAGGAGGTGGGGGAGG - Intronic
908703895 1:66930264-66930286 CGAGGCAGTGGCGGCGGGAGCGG + Intronic
908772721 1:67610793-67610815 TTAGGCACTGGGGTTGGGGGTGG + Intergenic
908836837 1:68236803-68236825 ATAGGAACTGGGGGTGAGGGAGG - Intergenic
908975145 1:69888206-69888228 GGAGGCAGTGAGGCTGGGGGAGG - Intronic
909155919 1:72076503-72076525 TGAGGCAGGGGGGGTGGGGATGG - Intronic
909391639 1:75127336-75127358 GGAGGCTCTGGGGGCGGGGAGGG - Intergenic
910423652 1:87098214-87098236 TTAGAGACTGGGGGTGGGGGTGG + Intronic
910632019 1:89364987-89365009 GTTGGCGCTGGGGGTGGGGGTGG - Intronic
910895419 1:92064380-92064402 CTAGGCACTGCGGGGGGGTGGGG + Intergenic
911087151 1:93988595-93988617 AGTGGCAATGGGTGTGGGGGGGG + Intergenic
911102508 1:94105637-94105659 CCAGGAGCTGAGGGTGGGGGTGG + Intronic
911664582 1:100538992-100539014 CGAGCCACCGGTGGTGGAGGAGG - Exonic
912376383 1:109213120-109213142 GGAAGGATTGGGGGTGGGGGTGG + Intergenic
912533103 1:110340357-110340379 CGAGGCAATGGTGGCGGAGGTGG - Exonic
913699438 1:121360523-121360545 CGAGGCTCTGGGGGTTCAGGGGG - Intronic
913975545 1:143451747-143451769 CAACTCTCTGGGGGTGGGGGGGG - Intergenic
914069939 1:144277364-144277386 CAACTCTCTGGGGGTGGGGGGGG - Intergenic
914109216 1:144688990-144689012 CAACTCTCTGGGGGTGGGGGGGG + Intergenic
914138107 1:144919513-144919535 CGAGGCTCTGGGGGTTCAGGGGG + Intronic
914900703 1:151709684-151709706 CCAGGCCCTGGGCCTGGGGGTGG + Intronic
915112290 1:153571777-153571799 GGAGGTTCTGGGGGTGGAGGTGG - Intergenic
915203477 1:154251590-154251612 AGAGGCGCTCGTGGTGGGGGTGG - Exonic
915447464 1:155982078-155982100 CCTGGCACTGCGGGTGGGGCTGG + Intronic
915468977 1:156114606-156114628 AGATCCATTGGGGGTGGGGGCGG - Intronic
915607081 1:156959175-156959197 TGGGGTACTGGGGGTGGAGGGGG + Intronic
915628960 1:157137570-157137592 CGAGGCACCGGGGCTGAGGCAGG + Intronic
915640606 1:157221635-157221657 CCAGGGGCTGGGGGTTGGGGTGG - Intergenic
915674254 1:157515797-157515819 GGTGGGCCTGGGGGTGGGGGAGG + Intronic
916071654 1:161173705-161173727 CGAAGTACTGGGGGTACGGGAGG + Exonic
916418006 1:164610509-164610531 GAAGGCACTGGGGGTGGCTGGGG + Intronic
916966192 1:169945131-169945153 TGAGGCAGTGGGGGGCGGGGGGG + Intronic
917139811 1:171824698-171824720 TGAGGCAGTGGTGGTGGAGGGGG + Intergenic
917345049 1:174021699-174021721 CTAGTCTGTGGGGGTGGGGGAGG - Intronic
917667972 1:177243965-177243987 GGAAGCTGTGGGGGTGGGGGTGG + Intronic
917789103 1:178488161-178488183 TGAGGCCCTGGGGGAGGTGGAGG - Intergenic
917966136 1:180179831-180179853 GGAGGCACAGGGGTTGGGGAGGG + Intronic
919770350 1:201154413-201154435 CGCGGCATTGGGGGAGGGGACGG - Exonic
919796792 1:201325661-201325683 CCAGGCCCTGGCAGTGGGGGTGG + Intronic
919898340 1:202024019-202024041 TTGGGCCCTGGGGGTGGGGGAGG - Intergenic
919955574 1:202411536-202411558 TAAGGTACTGGGGGTGGGAGGGG + Intronic
919970033 1:202569929-202569951 GGAGGCAGTGGGGCAGGGGGAGG + Intronic
920041290 1:203099313-203099335 TGTGCCACTGGGGGTGGGGTAGG - Intronic
920055243 1:203186428-203186450 CCAGGAGGTGGGGGTGGGGGAGG - Intronic
920241922 1:204558883-204558905 GGAGGCCTTGGGGGTGGGGTGGG + Intergenic
920305393 1:205015193-205015215 GGAAGGACTGGGGGTGGGTGGGG + Intronic
920486847 1:206379231-206379253 CGAGGCTCTGGGGGTTCAGGGGG - Intronic
920868804 1:209775740-209775762 CCAGGCACTGGGGGTGGGGAGGG + Intronic
921054024 1:211530737-211530759 AGGGGCACTGGGGGTGGGAGGGG - Intergenic
921089589 1:211830495-211830517 GGAGGCGCTGGGGGCGGGGAAGG - Intronic
921160465 1:212468703-212468725 TAAGGCGGTGGGGGTGGGGGGGG - Intergenic
921923244 1:220690830-220690852 CGAGGGAATGGGAGCGGGGGCGG - Intronic
921946116 1:220887204-220887226 CTAGGAACTGGGGGTGGGGGTGG - Intergenic
922365607 1:224860595-224860617 TGCTGCACTGGGGATGGGGGTGG + Intergenic
922730711 1:227947696-227947718 CGAGGCACCCGGGGTGGCTGGGG - Intronic
922782613 1:228264673-228264695 CCTGGCACTGGGGGTTGAGGTGG + Intronic
923014062 1:230112369-230112391 AGAGGCGCCGGGGGAGGGGGGGG + Intronic
924242903 1:242057312-242057334 CGGTGGCCTGGGGGTGGGGGTGG + Intergenic
924415421 1:243851116-243851138 CGAGGTGCAGGGGGTGGGGTCGG - Intergenic
924941713 1:248816730-248816752 TGAGGCAGTGGCGGTGGGAGGGG - Intronic
1062875860 10:942638-942660 CATGGGACTGTGGGTGGGGGTGG - Intergenic
1063503888 10:6579685-6579707 CAAGGGCCTGGGGGAGGGGGAGG - Intronic
1063505723 10:6597637-6597659 CCAAGGACTGGAGGTGGGGGGGG - Intergenic
1064133760 10:12732671-12732693 GGAGGGACAGGGGGCGGGGGGGG - Intronic
1064238483 10:13601486-13601508 CGGGGCACAGGGGGAGTGGGAGG - Intronic
1064243415 10:13650617-13650639 CCTGGCACTGGGGCTGGGGGAGG + Intronic
1064552948 10:16521062-16521084 CGGGGCGCTGGGGGTGGTGATGG - Exonic
1065022132 10:21509661-21509683 AGAGGCCCTGGGTGTTGGGGAGG - Intergenic
1065024228 10:21526118-21526140 CGGGGCAGTCGGGGTGGGGGTGG - Intergenic
1065540112 10:26755708-26755730 TGAGGCATAGGGGGAGGGGGTGG + Exonic
1066023127 10:31321106-31321128 CCAGGCGCGGGGGGTGGGGCTGG - Intronic
1066640406 10:37549645-37549667 TGAGGCACTGGCTTTGGGGGAGG - Intergenic
1066679097 10:37919115-37919137 GAAGCCAGTGGGGGTGGGGGTGG + Intergenic
1067092624 10:43276645-43276667 CCAGGGTCTGGGGGTGGGTGGGG - Intergenic
1067338830 10:45384758-45384780 CCAGACTCCGGGGGTGGGGGTGG + Intronic
1067428421 10:46226490-46226512 CGAGCCCCTGGTGGTGGGTGTGG + Intergenic
1068103838 10:52590328-52590350 GGAGCCTCTGGGGCTGGGGGTGG + Intergenic
1068610644 10:59056572-59056594 CCATGGACGGGGGGTGGGGGCGG - Intergenic
1068969180 10:62945296-62945318 TGAGGGCCTGGGAGTGGGGGTGG - Intergenic
1069361751 10:67650953-67650975 GGAGGCAGTGGGGGAGGGGGTGG - Intronic
1069455881 10:68553404-68553426 AAAGGCAGAGGGGGTGGGGGAGG + Intergenic
1069796114 10:71053053-71053075 TGAGACACTGTGGGTGGGGAGGG + Intergenic
1069990076 10:72309749-72309771 GGAGGCACTGGGGGTGTTGAAGG - Intergenic
1070358207 10:75661129-75661151 TGAGGCACACGGGCTGGGGGAGG + Intronic
1070407696 10:76111795-76111817 CGCCGAAATGGGGGTGGGGGGGG + Intronic
1070467559 10:76738835-76738857 CCAGGCACTGAGGGCAGGGGTGG + Intergenic
1070613279 10:77949246-77949268 CCAGGCACTGAGTGTGGTGGGGG - Intergenic
1070630275 10:78079764-78079786 TGATGCACTGGGGCTGGGGAGGG + Intergenic
1070698040 10:78577548-78577570 CTGGGCACTGAGGGTGGGGCTGG + Intergenic
1070780122 10:79132759-79132781 CGAGGCAGTGGGGTGGGGGCAGG + Intronic
1070812539 10:79305618-79305640 CGAGGGGCAGGGGGTGGGAGGGG + Intronic
1071049300 10:81427448-81427470 GGGGGAACTGGGGGTGGGGGTGG - Intergenic
1071397576 10:85238574-85238596 AGGGGCCCTGTGGGTGGGGGCGG + Intergenic
1071502104 10:86211477-86211499 CTCGGCATTGGGGGTGTGGGGGG + Intronic
1071601458 10:86960512-86960534 CTAGGCCCTGGGGGCGGGGCTGG - Intronic
1071700849 10:87933608-87933630 CCAGGGACTGAGGGTGGGGAGGG - Intronic
1071740042 10:88347797-88347819 TGAGGCAATGGGGGAGGGGAAGG - Intronic
1071925047 10:90396654-90396676 AGAGGCAGTGGGGGGTGGGGAGG + Intergenic
1072562264 10:96587016-96587038 GGAGGCGCGGGGGGCGGGGGAGG - Exonic
1072785038 10:98273569-98273591 GGTGGCACTGGGGGTGCAGGGGG - Intergenic
1073119136 10:101110998-101111020 GGAACCACTGAGGGTGGGGGTGG + Intronic
1073208568 10:101781227-101781249 CGTGGCCCTGGGCCTGGGGGAGG - Intergenic
1073591029 10:104757861-104757883 CAAGGCAGCGGGTGTGGGGGGGG - Intronic
1073754878 10:106571025-106571047 AGAGTGACTAGGGGTGGGGGCGG - Intergenic
1073833364 10:107412489-107412511 CCATGCACTGGGGGTGAGGTGGG - Intergenic
1074108292 10:110404829-110404851 GGAGGTACTGGGGGTGGAAGGGG - Intergenic
1074361251 10:112825453-112825475 CGAGGTACTGGATCTGGGGGGGG - Intergenic
1074537153 10:114336682-114336704 GGAGCCTCTGAGGGTGGGGGTGG + Intronic
1074755987 10:116624469-116624491 TTGGGCATTGGGGGTGGGGGTGG + Intronic
1074868416 10:117558387-117558409 GGAGGCACTTGGGGAGGGAGAGG + Intergenic
1074879822 10:117647217-117647239 TGAGGCACTGGGGGCCTGGGTGG + Intergenic
1074967743 10:118507257-118507279 ATAGCTACTGGGGGTGGGGGGGG + Intergenic
1075078318 10:119366347-119366369 GGAGGCAAAGGGGGTGGCGGAGG + Intronic
1075608501 10:123833448-123833470 GGAGGCACTGGGGGTGCTGGAGG + Intronic
1075618306 10:123907513-123907535 GGTGGGACTTGGGGTGGGGGTGG - Intronic
1075929403 10:126282855-126282877 CATGGAACTGGGGCTGGGGGTGG + Intronic
1076653576 10:132006323-132006345 GGAGGGGGTGGGGGTGGGGGTGG + Intergenic
1076676514 10:132149875-132149897 GGAGGTGGTGGGGGTGGGGGAGG - Intronic
1076937801 10:133577266-133577288 TGTGGGACTGGGGGGGGGGGTGG - Intergenic
1076986011 11:236436-236458 CGGGGCGCCGGGGGCGGGGGCGG - Intronic
1076998538 11:311005-311027 CGCGGCTCCGGGGCTGGGGGCGG - Intronic
1077000205 11:318754-318776 CGCGGCTCCGGGGCTGGGGGCGG + Intergenic
1077052988 11:576052-576074 CGGGGCTGCGGGGGTGGGGGCGG + Intergenic
1077112097 11:866382-866404 CGAGCCACAGGGGTTGGGTGGGG + Intronic
1077124504 11:926288-926310 CCAGGGTCTGGGGGTGCGGGCGG + Intronic
1077183819 11:1227788-1227810 CCAGGAGCTGGGGGTGGCGGGGG - Intronic
1077221381 11:1419134-1419156 CTGGGCACTGGTGGCGGGGGGGG + Intronic
1077253554 11:1571253-1571275 CGCGGCGCTGGGGGAGGGGCTGG - Intronic
1077300488 11:1844330-1844352 CGTGGCTCTGGAGGTCGGGGAGG + Intergenic
1077368287 11:2170084-2170106 AGAAGCAGTGGTGGTGGGGGAGG + Intronic
1077435411 11:2536519-2536541 CGAGACACTGAGGGTCGGGAGGG + Intronic
1077538304 11:3134829-3134851 AGAGGGGCTGAGGGTGGGGGAGG + Intronic
1077538585 11:3135932-3135954 CTATGCAGTGGGGGTTGGGGAGG - Intronic
1077670486 11:4152843-4152865 GGAGGCACAGGTGGTGGGGGTGG + Intergenic
1077771584 11:5224915-5224937 CGGGTCACTGTGAGTGGGGGAGG + Intergenic
1078062900 11:8059910-8059932 AGAGGCACTGGGGACAGGGGAGG + Intronic
1078314407 11:10280828-10280850 CTGGGGATTGGGGGTGGGGGAGG + Intronic
1078316087 11:10294253-10294275 CGAGCCAGCGCGGGTGGGGGCGG - Intergenic
1078449192 11:11427849-11427871 AGAGGCACTGGGGATGAGGTGGG - Intronic
1078535944 11:12174355-12174377 GCAGGGGCTGGGGGTGGGGGTGG - Intronic
1078591195 11:12641568-12641590 CTATGCACTGGAGTTGGGGGTGG - Intergenic
1079110312 11:17601633-17601655 GGAGGCATTGGGGTGGGGGGTGG + Intronic
1079318795 11:19432616-19432638 CGAGGCAGTGGGGGAGTGGGTGG + Intronic
1080223453 11:29934055-29934077 GGAGGCACTGAGAGTGAGGGAGG - Intergenic
1080604046 11:33849571-33849593 TGAGGGACTGGGGGGAGGGGAGG - Intergenic
1080657104 11:34266769-34266791 GAGGGCACAGGGGGTGGGGGAGG - Intronic
1081172057 11:39881479-39881501 CGTGGCAGTGAGGCTGGGGGAGG + Intergenic
1081207587 11:40293339-40293361 CCGGGTGCTGGGGGTGGGGGCGG - Exonic
1081805084 11:45885988-45886010 CGAGGTTCTGGGGTGGGGGGCGG - Intronic
1081809633 11:45907665-45907687 CATGCCAGTGGGGGTGGGGGGGG - Intergenic
1082091804 11:48096530-48096552 CAAGGTTGTGGGGGTGGGGGCGG - Intronic
1082807836 11:57461426-57461448 CCAGAGACTGGGGGTGGGGTGGG + Intronic
1082856907 11:57816503-57816525 GGAGGGAATGGGGGAGGGGGAGG - Exonic
1082951070 11:58816384-58816406 GGTGGCACTGAGGCTGGGGGAGG + Intergenic
1083043474 11:59710859-59710881 GATGGCAGTGGGGGTGGGGGTGG + Intergenic
1083265791 11:61546286-61546308 AGGGGCACCGGGGGTGGCGGTGG + Intronic
1083293621 11:61703428-61703450 CAAAGCTCTGGGGGTGGGGGTGG + Intronic
1083314581 11:61806523-61806545 GGAGTAACTGGGGGTGGGAGTGG + Intronic
1083319785 11:61838642-61838664 AGAGGCAATGGGGGTGGTGGGGG - Intronic
1083593053 11:63906478-63906500 AGAGGGAGTGGGGGTGGGGTGGG - Intronic
1084041830 11:66546958-66546980 CGAGGGTCTGGGGGCCGGGGAGG + Intronic
1084072029 11:66743105-66743127 CAAGAGACTGGGGGTGGGGATGG + Intergenic
1084088532 11:66865785-66865807 GCAGGACCTGGGGGTGGGGGTGG - Intronic
1084165832 11:67374271-67374293 CGAGGCGCTGGGGCTGGGGCAGG + Intronic
1084336487 11:68460824-68460846 CCAGGTAATGGGGGTAGGGGAGG + Exonic
1084581728 11:70028452-70028474 AGTAGAACTGGGGGTGGGGGAGG - Intergenic
1084676345 11:70637649-70637671 CTAGGCACTGGGAGTGAGGCTGG + Intronic
1084728192 11:71055768-71055790 CTAGGGGCTGGGGGAGGGGGAGG + Intronic
1084741700 11:71144185-71144207 CAAGGCTCAGGAGGTGGGGGAGG + Intronic
1084871786 11:72103328-72103350 GGGGGTACGGGGGGTGGGGGCGG - Exonic
1084945719 11:72637291-72637313 CTAGGTACTAGGGCTGGGGGAGG - Intronic
1085053838 11:73392965-73392987 CGGGGCCCTGGGGGTGAAGGTGG - Intronic
1085271639 11:75273341-75273363 CGAGGCAGCTGGGGTGGGGTGGG + Intronic
1085303015 11:75469305-75469327 CATGGCATTGGGGGTGGGTGGGG + Intronic
1085313250 11:75528475-75528497 TGAGGCGCTGGGGGTGTGTGAGG + Intergenic
1085416502 11:76322056-76322078 CGGGGCAGGCGGGGTGGGGGAGG + Intergenic
1085726943 11:78962405-78962427 TGAGGCACACGGGGAGGGGGAGG + Intronic
1086453399 11:86938726-86938748 CGAGGGGCTGGGGGTAGGGGTGG + Intronic
1087762221 11:102112566-102112588 AGAGGGAATGGGAGTGGGGGCGG - Intronic
1087800283 11:102496254-102496276 CCAGGCTGTGGTGGTGGGGGGGG + Intronic
1088239553 11:107759151-107759173 AGAGGAACTGGTGGTGGGTGGGG - Intergenic
1088678817 11:112221991-112222013 CTGGGGGCTGGGGGTGGGGGTGG - Intronic
1088748288 11:112822689-112822711 GGAGACCCTGGGGGTGGGGAGGG - Intergenic
1088922004 11:114266530-114266552 GGTGGGACTGGGGGTGGGGGTGG - Intronic
1089161305 11:116439658-116439680 CCAGACTCTGGGGGTGGGGTGGG + Intergenic
1089419431 11:118320088-118320110 TGAGGGATTGGGGGTGGGTGGGG - Intergenic
1089494089 11:118899799-118899821 GAAGGCCCTGGGTGTGGGGGTGG - Intronic
1089622456 11:119729506-119729528 CGAGGCGCGGCGGGTGGGGGTGG + Intergenic
1089667328 11:120028843-120028865 CAGGGCACTGGCGTTGGGGGAGG - Intergenic
1089868948 11:121655693-121655715 CGAGGCTCTGGCGGTGGGGAGGG - Intergenic
1090202016 11:124864032-124864054 GGAAGCACTAGGTGTGGGGGAGG - Intergenic
1090863300 11:130673306-130673328 GGAGGCCCTGGAGGCGGGGGTGG + Intronic
1091006143 11:131955684-131955706 CGGGGCACTGGGAGGGTGGGAGG - Intronic
1091081998 11:132680180-132680202 TGAGGCACTGGGTGAGGGGCAGG - Intronic
1091238409 11:134036850-134036872 CTTGGCGGTGGGGGTGGGGGCGG - Intergenic
1091402555 12:189639-189661 AGAGGGACTGGGGCTGGGGAGGG - Intergenic
1091403764 12:196488-196510 CGAGGCTCAGGGGCTGGGGCTGG + Intronic
1091797546 12:3305857-3305879 CCAGGCCCAGGGGGTGAGGGTGG + Intergenic
1091816966 12:3446072-3446094 CAAGGAACTGAGGGTGGGGAGGG - Intronic
1091817189 12:3447480-3447502 AGAGGCACTGCGGGAGAGGGGGG - Intronic
1091844510 12:3645498-3645520 CAAGGGGCTGGGGGTGGTGGGGG + Intronic
1092049311 12:5456611-5456633 CCAGGGGCTGGGGGTGGGGGTGG - Intronic
1092260500 12:6951222-6951244 GGTGGCACTGGGGGTGGGGACGG - Intronic
1092268354 12:7001230-7001252 CAAGGCTCTGGGGGGTGGGGTGG + Intronic
1092605372 12:10112373-10112395 CGAGGCAGCGGAGGTGGTGGTGG + Intergenic
1092899403 12:13044499-13044521 CGAGGCTCTGGGGGCGAGGCCGG + Intronic
1093110781 12:15149431-15149453 CTAGGCACTGGTGGGAGGGGAGG + Intronic
1094029307 12:25992691-25992713 GGAGGCACTGGAGGTGGGCCTGG + Intronic
1094494423 12:30980552-30980574 CCAGGTCCAGGGGGTGGGGGTGG - Intronic
1094606675 12:31955416-31955438 AGAGGCTGTGGGGGTGGAGGTGG + Intergenic
1094847902 12:34369447-34369469 CGAGGCACTTGTGGTGTGGAAGG - Intergenic
1095548083 12:43396042-43396064 CCAGGAAGTGGGGGTGGGGTGGG + Intronic
1095763767 12:45870615-45870637 CCAGGAACTGGGGGCGAGGGAGG - Intronic
1096121768 12:49093192-49093214 GGTGGCAGTGGGGGTGGGGAGGG + Intronic
1096162175 12:49387766-49387788 GCAGGCACTGGAGGTGAGGGTGG + Intronic
1096363534 12:51008863-51008885 TGAGTGACTGGGGGAGGGGGAGG - Intronic
1096371567 12:51073264-51073286 GGAGGCAGTGGGGGTTTGGGAGG + Intronic
1096386006 12:51195951-51195973 TGAGGTACAGGGGCTGGGGGGGG - Exonic
1096669819 12:53191948-53191970 CGTGGCAGTGGGGCTGGGGCTGG - Exonic
1096788348 12:54030431-54030453 GGAGGCCCTGGGGGTTGGTGTGG - Exonic
1096788599 12:54031690-54031712 GGAGGCACTGGAGGCGAGGGTGG - Intronic
1096940923 12:55344666-55344688 GGAGGCAGTGAGGCTGGGGGAGG + Intergenic
1097058598 12:56266108-56266130 CCAGGTACTGGGGAGGGGGGCGG + Intergenic
1097184578 12:57189707-57189729 AGAGGCACTGGGGTGGGGGCGGG + Intronic
1097196173 12:57243517-57243539 CCAGGGACTGGGGCGGGGGGCGG - Exonic
1097211075 12:57370390-57370412 GGAGGCCCGGGGGGGGGGGGCGG + Intronic
1097802372 12:63928645-63928667 CCATGGACTGGGGGTGGGGGCGG + Intronic
1098159382 12:67634686-67634708 CCAGCCATTGGGGGTGGGAGAGG + Intergenic
1098199386 12:68038852-68038874 TGAGGCAGTGGTGGTGGGGTCGG - Intergenic
1098275662 12:68808715-68808737 CGCGGCGGTGGGGGTGGGGGTGG + Intronic
1099165948 12:79307607-79307629 GGAAGGGCTGGGGGTGGGGGTGG + Intronic
1099313946 12:81061953-81061975 GGAGGCAGTGAGGCTGGGGGAGG - Intronic
1100368855 12:93946654-93946676 GGAAGCAATGGGGGTGGGGGAGG + Intergenic
1100726256 12:97412161-97412183 AGAGGCACGGGGGGTGGGAGTGG - Intergenic
1101399188 12:104373281-104373303 TCAGGCCCTGGGGTTGGGGGTGG + Intergenic
1101736967 12:107470523-107470545 CGTGACCCTGGGGATGGGGGTGG - Intronic
1101998406 12:109541355-109541377 CAAGTCACTGAGGGTGGGTGTGG - Intergenic
1102017432 12:109657046-109657068 GGAGGCACTGGGGGCTGGGGCGG - Intergenic
1102737981 12:115179914-115179936 CCAGGCCCTGGAGGTGGGGATGG + Intergenic
1102908276 12:116694045-116694067 CCCGGCACTGGGAGTGGGGAGGG + Intergenic
1102957777 12:117070523-117070545 CCTGCTACTGGGGGTGGGGGAGG - Intronic
1103014003 12:117480165-117480187 TGGGCCACTGGGGGTGGGGTGGG + Intronic
1103260980 12:119588367-119588389 GGAGGGGCAGGGGGTGGGGGAGG - Intergenic
1103558344 12:121779210-121779232 GGAGACACTCGTGGTGGGGGTGG + Exonic
1103705138 12:122867327-122867349 GCAGGCACCGGGGGTGGTGGGGG + Exonic
1103879279 12:124153599-124153621 CGAAGCAATGGTGGTGAGGGAGG + Intronic
1103927674 12:124432859-124432881 CGGGGGGCGGGGGGTGGGGGCGG + Intronic
1103930762 12:124449636-124449658 GGTGGCACCTGGGGTGGGGGTGG - Intronic
1103963152 12:124621967-124621989 GGCTGGACTGGGGGTGGGGGTGG - Intergenic
1103978336 12:124718963-124718985 GGAGTCACGTGGGGTGGGGGTGG + Intergenic
1103991334 12:124801279-124801301 CCAGGGGCTGGGGGAGGGGGCGG + Intronic
1104289504 12:127455391-127455413 CGAGGCCCTGCGGGGCGGGGGGG - Intergenic
1104466084 12:128991994-128992016 CCATGGACTGGGGTTGGGGGTGG + Intergenic
1104785305 12:131444816-131444838 CATGGCCCTGGGGATGGGGGGGG - Intergenic
1104799509 12:131544182-131544204 GGAGGCACAGGGGGAGTGGGGGG - Intergenic
1104806094 12:131590476-131590498 CTCTGCCCTGGGGGTGGGGGGGG - Intergenic
1104806414 12:131592200-131592222 AGAGCCACTGGGAGTGGGGCGGG - Intergenic
1104871197 12:131997733-131997755 GGAGGGAGTGGGGGAGGGGGAGG + Intronic
1104899413 12:132180475-132180497 ACAGGTTCTGGGGGTGGGGGTGG + Intergenic
1105040323 12:132956190-132956212 CGAGGCGGCGGGGCTGGGGGCGG - Intronic
1105545243 13:21346461-21346483 TGAGGCCCTGGGTGTGGGGCAGG - Intergenic
1105546019 13:21351790-21351812 AGAGGCACTAATGGTGGGGGTGG + Intergenic
1105858452 13:24390680-24390702 CGTGGCGCTGGGGGAGGGAGGGG + Intergenic
1106057740 13:26254369-26254391 CGAGGGACGAGGGCTGGGGGTGG - Exonic
1106107813 13:26749394-26749416 CCAGGCACTCGGCGGGGGGGGGG - Intergenic
1106146665 13:27055270-27055292 GAAGGCACTGGGGTTGGAGGTGG - Intergenic
1106367562 13:29097023-29097045 CATGGAACTGGGGGTGGGGTTGG + Intronic
1106506928 13:30378660-30378682 AGAGACAATGGGGGTGGGGGTGG + Intergenic
1107381650 13:39862989-39863011 GTAGGTACTGGGGGTGGGGGTGG - Intergenic
1107628038 13:42310613-42310635 GAAGCCAATGGGGGTGGGGGTGG + Intronic
1110318149 13:74134150-74134172 AGAGGCGCTTGGGGTGGGGTGGG + Intergenic
1110622538 13:77613684-77613706 AAAGGCTGTGGGGGTGGGGGCGG + Intronic
1110881577 13:80578266-80578288 AGAGGGACTGGTGGTGGGTGGGG - Intergenic
1111869462 13:93812134-93812156 CAAGGCGGTGGGGGGGGGGGCGG + Intronic
1111927391 13:94478158-94478180 CGAGGAGCTGGGGGTGGGGGGGG - Intronic
1112696459 13:101954301-101954323 TGAGGCACTGGGCGGGGTGGGGG + Intronic
1112750114 13:102574432-102574454 CCAGGGCCTGGGGGTGGGGGTGG - Intergenic
1113412128 13:110099792-110099814 CCAGGCACTGAGGGTCAGGGGGG + Intergenic
1113490513 13:110688120-110688142 CGAGGCACCGGAGGTGGCCGGGG - Intronic
1113784564 13:112995660-112995682 CGTGGCTCTGGGTGTGGAGGTGG + Intronic
1113803212 13:113096954-113096976 CCAGGCGCTCTGGGTGGGGGCGG - Exonic
1113966409 13:114155819-114155841 GGAGGTGCTGGGCGTGGGGGAGG + Intergenic
1114486524 14:23065838-23065860 CTAGGCACAAGGGGTGGGGCAGG + Intronic
1114516339 14:23302282-23302304 CGACGCACTGGGGTTGGAGCTGG - Exonic
1114522586 14:23348380-23348402 TGAGGGACTGGGGCTGGGGTAGG + Intronic
1114524463 14:23359441-23359463 CCAGGCAGGCGGGGTGGGGGTGG + Exonic
1114664636 14:24370290-24370312 AGAGGCAATGGGGGTGGTGGAGG - Exonic
1114978640 14:28133790-28133812 CTATGGACTGGGGGTGGGGTGGG + Intergenic
1115546162 14:34466533-34466555 GGTGGGACTGGGGGTGGGGCGGG - Intergenic
1115741187 14:36390706-36390728 CGAAGCACTGGGGGTAGCAGAGG - Intergenic
1116591481 14:46781303-46781325 TGCTGCACTGGGGGTGTGGGAGG - Intergenic
1116898718 14:50341448-50341470 GGAGGGTCTGGGGGGGGGGGGGG + Intronic
1117338856 14:54777199-54777221 TGGGGCAGTGGGGGTGGGGGGGG - Intronic
1117391409 14:55266339-55266361 GGAGGCACTGGGGGTGGTGGGGG - Intergenic
1117547586 14:56805728-56805750 AGAGCAGCTGGGGGTGGGGGTGG - Intronic
1117563328 14:56968245-56968267 TGAGGCAGTTGGGGTGCGGGGGG - Intergenic
1117684642 14:58240810-58240832 CGGGGGGGTGGGGGTGGGGGGGG - Intronic
1117790107 14:59331368-59331390 GGAGGCCCTGGGGGAGGAGGAGG - Exonic
1118119123 14:62818095-62818117 CCAGGAGCTGGGGGCGGGGGGGG + Intronic
1118359239 14:65042174-65042196 CGTGGACCTGGGGTTGGGGGTGG + Intronic
1118744329 14:68762994-68763016 CTGGTCCCTGGGGGTGGGGGTGG - Intergenic
1118975600 14:70673575-70673597 CTTGGGAATGGGGGTGGGGGTGG - Exonic
1119536647 14:75408451-75408473 CTAGGTACTGGGGGTGGGGCAGG + Intergenic
1119595259 14:75926969-75926991 CTAGGAACTGGGGCTGGCGGGGG + Intronic
1119677147 14:76564369-76564391 AGAGGGACTGGGGGAGGAGGAGG + Intergenic
1119880083 14:78092909-78092931 CCAGGCTCTGGGGGTGAGGCTGG + Intergenic
1120200588 14:81533942-81533964 CGGAGCAATGGGGGTGGGCGGGG - Intergenic
1120763462 14:88306667-88306689 AAAAGCACTGGGGCTGGGGGAGG + Intronic
1120904523 14:89608740-89608762 CGAAGAACTGGGGATGGGGTAGG + Intronic
1121061805 14:90917559-90917581 CTAGGGACTGGGATTGGGGGAGG - Intronic
1121243586 14:92447248-92447270 CCCGGCACTAGGGGCGGGGGAGG + Intronic
1121273293 14:92651890-92651912 GGCAGCACTGGGGGAGGGGGTGG - Exonic
1121332998 14:93059785-93059807 CGAGGCAGGGGTGGAGGGGGTGG + Intronic
1121449475 14:93998259-93998281 GGAAGCACTGGGGCTGGGGCTGG - Intergenic
1121595251 14:95157324-95157346 CGAGGAAATGGCGGCGGGGGCGG - Intronic
1121711896 14:96044646-96044668 GAAGGTGCTGGGGGTGGGGGTGG + Intronic
1121782715 14:96632122-96632144 CCAGGCACTGGGGCAGGGGCGGG + Intergenic
1122012360 14:98760665-98760687 CCAGGCAATGGGGGAGGGGGGGG - Intergenic
1122112183 14:99510483-99510505 GGAGGCACAGGTGGCGGGGGCGG - Exonic
1122202042 14:100128590-100128612 GGTGGGACTGGGGGTGGGGGGGG - Exonic
1122202065 14:100128635-100128657 GCTGGCAGTGGGGGTGGGGGAGG - Exonic
1122272000 14:100572485-100572507 CCAAGCACTGGGGTTGGGGTCGG - Intronic
1122274857 14:100586310-100586332 CCAGGCCCTGGGGGTATGGGTGG - Intronic
1122404119 14:101489440-101489462 TGTGGGACTCGGGGTGGGGGTGG - Intergenic
1122412695 14:101534013-101534035 CTCAGGACTGGGGGTGGGGGGGG + Intergenic
1122412702 14:101534031-101534053 GGGGGCACTGGGCCTGGGGGAGG + Intergenic
1122413164 14:101536270-101536292 CTGGTCTCTGGGGGTGGGGGTGG - Intergenic
1122414691 14:101543234-101543256 GGAGGAGATGGGGGTGGGGGCGG + Intergenic
1122556629 14:102584061-102584083 GTAGGGACCGGGGGTGGGGGTGG + Intergenic
1122606234 14:102948666-102948688 TGAGGGAGTGGGGGTGGGTGTGG + Intronic
1122637680 14:103138080-103138102 CCCGGAGCTGGGGGTGGGGGAGG + Intergenic
1122695742 14:103551224-103551246 CGCGGCTGTGGGGGTGGAGGCGG + Intergenic
1122705263 14:103616951-103616973 GGAGGGACTGGAGATGGGGGTGG - Intronic
1122720393 14:103718651-103718673 CAAGGCAGTGGGCTTGGGGGTGG + Intronic
1122773146 14:104106028-104106050 CGAGGCACTGAGGCCGGGGCAGG - Intronic
1122776231 14:104118069-104118091 CGAGGCACAGGAACTGGGGGTGG + Intergenic
1122789485 14:104178331-104178353 GGAGGCCCTGGTGGTGGTGGGGG + Intronic
1122793352 14:104193636-104193658 GGAGGCACTGAGGGTGAGGAGGG - Intergenic
1122799695 14:104223403-104223425 GGAGGCAGCTGGGGTGGGGGCGG - Intergenic
1122817764 14:104321929-104321951 CACAGCACTGGGGGCGGGGGCGG + Intergenic
1122885242 14:104707771-104707793 CCAGGCAGCAGGGGTGGGGGTGG - Exonic
1122906825 14:104805458-104805480 GGAGGCACGGTGGGTGTGGGAGG - Intergenic
1123057125 14:105575839-105575861 CCAGGCCATGAGGGTGGGGGAGG - Intergenic
1123081119 14:105696052-105696074 CCAGGCCATGAGGGTGGGGGAGG + Intergenic
1123204034 14:106694772-106694794 GGAGCCACCGGGGGGGGGGGGGG - Intergenic
1123487622 15:20755755-20755777 GGAGGCGCTGGGAGTGGGAGTGG - Intergenic
1123544114 15:21324813-21324835 GGAGGCGCTGGGAGTGGGAGTGG - Intergenic
1123993624 15:25703065-25703087 AGAGGCACTGGGGTCGGGCGCGG + Intronic
1124012580 15:25850643-25850665 TGAGTCACCGGGGCTGGGGGGGG - Intronic
1124343465 15:28904852-28904874 CGAGGCAGTGGGAGTGGGGCTGG + Intronic
1124624699 15:31301194-31301216 AAAGGCAGTGGGGGTGGGGAGGG - Intergenic
1124808324 15:32908255-32908277 GGAGTCTCTTGGGGTGGGGGAGG + Intronic
1124813889 15:32968906-32968928 TTAGGAAGTGGGGGTGGGGGTGG + Exonic
1125101624 15:35919639-35919661 GGTGGCAGTGGGGGGGGGGGGGG + Intergenic
1125320660 15:38484399-38484421 GGAGGTGGTGGGGGTGGGGGTGG + Exonic
1125508300 15:40279957-40279979 CGAGGCGGCGGGGTTGGGGGCGG - Intronic
1125514018 15:40307982-40308004 GGTGGGGCTGGGGGTGGGGGCGG - Intergenic
1125604112 15:40930384-40930406 AGAGCCACTGGAGGAGGGGGTGG - Intronic
1126099441 15:45110884-45110906 TGAGGGAGTGGGGGTTGGGGAGG + Intronic
1126295186 15:47131719-47131741 AGAGGGACAGGGGGAGGGGGAGG - Intergenic
1126330152 15:47523038-47523060 GGAGGCAGTGGGGATGGGGCTGG + Intronic
1126500649 15:49340411-49340433 CGAGGCAAAGCGGGGGGGGGAGG - Intronic
1126578573 15:50221301-50221323 AGAGCCACTGGCGGTGGGGTGGG + Intronic
1126613033 15:50549083-50549105 GGGGGGAATGGGGGTGGGGGTGG - Intergenic
1126851248 15:52798527-52798549 GGAGGCACGGGGGACGGGGGAGG - Intergenic
1127261692 15:57331352-57331374 GGAGGGACGGGGGGAGGGGGTGG + Intergenic
1127500626 15:59550720-59550742 AGAGGCACTGGGGTAGGGAGTGG - Intergenic
1127890121 15:63242847-63242869 CCAGGGACTGGAGGTGGTGGTGG + Intronic
1128028715 15:64460954-64460976 GGAGGAAGTGGGGGTTGGGGGGG + Intronic
1128056479 15:64703252-64703274 TGAGGCACTCGGGGGCGGGGCGG - Exonic
1128109347 15:65067106-65067128 CCAGGGAATGGGGGTGGGAGTGG + Intronic
1128149824 15:65355853-65355875 CGAGGCTCTGGGGGAGGGGGTGG - Intronic
1128424006 15:67521325-67521347 CGAGGCGCTGGGCTTGGGGCGGG - Exonic
1128999397 15:72319949-72319971 CGAGGGCCAGGGGGAGGGGGCGG + Exonic
1129229486 15:74188852-74188874 AGAGACACTGGGGGTGGTGGGGG + Intronic
1129254586 15:74326898-74326920 CATGGCCCTGGGGGTTGGGGAGG + Intronic
1129309455 15:74695964-74695986 CGATGCTGTGGGGGTGGGCGTGG - Exonic
1129392579 15:75227868-75227890 GGAGGCTGTGGTGGTGGGGGTGG + Intergenic
1129471817 15:75760328-75760350 GGAGGCTGTGGTGGTGGGGGTGG - Intergenic
1129598188 15:76981282-76981304 GGAGGCAGTGGGGGCGGGGGTGG - Intergenic
1129599063 15:76987662-76987684 AGTGGAACTTGGGGTGGGGGGGG - Intergenic
1129660549 15:77550617-77550639 AGAGGCAGGAGGGGTGGGGGAGG + Intergenic
1129792068 15:78348123-78348145 CAAGGCCTGGGGGGTGGGGGTGG - Exonic
1129828715 15:78652869-78652891 GGCGGCACTAGGGGTGGTGGTGG + Intronic
1129844011 15:78760003-78760025 AGATGCACTGGGGCAGGGGGCGG - Intronic
1129924276 15:79348951-79348973 CCATCTACTGGGGGTGGGGGAGG - Intronic
1130024875 15:80262263-80262285 GGAGGCAGTGGGGGAGAGGGAGG + Intergenic
1130146144 15:81275135-81275157 AGAGGCACTGGAGGAGGAGGAGG + Intronic
1130235826 15:82132673-82132695 CCAGGAATTGGGGGGGGGGGGGG + Intronic
1130257795 15:82333797-82333819 AGATGCACTGGGGCAGGGGGCGG + Intergenic
1130283082 15:82533971-82533993 TGTGGCACTGGGGATGGAGGTGG - Intergenic
1130342475 15:83011337-83011359 CGCAGCTCTGGGGGTGGCGGCGG + Intronic
1130531096 15:84748472-84748494 CGGGGGATTGGGGGGGGGGGGGG - Intergenic
1130568713 15:85021426-85021448 CTAGCTACTGGGGTTGGGGGTGG + Intronic
1130597141 15:85256166-85256188 AGATGCACTGGGGCAGGGGGCGG - Intergenic
1130959907 15:88652570-88652592 CGAGGAGGTGGGGGAGGGGGAGG - Intronic
1131057279 15:89383215-89383237 CTAAGCACTGGGGATGGAGGAGG - Intergenic
1131150997 15:90047100-90047122 AGAGGTTCTGGGGGTGGGTGGGG + Intronic
1131152949 15:90058250-90058272 GAAGGCACTTGGGGTGGGGAGGG + Intronic
1131154853 15:90068430-90068452 CGAGGCACTGGTAGAGGGTGGGG - Exonic
1131160392 15:90101674-90101696 CGAAGGGGTGGGGGTGGGGGCGG + Intronic
1131257912 15:90873621-90873643 TGAGGGACTTGGGGTGGGGGGGG + Intronic
1131287311 15:91071293-91071315 GGAGGTAGTGGGGGTGGGGGTGG - Intergenic
1131358984 15:91772600-91772622 CCAGGCTCTGGGGGTGGGGGTGG + Intergenic
1131510897 15:93048890-93048912 ACAGACACTGGGGGTGGGGGGGG + Intronic
1131827024 15:96330441-96330463 CGGGGGACCGGGGGTTGGGGGGG - Intronic
1132105307 15:99058980-99059002 GGAGGGGGTGGGGGTGGGGGTGG - Intergenic
1132149206 15:99447622-99447644 GGAGGCACGGGGGCGGGGGGCGG + Intergenic
1132279939 15:100603424-100603446 TGGGAAACTGGGGGTGGGGGTGG - Intronic
1202952456 15_KI270727v1_random:52086-52108 GGAGGCGCTGGGAGTGGGAGTGG - Intergenic
1132462148 16:60939-60961 CGAGGAGCTGGAGATGGGGGAGG + Intronic
1132576466 16:666611-666633 CCTGGCACTGTGGGTGGGGCCGG + Intronic
1132600427 16:770492-770514 CGTGGGGGTGGGGGTGGGGGTGG - Intronic
1132670597 16:1100795-1100817 GGAGGCGCGGGGGGAGGGGGCGG + Intergenic
1132674088 16:1114542-1114564 TGAGCCACTGGGGGCAGGGGTGG + Intergenic
1132678636 16:1130839-1130861 GGGTGCAGTGGGGGTGGGGGGGG + Intergenic
1132680945 16:1141524-1141546 GGAGGCAGGGCGGGTGGGGGGGG + Intergenic
1132683312 16:1152646-1152668 CGTCGTAGTGGGGGTGGGGGTGG + Intergenic
1132683642 16:1153530-1153552 GGAGCCCCTCGGGGTGGGGGTGG + Intronic
1132691306 16:1183051-1183073 CGGGTCACAGAGGGTGGGGGCGG - Intronic
1132713392 16:1279033-1279055 GGAGACCCTGGGGGAGGGGGTGG + Intergenic
1133033112 16:3021017-3021039 CGGGACGCTGGGGGTGGGGGGGG - Intronic
1133101772 16:3484415-3484437 GGATGCACGGGGGGTGGGGAAGG - Intronic
1133140911 16:3743456-3743478 CCATGCACTGGGGGAAGGGGAGG - Intronic
1133225081 16:4337117-4337139 GGGGGCAGTGGGGGTGGGGGGGG + Exonic
1133305088 16:4803572-4803594 GAACACACTGGGGGTGGGGGCGG - Exonic
1133343567 16:5055193-5055215 GGGGGCAGTGGGGGTGGGGGTGG - Intronic
1133396547 16:5452003-5452025 AGAGGCAATGGGTTTGGGGGTGG - Intergenic
1134036891 16:11037788-11037810 AGTGGTTCTGGGGGTGGGGGTGG - Intronic
1134230974 16:12430199-12430221 CCATGGACTGGGGCTGGGGGGGG - Intronic
1134240580 16:12503105-12503127 GGCGACCCTGGGGGTGGGGGTGG - Intronic
1134831527 16:17327612-17327634 CGAGGCGGGGGGGGGGGGGGGGG - Intronic
1135328523 16:21542969-21542991 GACGGCGCTGGGGGTGGGGGTGG + Intergenic
1135524760 16:23205872-23205894 CTGGGCTCTGGGGGTGGGTGGGG - Intronic
1135736225 16:24933793-24933815 AGAGGCGCAGGGGGTGGGGAAGG + Intronic
1135776010 16:25257916-25257938 CGAGGGGCTGGGGGAGGGGGGGG + Exonic
1136116523 16:28098107-28098129 CAAGGCAATTGGGGCGGGGGAGG + Exonic
1136171971 16:28495173-28495195 TGAGGAACTGGGGGTGGTGGCGG + Exonic
1136318577 16:29467970-29467992 TGAGGAAATGGAGGTGGGGGGGG - Intergenic
1136338870 16:29628942-29628964 GACGGCGCTGGGGGTGGGGGTGG + Intergenic
1136393802 16:29982058-29982080 CTAGGCATTGGGGATGGGGTGGG - Intronic
1136433149 16:30207316-30207338 TGAGGAAATGGAGGTGGGGGGGG - Intronic
1136692032 16:32039405-32039427 CAGGACACTGGGGGGGGGGGGGG + Intergenic
1136726665 16:32363032-32363054 CGGGGAAGTGGGGGAGGGGGAGG - Intergenic
1136777249 16:32878572-32878594 TGCAGCACTGTGGGTGGGGGTGG + Intergenic
1136893374 16:33982941-33982963 TGCAGCACTGTGGGTGGGGGTGG - Intergenic
1137299132 16:47129913-47129935 CCAGGAAGTGGGGTTGGGGGTGG + Intronic
1137582241 16:49640582-49640604 CGGGGGCCAGGGGGTGGGGGCGG - Intronic
1137669653 16:50271860-50271882 CAAGGCCAAGGGGGTGGGGGAGG - Intronic
1137696905 16:50467965-50467987 CGCGCCGCTGGGGGTAGGGGCGG - Intergenic
1137716708 16:50602588-50602610 AGAGGCAGAGGGTGTGGGGGGGG - Intronic
1137916508 16:52436315-52436337 GGAGGTGGTGGGGGTGGGGGGGG + Intergenic
1137926379 16:52546208-52546230 AGAAGGACTGGGGGTGGGGGAGG + Intronic
1138134939 16:54513287-54513309 CGAGCCACTGGTGGTAGGTGGGG - Intergenic
1138418798 16:56886355-56886377 CCAGGCACTGGGGGCTGAGGAGG - Exonic
1138497207 16:57415928-57415950 CCAGGCGCTCAGGGTGGGGGCGG - Exonic
1138505204 16:57475065-57475087 CCTGGCCCTGGGGGTGGGGAGGG - Intronic
1138510855 16:57507738-57507760 GGAGCCGGTGGGGGTGGGGGTGG + Intergenic
1138659477 16:58508902-58508924 CTTGGCAATGGGGGTGGGGAGGG + Intronic
1138998199 16:62478015-62478037 GGAGGCCCTGGGGCTGAGGGTGG + Intergenic
1139344446 16:66293515-66293537 CAATCCACTGGGGGTGGGGGTGG - Intergenic
1139420053 16:66844539-66844561 CGAGCCAGAGGCGGTGGGGGAGG - Intronic
1139444471 16:66988354-66988376 CGAGGCACTGGGGAGCAGGGAGG + Intergenic
1139484093 16:67246565-67246587 CGAGTGTCCGGGGGTGGGGGCGG + Intronic
1139637187 16:68264729-68264751 AGAGGCGCTGCGGGTGAGGGGGG + Intronic
1139807994 16:69585841-69585863 CCAGGAGCTGGGGGTTGGGGAGG + Intronic
1139938578 16:70588891-70588913 CCAGGGGCTGGGGGTGGGGAAGG + Intronic
1140049527 16:71467952-71467974 CGACTCAGTGGGGGGGGGGGGGG + Intronic
1140153541 16:72398438-72398460 AGAGGGAGTGGGGATGGGGGTGG + Intergenic
1140784421 16:78326578-78326600 TGAGGCATTGCGGGGGGGGGGGG - Intronic
1140864380 16:79047188-79047210 CAAGGCATTGAGGGTGGGGAGGG + Intronic
1140939496 16:79708153-79708175 GGAGGCCCTGGCGGTGTGGGAGG + Intergenic
1140991806 16:80220112-80220134 GGAGGCAGTGAGGCTGGGGGAGG + Intergenic
1141152456 16:81573624-81573646 CGGGGCCCTAGGGTTGGGGGAGG + Intronic
1141595252 16:85093248-85093270 ACAGGGGCTGGGGGTGGGGGTGG + Exonic
1141694676 16:85613843-85613865 CGAGGAAGCGGGGGTGTGGGGGG + Intronic
1141863598 16:86734639-86734661 GCAGCCAGTGGGGGTGGGGGAGG - Intergenic
1141895136 16:86954350-86954372 GGAGGCAGTGGGCGTGGGGGAGG - Intergenic
1141908176 16:87041351-87041373 TGCATCACTGGGGGTGGGGGCGG - Intergenic
1141973051 16:87495749-87495771 AGAGGGTCGGGGGGTGGGGGAGG - Intergenic
1142143133 16:88481419-88481441 GGAGGCAGCGGTGGTGGGGGTGG - Intronic
1142146872 16:88496459-88496481 GGAGTCAGTGGGGGTGGGGCGGG - Intronic
1142200312 16:88757974-88757996 AGAGGCACAGAGGGTGGCGGAGG - Intronic
1142259485 16:89036174-89036196 TGGGGGCCTGGGGGTGGGGGCGG - Intergenic
1142356230 16:89603483-89603505 GGAGGCACTGGGGGCTGGAGGGG + Intergenic
1142356532 16:89604231-89604253 GGGAGCACTGGGGGTGGGAGGGG + Intergenic
1202999769 16_KI270728v1_random:154726-154748 CGGGGAAGTGGGGGAGGGGGAGG + Intergenic
1203079663 16_KI270728v1_random:1140681-1140703 TGCAGCACTGTGGGTGGGGGTGG + Intergenic
1203131367 16_KI270728v1_random:1691126-1691148 CGGGGAAGTGGGGGAGGGGGAGG + Intergenic
1142620181 17:1160673-1160695 CGAGGCTCTGGGGAGGGAGGCGG + Intronic
1142684239 17:1568444-1568466 CTAGGCACTGGGGGTAGAGTGGG + Intergenic
1142699151 17:1649120-1649142 CGGGGCTCCGGGGGCGGGGGCGG - Intronic
1142759663 17:2035242-2035264 TGAATCACTGGGGGAGGGGGTGG - Intronic
1142874599 17:2843921-2843943 CGAGGGGTTGGGGGCGGGGGTGG + Intronic
1142875924 17:2852329-2852351 GGAGGGGGTGGGGGTGGGGGTGG + Intronic
1143027846 17:3951555-3951577 GGAGGCACTGGGGGTGGGACCGG - Intronic
1143233863 17:5381126-5381148 CCAGCTGCTGGGGGTGGGGGAGG + Intronic
1143240997 17:5443224-5443246 AGAGGGGGTGGGGGTGGGGGAGG - Exonic
1143467261 17:7145841-7145863 TGAGACAGTGGGGGTGGGGAAGG - Intergenic
1143473632 17:7191182-7191204 CCATCCACTGGGGGTGGCGGGGG + Intronic
1143480674 17:7225995-7226017 GGAGGGACTGGAGGTGGAGGTGG + Exonic
1143576722 17:7798141-7798163 CGTGTGACTGGGGGTGGGGTGGG - Exonic
1143577735 17:7804476-7804498 TGGGGCACGGGGGGTGGGCGTGG - Intronic
1143635758 17:8162998-8163020 CCGGGCACTGCGGGCGGGGGCGG + Intronic
1144206429 17:12982888-12982910 GGAGGGAGTGGGGGTGGGGTGGG + Intronic
1144343598 17:14331296-14331318 GAAGGGGCTGGGGGTGGGGGTGG - Intronic
1144677097 17:17168589-17168611 CCAGGCCCTGGAGGTGGTGGTGG + Intronic
1144754246 17:17669739-17669761 GGAGGGAGTGGGAGTGGGGGAGG - Intergenic
1144795414 17:17888067-17888089 AGCAGCACTGAGGGTGGGGGAGG + Intronic
1144815156 17:18028955-18028977 GGTGGCACTGGTGGTGGGGAGGG - Intronic
1144834539 17:18150129-18150151 AGGGGCAGTGGGGGTGGGGTGGG - Intronic
1144871716 17:18376268-18376290 AGGGGCAGTGGGGGTGGGGAGGG - Intergenic
1145266904 17:21384005-21384027 AGAAACTCTGGGGGTGGGGGAGG - Intronic
1145694529 17:26775737-26775759 CGCGGCACTGAGGGCGGGAGCGG + Intergenic
1145759043 17:27415510-27415532 CAAGGCCCTGGAGTTGGGGGAGG + Intergenic
1145871239 17:28275164-28275186 ACAGGCGCTGGGGGTGGAGGTGG + Intergenic
1145956944 17:28861264-28861286 CGTGGGATTGGGGGTAGGGGAGG - Intergenic
1146095858 17:29929938-29929960 CGAGGCGCAGGGGCTGGAGGTGG + Exonic
1146108839 17:30068688-30068710 CAAGGCACTGGGAGTGGCAGTGG + Intronic
1146307784 17:31743913-31743935 CCAGGCAGTGGGGATGGGGGTGG - Intergenic
1146456467 17:33013371-33013393 ATAGGCACTGGGGGGGAGGGAGG + Exonic
1146546673 17:33745163-33745185 GGCGGAACTGGGGGTGGGAGGGG - Intronic
1146653795 17:34623402-34623424 AGAGGGACGGGGGGGGGGGGGGG - Intronic
1146935087 17:36808289-36808311 CGCGGCTGTGGGGGTGGCGGGGG - Intergenic
1147134928 17:38428962-38428984 GGAGGGAGAGGGGGTGGGGGAGG + Intronic
1147135125 17:38429701-38429723 GGATGGACGGGGGGTGGGGGTGG + Intronic
1147183991 17:38704079-38704101 CGGGGGACTGGGGGTGGAGGAGG - Intergenic
1147210620 17:38870658-38870680 CGGGGCGCTGGTGGAGGGGGCGG + Intronic
1147250538 17:39150670-39150692 TGGGGCACTGGGGTAGGGGGTGG - Intronic
1147306898 17:39570288-39570310 TGAGGCTGTGGGAGTGGGGGAGG - Intergenic
1147320612 17:39643630-39643652 AGAGGCCCTGGGTGTGGAGGAGG - Intronic
1147341586 17:39755851-39755873 CACAGCACTGGGGGTGGTGGTGG - Intergenic
1147412628 17:40264708-40264730 CGCCGCCCTGGGGGTGGTGGGGG - Exonic
1147575738 17:41598221-41598243 GGTGGTAGTGGGGGTGGGGGTGG + Intergenic
1147635089 17:41959173-41959195 GGATGCACTGGGAGTGGGTGGGG - Intronic
1147910522 17:43853379-43853401 TGAGGCACGGGTGGTTGGGGAGG + Intronic
1148019257 17:44542562-44542584 AGAGGCCAAGGGGGTGGGGGTGG + Intergenic
1148049249 17:44761016-44761038 GCAGTCACTGGGGGTGGGGTGGG + Intronic
1148051154 17:44770492-44770514 ACAGGCAGTGGGGGCGGGGGGGG - Intronic
1148054807 17:44787647-44787669 GGAGGCGCTGGGGCTGGGGGTGG - Intergenic
1148143236 17:45342909-45342931 CTAGGCCCTGGGGGTGGGTAGGG + Intergenic
1148262087 17:46193010-46193032 CGAGGCAGAGGGGGAGGGGAAGG + Intronic
1148337455 17:46851389-46851411 CGGGGCAATGGGGGAGGGGCGGG + Intronic
1148349698 17:46931652-46931674 ACAGGCGCTGGGGGTGGAGGTGG - Intronic
1148562122 17:48612175-48612197 AGGGGCGCTGGGGGTGAGGGAGG - Intronic
1148855065 17:50574564-50574586 AAAGGGAGTGGGGGTGGGGGGGG - Intronic
1149337846 17:55655561-55655583 CTAGGCCCTGGGAGTGGGGATGG + Intergenic
1149461596 17:56833939-56833961 CAGGGCACTGCGGCTGGGGGCGG - Intronic
1149496028 17:57118070-57118092 CGAGTTGGTGGGGGTGGGGGTGG + Intronic
1150273683 17:63882490-63882512 CGTGGGGATGGGGGTGGGGGTGG + Intergenic
1150600872 17:66649850-66649872 GGAGGTACTGAGGGTGGGGAAGG + Intronic
1150620543 17:66804493-66804515 GGAGGGATTGGGGGTGGGGGAGG + Exonic
1150712577 17:67544397-67544419 GGAGGGAATGGGGGTGGGGGTGG + Intronic
1150747303 17:67825972-67825994 CGGGGCGCTGGTGCTGGGGGGGG - Exonic
1150860657 17:68797133-68797155 AGAGACACAGAGGGTGGGGGTGG + Intergenic
1151440670 17:74126856-74126878 AGAGGCGATGGGGGTGGGGGAGG - Intergenic
1151521991 17:74636871-74636893 CGAGGCAGCGGGGGTGAGGGTGG - Intergenic
1151592083 17:75052014-75052036 AAAAGGACTGGGGGTGGGGGTGG - Intronic
1151612133 17:75183068-75183090 CGTGGGACGGGGGGTGGGGGTGG - Intergenic
1151830081 17:76544405-76544427 GGAGGCGCTCAGGGTGGGGGAGG + Intronic
1151898096 17:76993964-76993986 CAAGGCCCTGGGGGAGGGTGGGG - Intergenic
1151990527 17:77571289-77571311 AGGGGCAGTGGGGGTGGGGCAGG - Intergenic
1152002720 17:77656365-77656387 CCAGGAGCTGGGGGTGGAGGTGG + Intergenic
1152097001 17:78278317-78278339 TGAGGCCCTGGGGGTGGGCAGGG - Intergenic
1152107546 17:78339922-78339944 AGAGACGGTGGGGGTGGGGGGGG - Intergenic
1152111428 17:78359545-78359567 CGAGGCACGGGGGTAGGGAGGGG + Intronic
1152164976 17:78697733-78697755 CGATGCACTGGGGTGGGGGCAGG + Intronic
1152267174 17:79301939-79301961 CTAGGGACTGGGGGAGGGGGTGG + Intronic
1152267877 17:79306778-79306800 CGTGGAGCTGGGGGTGGAGGAGG - Intronic
1152278853 17:79373375-79373397 CCAGGCACTCGGGCTGGGCGTGG + Intronic
1152302168 17:79501452-79501474 TGAGTCACTGGGGTTGGTGGGGG + Intronic
1152321284 17:79609991-79610013 CGAGGCCCTGGGGGTGGCCGAGG + Intergenic
1152699240 17:81810994-81811016 TGTTGCACTGGGGGTGTGGGGGG - Exonic
1152777990 17:82213978-82214000 CTAGACACAGGGGGTGGGGAGGG - Intergenic
1152802844 17:82339915-82339937 AGAAGCACTGGGGGAGGGGTTGG - Intergenic
1152803640 17:82344179-82344201 GGAGGCAGGGGGGGCGGGGGTGG + Intergenic
1152885508 17:82846831-82846853 CCAGGCAATGAGGGTGGGTGGGG - Intronic
1152897689 17:82922751-82922773 AGAGGCACTGGGGGCGGGGCAGG - Intronic
1153123732 18:1764347-1764369 CAGGGCAGTGGGGCTGGGGGTGG + Intergenic
1153219390 18:2847973-2847995 CGGGGCGGTGGGGGTGGGGTGGG + Intronic
1154355302 18:13619953-13619975 CTAGGGACTGAGGGTGGGAGTGG - Intronic
1154445269 18:14431009-14431031 GGAGGCGCTGGGAGTGGGAGTGG - Intergenic
1155231036 18:23775472-23775494 AGAGGGGTTGGGGGTGGGGGTGG - Intronic
1155911278 18:31507069-31507091 TGAGGCTGTGGGGGTAGGGGAGG - Intronic
1156011350 18:32501208-32501230 AGAGGAACTGGGGGTGGGCGGGG + Intergenic
1156017783 18:32565742-32565764 CTCTGCACTGAGGGTGGGGGAGG + Intergenic
1156325534 18:36071507-36071529 CAAGGGGCTGGGGGCGGGGGGGG + Intergenic
1156683078 18:39614591-39614613 CTAGGCACTGCGGGTGGAGGCGG - Intergenic
1157358962 18:46961281-46961303 AGGGGCGGTGGGGGTGGGGGTGG + Intronic
1157484146 18:48075137-48075159 TGTAGCACTGTGGGTGGGGGAGG - Intronic
1157516693 18:48316352-48316374 CTAGGGGCTGGGGGTGGAGGAGG - Intronic
1157563732 18:48665639-48665661 CCAGGGACTGGGGGTGGTGATGG - Intronic
1157593341 18:48849053-48849075 AGAGGCCCTGGGGTCGGGGGAGG - Intronic
1157700493 18:49759086-49759108 AATGGCACTGGGGGTGGGGGAGG - Intergenic
1157934165 18:51855624-51855646 CAAGGCCCTGGGGATGGGAGAGG + Intergenic
1158236796 18:55324677-55324699 CTGGGCATGGGGGGTGGGGGTGG - Intronic
1158331488 18:56367895-56367917 AGAGGGACTGGTGGTGGGCGGGG + Intergenic
1158551246 18:58438068-58438090 AGAGGCACAGGGGATGTGGGAGG - Intergenic
1159143469 18:64424689-64424711 GGTGGCAGTGGGGCTGGGGGAGG + Intergenic
1159797914 18:72867083-72867105 CGTGGAACCGGGCGTGGGGGCGG - Intronic
1159821032 18:73143722-73143744 CCAGGAACTGGGGGTGGGGACGG - Intergenic
1160571081 18:79818116-79818138 CGAGCCACAGAGGGTGGGTGTGG + Intergenic
1160662269 19:306587-306609 CAAGGCCCGGGGGGTGGGGAAGG + Exonic
1160781036 19:878082-878104 CGTGGCGCTGGGGCTGGGGCTGG - Intronic
1160789867 19:918397-918419 AGGGGCGCTGGGGGAGGGGGGGG + Intronic
1160810275 19:1010277-1010299 CGAGCCCGTGGGGGTGGGGGAGG - Exonic
1160840923 19:1146753-1146775 GGAGGCTGTGAGGGTGGGGGTGG + Intronic
1160844682 19:1161144-1161166 CTGAGTACTGGGGGTGGGGGTGG + Intronic
1160844705 19:1161203-1161225 CTGAGCACTGGGGGTGGGGGTGG + Intronic
1160915570 19:1495009-1495031 CTGGGCAGTGGGGGTGGGTGCGG - Intronic
1160949562 19:1658898-1658920 CGAGGGCCAGGGGGCGGGGGCGG + Intergenic
1160992232 19:1864499-1864521 CGCCCCACTGGGGGTGGGGAGGG + Intergenic
1161104594 19:2437053-2437075 CCAGGCCCAGGGAGTGGGGGGGG - Intronic
1161114336 19:2488394-2488416 GGGTGCATTGGGGGTGGGGGTGG + Intergenic
1161138629 19:2635285-2635307 GGAGACACTGGGGCTGGGGGTGG - Intronic
1161169656 19:2806491-2806513 CAAGCCAGTGGGGGTGGGGGAGG - Intronic
1161250625 19:3278127-3278149 CTTGGCCGTGGGGGTGGGGGTGG + Intronic
1161252035 19:3285661-3285683 CGGGGAAGGGGGGGTGGGGGCGG - Intronic
1161253851 19:3295537-3295559 GGAGGTGGTGGGGGTGGGGGTGG - Intronic
1161265469 19:3361497-3361519 AAACGCACTGGGGGTGGGGTGGG - Intronic
1161268310 19:3375367-3375389 CCGGGCAGTGGGGGTGGTGGGGG - Intronic
1161396467 19:4047362-4047384 CGAGGCCCTGGGCTGGGGGGAGG - Exonic
1161431189 19:4233317-4233339 GGCGGCAGTGGGGGCGGGGGCGG + Intronic
1161448267 19:4329818-4329840 CTTGGGGCTGGGGGTGGGGGAGG - Intronic
1161575481 19:5052344-5052366 CCAGACACTGGGGGTGGGGGTGG + Intronic
1161582088 19:5086648-5086670 AGAGGCCCTGGGGGCTGGGGGGG - Intronic
1161733219 19:5974950-5974972 GGAGGGACTGGGTGTGAGGGTGG + Intronic
1161794387 19:6378104-6378126 CCAGGCAGTGGGGGTGGCTGGGG + Intronic
1161935398 19:7368759-7368781 CCAGGCACTGGGGGTAGGAATGG + Intronic
1162021554 19:7870518-7870540 GGAGACACTGGGGGTGAGGCAGG + Exonic
1162421046 19:10566203-10566225 CGGAGCACAGGGGGTGGGGCGGG - Intergenic
1162440217 19:10687945-10687967 CGAGGCCCTGGCTGTGGGTGAGG + Intronic
1162450443 19:10751114-10751136 TGAGGCATGGGGGGTGGAGGTGG + Intronic
1162683052 19:12361667-12361689 GGAGGCAGAGGGGGAGGGGGAGG - Intronic
1162824166 19:13241347-13241369 GGAGGCACAGGGGCTGGGGGCGG + Intronic
1162917346 19:13881525-13881547 GGAGGCCCTGGGGATGGGGGTGG + Intergenic
1162932281 19:13963089-13963111 CGGGCCACTGGGGGCGCGGGCGG - Intronic
1162964469 19:14149400-14149422 GGAGGCACTGGGGTTGTGGAGGG - Exonic
1163085978 19:14979856-14979878 AGGGGGACTGGGGGTGGGCGGGG + Intronic
1163210760 19:15838463-15838485 CTGGGGATTGGGGGTGGGGGTGG + Intergenic
1163343845 19:16727374-16727396 AGAGGCACTGGAGGTGGTGGGGG + Intronic
1163598087 19:18231984-18232006 TGAGGGAGTGGGGGCGGGGGAGG + Intronic
1163810324 19:19427430-19427452 CTAAGTACTGGGGGTGGGGGTGG + Intronic
1163845861 19:19637772-19637794 CGAGACAGTGGGTCTGGGGGCGG + Intronic
1164320149 19:24137289-24137311 AGAGGGACTGGTGGTGGGTGGGG + Intergenic
1164517418 19:28948137-28948159 AGAAGCAGTGGGGGAGGGGGAGG + Intergenic
1164539757 19:29113976-29113998 CGAGGCAGTGGGGCTGGGGCTGG + Intergenic
1164574168 19:29396100-29396122 AGGGGCACAGGGGGTGGGGAGGG - Intergenic
1164647456 19:29870174-29870196 GGAGGGCCGGGGGGTGGGGGTGG - Intergenic
1164679162 19:30122396-30122418 TGGGGCAGTTGGGGTGGGGGCGG - Intergenic
1164846572 19:31437847-31437869 CCAGGTATTGGGGTTGGGGGTGG - Intergenic
1164954442 19:32369903-32369925 CCAGGGGCTGGGGGTGGGGAGGG - Intronic
1165177872 19:33943278-33943300 CGAGGCACTGGGAGCTGTGGTGG - Intergenic
1165225389 19:34351293-34351315 GGAGGAGCTGGGGGTGGAGGTGG - Intronic
1165248761 19:34513532-34513554 GGGGACACTGGGGGTGGTGGTGG + Intergenic
1165273895 19:34732514-34732536 GGGGACACTGGGGGTGGTGGTGG - Intergenic
1165305548 19:35000620-35000642 CGGGGCGATCGGGGTGGGGGCGG + Intronic
1165362745 19:35346716-35346738 AGAGGCACTGGGGGCAGCGGGGG + Exonic
1165420674 19:35720638-35720660 GGGGACACTGGGGGTGGTGGTGG - Exonic
1165528771 19:36379121-36379143 CGAGGCAATGGGCGCGGGGGTGG - Intronic
1165712610 19:38022961-38022983 TCAGTCACTGCGGGTGGGGGTGG - Intronic
1165807145 19:38587440-38587462 TAAGGCACTTGAGGTGGGGGTGG - Intronic
1165893119 19:39126437-39126459 CGGGGGACGGGGGGGGGGGGGGG + Intronic
1165937359 19:39397558-39397580 CCAGGTACTGTGGGTAGGGGAGG - Exonic
1166103029 19:40582547-40582569 CCAGGCTTAGGGGGTGGGGGTGG - Intronic
1166109512 19:40613673-40613695 CGAGGCAGTGAGGGGGGGCGGGG + Intronic
1166121876 19:40691299-40691321 AGAGGCACTGTGTGTGTGGGAGG + Intergenic
1166184843 19:41133346-41133368 CGAGCCAGTGGGCGGGGGGGGGG - Intergenic
1166302659 19:41921233-41921255 GGAGGAACTGGAGGTTGGGGTGG + Intronic
1166304280 19:41928738-41928760 TGAGGGAGTGGGGGTGGGGCGGG + Intronic
1166355477 19:42224935-42224957 GGAGGCAGTGGTGTTGGGGGAGG - Exonic
1166355745 19:42226240-42226262 TGAGGCTCTGGAGGTGGGGGTGG - Exonic
1166361171 19:42253663-42253685 AGGGGCCCTGGGGGTGGGGCCGG - Intronic
1166367930 19:42286640-42286662 AGAGGCTCTGGTGTTGGGGGTGG + Intronic
1166384136 19:42370835-42370857 AGAGGAACCGGGGGGGGGGGGGG + Intronic
1166581770 19:43906988-43907010 AGAGGCAGTGGGGTTGGGAGGGG - Intergenic
1166690844 19:44820627-44820649 GGAGGAACTGAGGATGGGGGTGG - Intronic
1166807279 19:45494811-45494833 AGCGGCCCTGGGGGCGGGGGCGG + Exonic
1166812410 19:45522369-45522391 GGAGGTCCTGGTGGTGGGGGTGG - Exonic
1166855630 19:45781519-45781541 CGAGACTTTGGGGCTGGGGGTGG + Intronic
1166874816 19:45890867-45890889 GGTGGCGGTGGGGGTGGGGGTGG + Exonic
1166965399 19:46526845-46526867 CCATTCCCTGGGGGTGGGGGTGG - Intronic
1167103627 19:47418691-47418713 AGAGAGACTGCGGGTGGGGGAGG + Intronic
1167134425 19:47608661-47608683 CCCGGGACTGGGGCTGGGGGCGG + Intronic
1167294951 19:48644563-48644585 GGAGGCCCTGGGGGTGGGGTCGG + Exonic
1167328123 19:48837398-48837420 CGAGGGAGTGGGCGTGGAGGAGG - Exonic
1167421682 19:49407547-49407569 AAAGACACTGGGGGTGGTGGTGG - Intronic
1167465879 19:49651011-49651033 GGGGGCGGTGGGGGTGGGGGAGG - Exonic
1167566516 19:50260988-50261010 TGAGGAAGCGGGGGTGGGGGCGG - Intronic
1167665472 19:50820925-50820947 GGAGGCCCTGGGGGAGGGTGGGG + Intronic
1167684823 19:50949797-50949819 CGGGGAAGTGGGGGTGGGGGTGG - Intronic
1167703663 19:51065762-51065784 TGAGCCACTGGGGGTGGAGAGGG - Intergenic
1167741366 19:51326625-51326647 CGGGTCAATGGGGGTGGGGTGGG - Intronic
1168125237 19:54279164-54279186 TGAGGCACCGGGGGAGAGGGAGG - Intronic
1168307257 19:55442400-55442422 GGGGGCGCTGGGGGTGCGGGCGG - Exonic
1168477020 19:56683677-56683699 ATGGGCACTGGGGGTGGGGAAGG + Intergenic
1168489562 19:56796662-56796684 CCAGGCAGTGGGGGGTGGGGAGG + Intronic
1168703931 19:58457512-58457534 GGAGGGGGTGGGGGTGGGGGCGG - Exonic
925215227 2:2088528-2088550 CCAGGCACTGGTGGTGGATGAGG + Intronic
926049843 2:9737682-9737704 GGGGGCACTGGGGGAGTGGGAGG - Intergenic
926075319 2:9938129-9938151 GGTGGCCCTGGGGGTGGCGGGGG - Intergenic
926240052 2:11078509-11078531 CCAGGGGCTGGGGGTGGAGGAGG + Intergenic
926702605 2:15813751-15813773 AGGGGCAGTGGGGGTGGGGATGG + Intergenic
926783538 2:16497965-16497987 AGAGGTGGTGGGGGTGGGGGTGG + Intergenic
927173896 2:20392092-20392114 CTAGGCTGTGGGGGGGGGGGGGG + Intergenic
927669798 2:25059562-25059584 CCAGGGACTGCGGGGGGGGGGGG + Intronic
927678697 2:25125595-25125617 CGAGGAACTGTGGCTGGAGGTGG - Intronic
927681075 2:25139383-25139405 TTAGGCACAGGGGTTGGGGGGGG + Intronic
927717195 2:25360427-25360449 GGGGGGGCTGGGGGTGGGGGTGG - Intergenic
927817588 2:26232956-26232978 CCAAGAACTGGGGGTGGGGTGGG + Intronic
927928154 2:27027117-27027139 CGAGGGGCAGGGGGTGGGGAGGG - Exonic
927943999 2:27123790-27123812 CGGGGCACCGGCGGTGGGCGGGG + Intronic
927964011 2:27258052-27258074 AGAGTCTCTGCGGGTGGGGGGGG + Exonic
927988335 2:27429025-27429047 CGGGGCCCGGCGGGTGGGGGCGG + Intronic
928025592 2:27736210-27736232 CAAGGCCCTGGGGCTGAGGGAGG - Intergenic
928081503 2:28316401-28316423 GGTGGGAGTGGGGGTGGGGGTGG + Intronic
928170081 2:28997980-28998002 CCAGGCTCTGGTGTTGGGGGTGG + Intronic
929031862 2:37656982-37657004 CGGGGGGCGGGGGGTGGGGGGGG - Intronic
929567649 2:42999781-42999803 CAATTCACTGGGGGTTGGGGTGG + Intergenic
929722887 2:44389035-44389057 AGAGGAACTGGTGGTGGGCGGGG + Intronic
929739341 2:44587445-44587467 AGAGGGACAGGGGGAGGGGGAGG - Intronic
930046406 2:47176518-47176540 TGAGGCGCTGGGGGCGGAGGAGG - Exonic
930150345 2:48053024-48053046 CGTGGGATTGGGGGAGGGGGAGG - Intergenic
930239960 2:48925870-48925892 CGTGGGATTGGGGGAGGGGGAGG + Intergenic
930248854 2:49013122-49013144 TGAGAAAGTGGGGGTGGGGGGGG - Intronic
930666024 2:54099437-54099459 CCAGGGTCTGGGGGTGGGAGTGG - Intronic
930919197 2:56730817-56730839 TGAGAGGCTGGGGGTGGGGGCGG + Intergenic
931586973 2:63840439-63840461 CGGGGCAATGGGGATGGTGGTGG + Intergenic
931652288 2:64479277-64479299 AGAGACACTGGGGATGGGGCTGG + Intergenic
931893470 2:66702303-66702325 GGAGGCTCTGGGTTTGGGGGTGG - Intergenic
931910032 2:66889225-66889247 AGAGGGGGTGGGGGTGGGGGGGG - Intergenic
932222623 2:70011410-70011432 TGAGGCAGTGGTGGTGGGGCTGG + Intergenic
932343981 2:70983922-70983944 TGAGACAATGGCGGTGGGGGAGG + Intronic
932375897 2:71235633-71235655 CTGGCTACTGGGGGTGGGGGTGG + Intergenic
932559536 2:72855081-72855103 TGGGGCACTGGGGGGGGTGGGGG + Intergenic
932567140 2:72917421-72917443 CGAGGGACGGCGGGTGGGGAGGG - Intronic
932629323 2:73324856-73324878 AGTGGCAGTGAGGGTGGGGGTGG - Intergenic
932735647 2:74252293-74252315 GGAGGCAATGGAGGTGGTGGTGG - Exonic
933255143 2:80072312-80072334 GGACATACTGGGGGTGGGGGAGG - Intronic
933289031 2:80416041-80416063 CTAGGGGCTGGAGGTGGGGGTGG + Intronic
933367179 2:81367731-81367753 GGAGGGACCCGGGGTGGGGGAGG - Intergenic
933666932 2:84971487-84971509 CGAGGCCCGGGAGGTGCGGGTGG - Intronic
933780775 2:85799446-85799468 CTGTGCCCTGGGGGTGGGGGAGG + Intergenic
934187110 2:89756866-89756888 GGAGGCACTGGCAGTGGGCGGGG + Intergenic
934304579 2:91810365-91810387 CGCGGCACGGTGGGCGGGGGGGG - Intergenic
934328678 2:92042385-92042407 CGCGGCACGGTGGGCGGGGGGGG + Intergenic
934467092 2:94273028-94273050 CGCGGCAGCGGGGGCGGGGGCGG + Intergenic
934478005 2:94605690-94605712 GGAGGCAGTGGGGCTTGGGGTGG + Intergenic
934661549 2:96146016-96146038 CCAGGCAATGGGGGGTGGGGAGG - Intergenic
934765226 2:96876751-96876773 AGGGGCACTGGTGGTGGGGTGGG + Intronic
934864346 2:97792595-97792617 TGAGGCACTGGCGGTGGCAGAGG + Exonic
934869349 2:97847062-97847084 CCAGCTACTGGGGGGGGGGGGGG + Intronic
935713350 2:105918252-105918274 GGAAGGAGTGGGGGTGGGGGAGG + Intergenic
936111790 2:109670961-109670983 CCAGGCACTGGGGCCTGGGGTGG - Intergenic
936245221 2:110820549-110820571 AGAGGGAGTGGGGGTGGGGCTGG + Intronic
936646601 2:114379035-114379057 GCAGCCACTGGGGGTGAGGGTGG + Intergenic
937085706 2:119170387-119170409 GCAGGCACTGGGGGGGTGGGCGG + Intergenic
937122334 2:119449568-119449590 CTGGGCACTGGGGTTGGGGGAGG - Intronic
937236010 2:120432347-120432369 CAAGCCTGTGGGGGTGGGGGCGG - Intergenic
937310796 2:120902187-120902209 CAAGGGGTTGGGGGTGGGGGGGG - Intronic
937403346 2:121605120-121605142 GTAGGGAGTGGGGGTGGGGGTGG - Intronic
937649548 2:124304854-124304876 CGAGGCACTTGGGTTCGCGGAGG + Intronic
937746235 2:125418719-125418741 CCAGGGACTGGGGGAGGGGAAGG + Intergenic
937953963 2:127408676-127408698 GGAGGAGCTGGGGGTGGTGGTGG - Intergenic
937982063 2:127621643-127621665 GAAGGCACTGGGGTTGGGGGTGG + Intronic
938015146 2:127860618-127860640 TGTGGGAGTGGGGGTGGGGGAGG - Intergenic
938108820 2:128550960-128550982 CAGGACAGTGGGGGTGGGGGAGG + Intergenic
938289983 2:130143906-130143928 CGGGGCAGGAGGGGTGGGGGAGG + Intronic
938466541 2:131529031-131529053 CGGGGCAGGAGGGGTGGGGGAGG - Intronic
938498774 2:131818892-131818914 GGAGGCAGTGAGGCTGGGGGAGG - Intergenic
938571993 2:132569620-132569642 TGGGGCAGTGGGGGTGGGGGGGG + Intronic
938779856 2:134575327-134575349 GTGGGCACTGGGGGTGGGGTAGG - Intronic
938859645 2:135354758-135354780 CCAGGGGCTGGAGGTGGGGGAGG + Intronic
938971706 2:136438922-136438944 AGAGGCCTTGGGGGGGGGGGGGG - Intergenic
939475298 2:142678995-142679017 AGAGGGAGTTGGGGTGGGGGAGG + Intergenic
940344905 2:152619113-152619135 GGAGGCAGTGGTGGTGGAGGAGG - Exonic
940892873 2:159052032-159052054 TGAGGCAGTGGGGGCGGGAGAGG + Intronic
941007476 2:160262785-160262807 TGAGGCACTAGGAGTGGGGCTGG + Intronic
941028153 2:160481220-160481242 TGGGGCACCGGGGGTGGGCGAGG + Intronic
941178924 2:162235128-162235150 CGGGGGACTGGGGGAGTGGGGGG - Intronic
941604712 2:167582989-167583011 CAAGTCACTAGGGGTGGGGTGGG - Intergenic
941627462 2:167845206-167845228 AGAGGAACTGGTGGTGGGTGGGG - Intergenic
941647761 2:168059437-168059459 CGAGGCCTTGGGAGTGAGGGTGG + Intronic
942079286 2:172385119-172385141 GGAGGCAGGTGGGGTGGGGGCGG - Intergenic
944168037 2:196743567-196743589 GGATGGAGTGGGGGTGGGGGTGG - Intronic
944414986 2:199471357-199471379 CGGGGCCGTGGGGGTGGTGGGGG - Intergenic
944617128 2:201472565-201472587 CCAGGGACTGGGAGTGGGGATGG + Intronic
945255694 2:207801258-207801280 TGAGGAACTGGGGTTGGTGGGGG - Intergenic
945955738 2:216084170-216084192 CCAGGCAGATGGGGTGGGGGAGG - Intronic
946190918 2:218007552-218007574 TGAGGCTCGGGGGGTGGGGGGGG + Intergenic
946192750 2:218016124-218016146 GGAGCGGCTGGGGGTGGGGGTGG - Intergenic
946280571 2:218663040-218663062 CAAGGCACTAGGGGAGGAGGTGG - Intronic
946328029 2:218994727-218994749 GGCGGCGGTGGGGGTGGGGGTGG + Intergenic
946329673 2:219002142-219002164 CGAGGCCTTGGTGGCGGGGGCGG + Intergenic
946386382 2:219386873-219386895 CAAGGTACTGGGGGTGGGGTGGG - Exonic
946391565 2:219419502-219419524 TGAGGCCCTGGGGGAGGTGGGGG + Intronic
947118339 2:226795116-226795138 TGAGGGGGTGGGGGTGGGGGAGG + Exonic
947749471 2:232525025-232525047 CAGGCCACTGGGGGTGGTGGTGG + Intronic
947852806 2:233302006-233302028 CGGGGCAGGGGAGGTGGGGGCGG - Intergenic
947914707 2:233823672-233823694 TGAGGCACCGGGTGTGGGCGGGG + Exonic
948122699 2:235543101-235543123 CGAGGGGCAGGGGGCGGGGGGGG - Intronic
948126439 2:235567731-235567753 CGTGGCACTGGGGGGTGGGCAGG + Intronic
948152465 2:235755089-235755111 GGAGGCACTGGGGGCTGGGGCGG + Intronic
948349023 2:237323031-237323053 CAAGTCAATGGGGGTGGCGGGGG + Intergenic
948478328 2:238235417-238235439 GGTGTCACTGGGTGTGGGGGCGG + Intergenic
948662082 2:239513932-239513954 CTTGGCACTGGGAGTGGGGGTGG + Intergenic
948768151 2:240233805-240233827 CGAGGCACTGTGGGCAGGGCCGG - Intergenic
948768160 2:240233833-240233855 AGAGGCACTGTGGATGGGGCGGG - Intergenic
948800331 2:240430534-240430556 CCATGGGCTGGGGGTGGGGGGGG - Intergenic
948995767 2:241577514-241577536 GGAGGCACTCGGGGGAGGGGGGG - Intergenic
1168848106 20:959058-959080 CAAGTCACTGGTGGTGGGTGTGG + Exonic
1168883257 20:1225650-1225672 CGAGGGACTGGGCGCGGCGGCGG - Intergenic
1168977165 20:1975406-1975428 CTTGGAGCTGGGGGTGGGGGCGG + Intergenic
1169084969 20:2820916-2820938 AGTGGGGCTGGGGGTGGGGGAGG + Intergenic
1169196781 20:3687452-3687474 CCAGTCCCTGGGGGTAGGGGGGG + Exonic
1169211012 20:3766439-3766461 TGAGGTGCTGGGGGTGGGGGTGG + Intronic
1169250696 20:4058785-4058807 GGAGGAACTGGGGATTGGGGAGG + Intergenic
1169915673 20:10680839-10680861 CCAGGGCCTGGGGGTGGGTGAGG - Intergenic
1170007790 20:11687315-11687337 CGGGGCGCTGGGGGAGGGGACGG + Intergenic
1170336405 20:15275042-15275064 GGGGTGACTGGGGGTGGGGGAGG + Intronic
1170870211 20:20199189-20199211 CTAGGAAGTGGGGGTGGGTGTGG - Intronic
1171011967 20:21513769-21513791 GGAGGGACTGGGGGAGGGGAGGG + Exonic
1171073046 20:22094032-22094054 TCATGCAGTGGGGGTGGGGGGGG - Intergenic
1171102698 20:22400424-22400446 CCAGGGGCTTGGGGTGGGGGTGG - Intergenic
1171210098 20:23310363-23310385 TGAGGAAGTGGGGGTGGGGTGGG - Intergenic
1171300828 20:24058958-24058980 AGAGGAACTGGGAGTGTGGGAGG + Intergenic
1171322930 20:24262323-24262345 AGCCACACTGGGGGTGGGGGTGG - Intergenic
1172240786 20:33411317-33411339 CGTGGGACTGGGGGTGGGGGTGG - Intronic
1172304667 20:33872348-33872370 GGAGGAGTTGGGGGTGGGGGTGG + Intergenic
1172311451 20:33921455-33921477 TGAGGCAGTGGTGGTGGTGGTGG - Intergenic
1172313608 20:33936469-33936491 CTAAGCCGTGGGGGTGGGGGGGG + Intergenic
1172573979 20:35992745-35992767 CCAGGGTCGGGGGGTGGGGGAGG - Intronic
1172944091 20:38674557-38674579 CGGGGCTCTGGGGGCGGGGTGGG - Intergenic
1173266289 20:41485679-41485701 CCAGGGACTGGGGGGTGGGGCGG + Intronic
1173619452 20:44425583-44425605 CAAGACACTGGGTCTGGGGGTGG + Intronic
1173626507 20:44476540-44476562 CCCGGCACTGGGGGTGGCAGTGG + Intronic
1173641303 20:44604019-44604041 GGATGAATTGGGGGTGGGGGTGG + Intronic
1173666948 20:44769760-44769782 GGAGGGGCTGGGGGTGGGGAAGG + Intronic
1173844129 20:46177402-46177424 CAAGTCATTGGTGGTGGGGGAGG - Intronic
1173911421 20:46673760-46673782 CCAGGCACTGGGAGTGTGGCAGG - Intronic
1173916859 20:46714352-46714374 CTGGGCACTGAGGGTGGAGGTGG + Intronic
1173930132 20:46811322-46811344 GGGGGCCCGGGGGGTGGGGGCGG - Intergenic
1174317465 20:49713766-49713788 CGAGGCCCAGGCGGTGGCGGCGG - Exonic
1174390634 20:50216503-50216525 GGGGGCACTGGGGGGTGGGGTGG + Intergenic
1174456057 20:50649589-50649611 CCAGTCCCTGTGGGTGGGGGTGG - Intronic
1174593896 20:51668121-51668143 CGAGGGGCTGGGGGAGGGGAGGG + Intronic
1174597555 20:51696215-51696237 CGAGGGGTTGGGGGTGGGGGCGG - Intronic
1174703024 20:52628263-52628285 AGAGGAATTGGGGATGGGGGAGG - Intergenic
1174958079 20:55123388-55123410 GGATGCAGTGGAGGTGGGGGAGG + Intergenic
1174979203 20:55373660-55373682 CGAGGCACTGGGGATAGGCAGGG - Intergenic
1175013821 20:55766648-55766670 CCAGGGAGTGGGGGTGGTGGTGG + Intergenic
1175100588 20:56576115-56576137 GGTGGCACTGGAGGTGGGAGAGG - Intergenic
1175587876 20:60159858-60159880 CCAGGCTCTGTGGTTGGGGGCGG + Intergenic
1175730373 20:61350108-61350130 TGCAGCACTGGGGGAGGGGGAGG - Intronic
1175730393 20:61350185-61350207 TGCAGCACTGGGGGAGGGGGAGG - Intronic
1175730412 20:61350262-61350284 TGCAGCACTGGGGGAGGGGGAGG - Intronic
1175730433 20:61350339-61350361 TGCAGCACTGGGGGAGGGGGAGG - Intronic
1175730453 20:61350416-61350438 TGCAGCACTGGGGGAGGGGGAGG - Intronic
1175730473 20:61350493-61350515 TGCAGCACTGGGGGAGGGGGAGG - Intronic
1175951119 20:62583880-62583902 CGTGGCAATGGGTGCGGGGGTGG + Intergenic
1176035398 20:63033884-63033906 CACGGGGCTGGGGGTGGGGGTGG + Intergenic
1176106978 20:63394050-63394072 CGAGGACTTGGGGTTGGGGGAGG + Intergenic
1176146446 20:63567621-63567643 GGCGGCACTGCGGGAGGGGGAGG + Exonic
1176159658 20:63641844-63641866 CGGGGCACTGGGCGGGGGCGGGG - Intronic
1176159713 20:63641969-63641991 CGGGGCACTGGGCGGGGGCGGGG - Intronic
1176363149 21:6015760-6015782 TGAGGTGCTGGGGGTGGGGAGGG - Intergenic
1176450722 21:6858854-6858876 GGAGGCGCTGGGAGTGGGAGTGG + Intergenic
1176586877 21:8595709-8595731 CGCGGCAGCGGGGGGGGGGGGGG - Intergenic
1176703747 21:10093203-10093225 AGAGGGAGTGGGGGTGGGAGGGG + Intergenic
1176828891 21:13723872-13723894 GGAGGCGCTGGGAGTGGGAGTGG + Intergenic
1177179199 21:17726645-17726667 CCAGGCACTGGGAGTGTTGGTGG - Intergenic
1177197436 21:17918145-17918167 AGAGAAACTGGGGGTGAGGGGGG + Intronic
1178059404 21:28835107-28835129 GGAGGAACTGGTGGTGGGTGGGG - Intergenic
1178127485 21:29530694-29530716 CCAGTCACTGGGAGTGGTGGTGG + Intronic
1178933030 21:36836037-36836059 CGTGGCACTGGGGATAGGAGTGG - Intronic
1179534952 21:42045370-42045392 TGAGGCTGTGTGGGTGGGGGTGG + Intergenic
1179590686 21:42405975-42405997 CTAGGCAGTGGGGGGGGGGGGGG + Intronic
1179720397 21:43313246-43313268 GGAGGTGCTGGGGGCGGGGGTGG - Intergenic
1179760369 21:43522785-43522807 TGAGGTGCTGGGGGTGGGGAGGG + Intergenic
1179874918 21:44262556-44262578 TTAGGGAGTGGGGGTGGGGGTGG + Intergenic
1179882432 21:44299052-44299074 GGAGGCCCGTGGGGTGGGGGGGG - Intergenic
1179887903 21:44322255-44322277 CCAGGCCCTGCAGGTGGGGGCGG + Intronic
1180005511 21:45018889-45018911 CGGGGCCCTGCGGGTGGGGCTGG - Intergenic
1180038683 21:45264669-45264691 CGGGGCAGTCGGGGTGAGGGTGG + Exonic
1180703334 22:17793692-17793714 CGAGGCAGTGGGGATGGGGTTGG + Intronic
1180935922 22:19625456-19625478 CCAGGCTCTGGGGGTGGGCCGGG - Intergenic
1180951355 22:19722073-19722095 CCAGGCTCTGGGGGAGGGGGGGG - Intronic
1181031637 22:20150932-20150954 GGGGACACTGGGGGTGGGGGTGG + Intergenic
1181085651 22:20438202-20438224 CGAGGCGCTGGGAGCGGGGGTGG - Intronic
1181164633 22:20976773-20976795 CAAGGCACTGGGTGCTGGGGTGG - Intronic
1181168382 22:20995113-20995135 CCAGGCCCTCGGGGTGGGGGTGG + Intronic
1181487677 22:23241774-23241796 TGTGGCACTGGAGGTGGGGCAGG - Intronic
1181669726 22:24420469-24420491 CTTGGGCCTGGGGGTGGGGGAGG + Intronic
1181669736 22:24420519-24420541 CAAGGCTGTGGGGCTGGGGGAGG - Intronic
1181966199 22:26658068-26658090 CTCGGAACTGGAGGTGGGGGTGG + Intergenic
1181975403 22:26725529-26725551 CCAGGGACTGGGGGGGGCGGTGG - Intergenic
1181985972 22:26800053-26800075 AGAGAGACTGGGGGTTGGGGTGG + Intergenic
1182024688 22:27108877-27108899 CGAGGCAGCCAGGGTGGGGGCGG - Intergenic
1182093201 22:27609702-27609724 GCAGGGAGTGGGGGTGGGGGCGG + Intergenic
1182103021 22:27670883-27670905 GGAGGCCCTGCGGGTGGGGGCGG - Intergenic
1182309037 22:29391773-29391795 CCTTGCACTGGGCGTGGGGGTGG - Intronic
1182357268 22:29727843-29727865 CTGGGCCCTGGGGGTGGGGCAGG + Intronic
1182380525 22:29883543-29883565 GGAGGCGCTGGGTGTGGGAGTGG + Intronic
1182541688 22:31046546-31046568 TGAGGCTCTGGGGCCGGGGGAGG - Intergenic
1182743015 22:32582549-32582571 AGACGGGCTGGGGGTGGGGGTGG + Intronic
1182862174 22:33569706-33569728 TGGGGCTGTGGGGGTGGGGGTGG - Intronic
1182993296 22:34789125-34789147 GGCGGCACTGAGGCTGGGGGAGG + Intergenic
1183314495 22:37129452-37129474 GGAGGCGGAGGGGGTGGGGGTGG - Intronic
1183369241 22:37423163-37423185 CGAGGCACTGTGGGAGGGCCAGG + Intronic
1183438353 22:37808219-37808241 GGAGGTCCTGGAGGTGGGGGTGG + Intronic
1183684469 22:39353597-39353619 TGAGGCACAGAGGGTGGGGAGGG - Intronic
1183706192 22:39476174-39476196 ACAGGGACTGGAGGTGGGGGAGG + Intronic
1184086927 22:42270753-42270775 CGGGGCGCTGGGGGCGGGGCCGG + Intronic
1184108717 22:42383214-42383236 AGAGGCCCAGGAGGTGGGGGAGG + Exonic
1184298925 22:43543541-43543563 CCAGGCTCTGGGGGAGGGGAAGG + Intronic
1184473939 22:44710699-44710721 AGAGGTCCTGGGTGTGGGGGAGG + Intronic
1184756171 22:46517136-46517158 TGAGGCAGTGGGGGATGGGGAGG - Intronic
1184766496 22:46575368-46575390 CAAGGCTCTGGGGGAGGGGGGGG - Intergenic
1184775244 22:46619831-46619853 CACTGCAGTGGGGGTGGGGGAGG + Intronic
1184800297 22:46754897-46754919 GGTGGCAGTGGGGGTGGGGAGGG - Intergenic
1184866128 22:47202635-47202657 GGAGGCTCTGGGCCTGGGGGTGG + Intergenic
1185003064 22:48257940-48257962 CCAGGGAGTGGCGGTGGGGGTGG - Intergenic
1185023047 22:48391584-48391606 GAAGGCCCTGGGGGTGGGTGCGG + Intergenic
1185080380 22:48706349-48706371 CGAGGAACTGTGAGTGGGCGAGG + Intronic
1185258646 22:49849717-49849739 GGAGGCGCTCGGGGTTGGGGAGG - Intergenic
1185285879 22:49999711-49999733 CGGGGCGCGGGGGGTGGGCGGGG + Intronic
1185287635 22:50009630-50009652 CCAGGCTGTCGGGGTGGGGGTGG + Intronic
1185315749 22:50178429-50178451 CGGGGGACTGGGGGTGGGAGAGG + Intronic
1185325726 22:50225065-50225087 TGAGAGCCTGGGGGTGGGGGAGG - Intronic
1203255432 22_KI270733v1_random:135394-135416 CGTGGTGGTGGGGGTGGGGGGGG + Intergenic
949129564 3:483607-483629 CGGGGTAGTGGGGGCGGGGGGGG + Intergenic
949253482 3:2016696-2016718 CAAGGCACTGTGGGTGTGGCCGG - Intergenic
949970888 3:9403047-9403069 GGAGGCAATGTTGGTGGGGGAGG + Intronic
950091920 3:10301760-10301782 GGAAGCTCTGGGGGTGGGGCTGG + Intronic
950115790 3:10449673-10449695 CGGGTCCCGGGGGGTGGGGGTGG + Exonic
950171838 3:10844173-10844195 AGAGTCACTGGGGCTGGGGCTGG - Intronic
950205119 3:11074196-11074218 ACAGGAACTCGGGGTGGGGGGGG - Intergenic
950377024 3:12580454-12580476 CGTCTCACTGGGGGTGGTGGCGG - Intronic
950484568 3:13265388-13265410 TGAGGGAGTGGGGGTGGAGGTGG - Intergenic
951580940 3:24161832-24161854 CGAGGAGATGGGGGTGGGGGTGG - Intronic
952115004 3:30168469-30168491 AGTGGGCCTGGGGGTGGGGGTGG - Intergenic
953061556 3:39432341-39432363 GAGGGCACTGGGGCTGGGGGTGG + Intergenic
953409758 3:42684123-42684145 CGGGGGAGTGGGGGAGGGGGTGG - Intergenic
953657056 3:44862202-44862224 CGGGGCTCTTGGGGTGGGGCGGG + Intronic
953878317 3:46678912-46678934 CGAGGCACTGGTACTGGTGGAGG + Intronic
954241273 3:49295735-49295757 CTAGGCATTTGGGGAGGGGGGGG - Intronic
954294152 3:49664897-49664919 CGAGGCACTGGGGGTGGGGGTGG + Intronic
954476502 3:50751414-50751436 CCAGGCATTGGGGGAAGGGGAGG - Intronic
954581022 3:51702983-51703005 CCAGTCATTGGGGGTGGGGTGGG + Intronic
954691056 3:52395848-52395870 CAGGTAACTGGGGGTGGGGGTGG - Intronic
954816443 3:53285108-53285130 TTAGACCCTGGGGGTGGGGGTGG + Exonic
955345481 3:58158097-58158119 GCTGGCACTTGGGGTGGGGGTGG + Intronic
955672994 3:61421449-61421471 ACAGGGAATGGGGGTGGGGGGGG - Intergenic
955780525 3:62479357-62479379 CGAGGAAGTGGGTGGGGGGGAGG - Intronic
955934764 3:64091922-64091944 GGAGGCGATGGGGGCGGGGGCGG + Intergenic
956052570 3:65264348-65264370 CAAGGGAGTGGGGGTGTGGGTGG + Intergenic
956080302 3:65549667-65549689 CAAGGCCCTGAGGATGGGGGCGG - Intronic
956519617 3:70089530-70089552 AGATGGACGGGGGGTGGGGGTGG + Intergenic
956710249 3:72032709-72032731 ATAGAAACTGGGGGTGGGGGTGG + Intergenic
957941975 3:87017533-87017555 GGAGGCAGTGAGGCTGGGGGAGG + Intergenic
958622387 3:96577662-96577684 AGAGGTAATGGGGGTGGGGAAGG - Intergenic
958711216 3:97719092-97719114 CGCGGCGGGGGGGGTGGGGGGGG - Intronic
958736592 3:98016365-98016387 GGAGGAATGGGGGGTGGGGGAGG - Intronic
958847078 3:99278101-99278123 CCAGGCACTGGGGGAGGGAGAGG + Intergenic
958969915 3:100600497-100600519 AGAGGAACTGGTGGTGGGCGGGG + Intergenic
959298460 3:104568922-104568944 CTAAGAACTGGGGGGGGGGGGGG - Intergenic
959744037 3:109755761-109755783 AGAGGAACTGGGGCAGGGGGTGG - Intergenic
959783261 3:110262127-110262149 CCAGGAGCTGGGGGTGGGTGCGG + Intergenic
959899075 3:111639593-111639615 AGAGGGACTGGTGGTGGGCGGGG - Intronic
959926146 3:111924078-111924100 CAAAGGACTGGGGTTGGGGGAGG - Intronic
959997302 3:112693588-112693610 AGAGGAACTGGTGGTGGGTGGGG - Intergenic
960567170 3:119146136-119146158 CCAGGCACTGTGGGTGGGGTTGG - Exonic
960944119 3:122954364-122954386 CAAGGGTCTGGGAGTGGGGGTGG - Intronic
961199209 3:125030751-125030773 GGAGGCATGGAGGGTGGGGGAGG + Intronic
961322133 3:126083766-126083788 CCAGGCGCTGGGGGTCGCGGGGG - Intronic
961386678 3:126526791-126526813 CTGGGCACTGGGGATGAGGGTGG - Intronic
961455576 3:127022351-127022373 GGGGGCACTGGGGTTGGGGGAGG + Intronic
961664184 3:128486152-128486174 CCAGGGGCTGGGGGTGGGAGCGG - Exonic
961746205 3:129064967-129064989 AGAGGCACTGAGGCTGGGGCTGG - Intergenic
961868010 3:129968112-129968134 CGAGATCCAGGGGGTGGGGGTGG + Intergenic
962009795 3:131381834-131381856 CGAGGCCCTGGCGCTGGGGTCGG + Exonic
962332016 3:134486404-134486426 CGAGGGACTGGGCTTCGGGGCGG - Intronic
962404728 3:135091208-135091230 TGAGGCAGTTGGGATGGGGGTGG + Intronic
962477025 3:135763759-135763781 TGAGGCACTGGGTGTAGTGGTGG + Intergenic
962527735 3:136251444-136251466 GGAGGCACTGGGGGAGGGATGGG + Intronic
962657377 3:137561587-137561609 CGTGGGGTTGGGGGTGGGGGCGG + Intergenic
962676647 3:137763054-137763076 CGAGGGGCTAGGAGTGGGGGAGG - Intergenic
962685075 3:137839828-137839850 CCATGCACCCGGGGTGGGGGTGG + Intergenic
962809087 3:138946601-138946623 CCAGGCAAGGGCGGTGGGGGTGG - Exonic
963183516 3:142387305-142387327 CTCGTCACTGGGGGTGGGGAGGG + Intronic
963891567 3:150641281-150641303 CCAGCCACTCGGGGTTGGGGTGG + Intergenic
965380998 3:167987806-167987828 TGGGGCACTGGGGGTGGGGTGGG + Intergenic
965596818 3:170418923-170418945 CGGGACACTGGAGGTGGAGGTGG - Exonic
966300992 3:178479906-178479928 GGAGGCAGTCGGGGTGGGGGTGG - Intronic
966331612 3:178821148-178821170 AGAGGAATTGAGGGTGGGGGTGG - Intronic
966645912 3:182246152-182246174 CCAGGCACTGGGTGTGGGGTGGG + Intergenic
966690017 3:182732332-182732354 AAGGGCACTGGGGGTGGGGGTGG - Intergenic
967271443 3:187736796-187736818 TGCGGCATTTGGGGTGGGGGTGG - Intronic
967388110 3:188929859-188929881 GGAGGCACTGTGGATGGCGGGGG - Intergenic
968133125 3:196203745-196203767 CGATGCACTGAGGCTGGGGAGGG + Intronic
968284749 3:197501965-197501987 TGAGCCACTGGGGGTGGCTGAGG - Intergenic
968441781 4:627972-627994 CATGGCACTGGGGGTGGGGGTGG - Intronic
968505214 4:968243-968265 CGAGGGGGTGGGGGTGGGGCAGG - Intronic
968522353 4:1039689-1039711 CGTGGCGGTGGTGGTGGGGGCGG + Intergenic
968534468 4:1114109-1114131 TGAGGCGGTGGGGGTGGGGGGGG + Intergenic
968685044 4:1952333-1952355 CCAGGCGGTGGGGGTGGGGAGGG - Intronic
968701755 4:2060796-2060818 CCAGGCGGTGGGGGTGGGTGGGG + Intronic
968761060 4:2442943-2442965 GGAGCCACTGGGGGTGCTGGGGG + Intronic
968761089 4:2443009-2443031 GGAGCCACTGGGGGTGCTGGGGG + Intronic
968846139 4:3042637-3042659 AGTGGAAATGGGGGTGGGGGTGG - Intergenic
968964199 4:3761343-3761365 TGAGCTCCTGGGGGTGGGGGTGG - Intergenic
968983947 4:3865389-3865411 CGAGGCAGTGGGTGGGGGGCGGG - Intergenic
969022463 4:4147486-4147508 GTGGGCACTGGGGGGGGGGGGGG - Intergenic
969071341 4:4541883-4541905 CAAGGCGCTGGGAGTGGCGGTGG - Exonic
969256917 4:6008436-6008458 CGAGGCACTGGGGCAGCAGGCGG - Intergenic
969414312 4:7048740-7048762 CCAGGGACTGGGGAAGGGGGAGG - Intronic
969423114 4:7108682-7108704 TAAGGATCTGGGGGTGGGGGAGG - Intergenic
969447306 4:7252674-7252696 AGAGGGGCTGGGGGTGCGGGAGG + Intronic
969521015 4:7677851-7677873 TGGGACACTAGGGGTGGGGGTGG - Intronic
969592113 4:8127837-8127859 AAAGGCACTCGGGGTGGGGGAGG + Intronic
969718079 4:8877953-8877975 CCAGGCCCTGGGGTTGGGGGAGG - Intergenic
969848582 4:9938900-9938922 CTATGAACTGGGGGTGGGGATGG + Intronic
970058506 4:12002336-12002358 CAAGAGGCTGGGGGTGGGGGTGG + Intergenic
970441337 4:16083345-16083367 CCATCCACTGGGGATGGGGGCGG - Intronic
970590570 4:17556637-17556659 TGAGGGACTGGGGGTGGGGAGGG - Intergenic
970718083 4:18951651-18951673 AGAGGTAATGGGGGTGGGTGGGG + Intergenic
970842277 4:20488481-20488503 AGAGCCAATGGGGGTGGGGTGGG - Intronic
971047829 4:22825777-22825799 CCAGGGACTAGGGGTGGGAGTGG - Intergenic
972341441 4:38155569-38155591 CTAGGGGGTGGGGGTGGGGGTGG + Intergenic
972344075 4:38177920-38177942 GAAGGCATTGGGGGTGGTGGGGG + Intergenic
972503221 4:39697232-39697254 CAGGGGACTCGGGGTGGGGGAGG - Intergenic
973179555 4:47251474-47251496 AGAGGAACTGGAGGTGGGTGGGG + Intronic
973236000 4:47905744-47905766 TGAGTGAGTGGGGGTGGGGGTGG + Intronic
973301424 4:48589257-48589279 CAAGGCCCTTGGGGTGGGGTGGG + Intronic
973613260 4:52657352-52657374 CGCAGCACTGAGGGTGGGTGGGG + Intronic
975076290 4:70212940-70212962 CGAGGCAGTCTGGCTGGGGGAGG - Intergenic
975406458 4:73996245-73996267 GGACACACTGGGGTTGGGGGTGG - Exonic
975870732 4:78776247-78776269 CGGGGCACTGGCGGAGGCGGCGG + Intergenic
977323335 4:95547391-95547413 AGAGGCGCTGGGGGTGGGGATGG - Intronic
977323698 4:95549245-95549267 ACAGACACCGGGGGTGGGGGTGG + Intergenic
978868148 4:113540933-113540955 GGAAGCAGTGGGGGTGGGGAAGG - Intronic
979445839 4:120810124-120810146 CAAGGACCAGGGGGTGGGGGAGG - Intronic
980375963 4:131949555-131949577 AGAGGGAGTGGGGGTGGGAGGGG + Intergenic
980723649 4:136728619-136728641 GGAGGTGGTGGGGGTGGGGGTGG + Intergenic
981729995 4:147887217-147887239 CTGGGCACTGAGGGTGGAGGTGG - Intronic
982125626 4:152181684-152181706 AGAGGCTGGGGGGGTGGGGGAGG - Intergenic
983058584 4:163128946-163128968 GGAGGCAGTGGTGGAGGGGGAGG + Exonic
984431933 4:179661239-179661261 GGACACACTGGGGTTGGGGGTGG - Intergenic
984579953 4:181500382-181500404 CGGGGGATCGGGGGTGGGGGAGG + Intergenic
984639055 4:182143635-182143657 GGCGGCCCTGGGGGAGGGGGCGG - Intergenic
984840743 4:184065135-184065157 CGGGGCAGAGGGGGTGGGGAGGG + Intergenic
985092931 4:186382081-186382103 CGAGGAACCGGCGGTGGGCGGGG - Intergenic
985217725 4:187671766-187671788 CGAGGAACCGGCGGTGGGCGGGG + Intergenic
985552567 5:541100-541122 GGAGGCAGAGGGGGTGGAGGAGG - Intergenic
985590352 5:761369-761391 CTGGGCCCTGGAGGTGGGGGAGG + Intronic
985649968 5:1102875-1102897 CCAGGCAGTGGGGTTGGGTGGGG - Intronic
985821325 5:2161957-2161979 TGAGTCAATTGGGGTGGGGGAGG + Intergenic
985973222 5:3393502-3393524 AGAGGTGCAGGGGGTGGGGGAGG + Intergenic
986750252 5:10780352-10780374 GGAGGCAGTGAGGCTGGGGGAGG + Intergenic
986795863 5:11211263-11211285 AGAGGCAGTGGGGCTGGGGGAGG + Intronic
987323549 5:16792551-16792573 GGAGGGACTGGGGTTGGGGGAGG - Intronic
988385496 5:30559224-30559246 CCCTGCACTGGGGGTGGGTGGGG - Intergenic
988662504 5:33287313-33287335 CAAGGCACTGTGGGGAGGGGAGG + Intergenic
989210626 5:38855689-38855711 GGTGGCAGTGGGGGTTGGGGGGG - Intronic
990512623 5:56502437-56502459 TGAGGGAGTGGGGGTGGGAGAGG + Intergenic
990791354 5:59483640-59483662 CCAGGGACTGGAGGTGGTGGTGG + Intronic
991006136 5:61829995-61830017 TGAGGCACTGGGCGGGGGGTGGG + Intergenic
991512577 5:67396189-67396211 CCAGCCACTGGGTGTGGGGATGG + Intergenic
992031149 5:72722771-72722793 TTTGGCAGTGGGGGTGGGGGTGG - Intergenic
992204002 5:74412262-74412284 AGATGGCCTGGGGGTGGGGGAGG - Intergenic
992232924 5:74681278-74681300 TGAGGCTCAGGGGTTGGGGGTGG + Intronic
992716016 5:79512870-79512892 CAAGGATCTGGGGGTGGGGGTGG - Exonic
993094971 5:83471375-83471397 CGGGGAAATGGGGGTGGGGAAGG + Intergenic
993881194 5:93363413-93363435 ACAGACACTGGGGGTGGGGTGGG + Intergenic
994043623 5:95284665-95284687 CGCGGCGCTGGCGGTGGCGGCGG + Intergenic
995142492 5:108749177-108749199 CCAGGGACGGGGGTTGGGGGGGG - Intronic
995467546 5:112466442-112466464 CGTGGCAGTGAGGCTGGGGGAGG - Intergenic
995472982 5:112523151-112523173 GGAGGAACTGGTGGTGGGTGGGG + Intergenic
996010187 5:118473722-118473744 AGAGGCACTGTGGATGGGAGAGG + Intergenic
996366124 5:122703236-122703258 CCAGCCACTGGGGATGGAGGAGG - Intergenic
996520796 5:124423551-124423573 GGAGGCAGTGAGGCTGGGGGAGG + Intergenic
997030324 5:130120211-130120233 TGAGGCACTGGAGGAGGTGGGGG - Intronic
997234222 5:132263497-132263519 AGGTCCACTGGGGGTGGGGGTGG + Intronic
997423532 5:133787563-133787585 CGTGGGACTGGGGGTGGGGGCGG - Intergenic
997525542 5:134550769-134550791 GGTGGAACTGGGGGTGGAGGTGG + Intronic
997631349 5:135371194-135371216 TCAGGGACTGGGGGTGGGGTCGG + Intronic
997667292 5:135641880-135641902 CCAGGCTCTGGGGGTGGAAGAGG - Intergenic
997698646 5:135880939-135880961 GGATGCAGTGTGGGTGGGGGTGG - Intronic
997722236 5:136088506-136088528 TGAGGCTCTGGGGCTGGGGTTGG + Intergenic
997829134 5:137133944-137133966 AGATGGGCTGGGGGTGGGGGGGG + Intronic
997964230 5:138345130-138345152 CGGGGCAGTGGTGGAGGGGGTGG + Exonic
998142905 5:139709896-139709918 CGGGGCGCTGGGGGTCCGGGAGG + Intergenic
998388331 5:141771269-141771291 AGAGGAGCTGGGGCTGGGGGTGG + Intergenic
998461822 5:142315149-142315171 AGGGGCCCTGGGGGTGGGGTGGG + Exonic
999133144 5:149299732-149299754 GCAGCCCCTGGGGGTGGGGGTGG - Intronic
999241823 5:150132296-150132318 AGATGAACTGTGGGTGGGGGTGG + Intronic
999436194 5:151565654-151565676 ACAGGTACTGGGGGTGGGGTAGG - Exonic
999449997 5:151670796-151670818 CTGGGCACTGGGAGTGGGGAGGG + Intronic
999936088 5:156486864-156486886 ATAGGCACTGGTGGTGGTGGAGG - Intronic
1001204347 5:169748058-169748080 GCAGGCACTGGGGGTGCGGGTGG + Intronic
1001468139 5:171987110-171987132 CCAGGCACGGGGAGTGGGGATGG - Intronic
1001537143 5:172506049-172506071 AGGAGCATTGGGGGTGGGGGTGG - Intergenic
1001642880 5:173257669-173257691 CAAGGCACTGGGGGTGTGAGAGG - Intergenic
1001652652 5:173327054-173327076 CGAGGGTCTCGGGGTGGTGGGGG + Intronic
1001678859 5:173541333-173541355 CCAGGAACTGGGGGTGGGGATGG + Intergenic
1001917684 5:175575414-175575436 AGAGGCCCTGGGGGTCTGGGAGG - Intergenic
1001937306 5:175714634-175714656 TGAGGCAGTGGTGGTGGGGGTGG - Intergenic
1002095933 5:176831078-176831100 CGAGGCACGGAGGTGGGGGGTGG - Intronic
1002160394 5:177311339-177311361 GGCGGGAGTGGGGGTGGGGGTGG - Intronic
1002187180 5:177459813-177459835 CCAGGCCCTGGGGGCGGGAGAGG - Intronic
1002283990 5:178150101-178150123 TGAGGCACAGGAAGTGGGGGTGG - Exonic
1002292484 5:178209417-178209439 CGAGGCAGCGGAGGTGGTGGTGG + Exonic
1002373956 5:178775199-178775221 CGGAGGCCTGGGGGTGGGGGAGG - Intergenic
1003042529 6:2701331-2701353 GGAGGCAGTGGGGCTCGGGGAGG - Intronic
1003406392 6:5830058-5830080 TGAGGCCCTGGGGGTGGGGCAGG + Intergenic
1003472791 6:6452382-6452404 GGAGGGAATGGGGGTGGTGGGGG + Intergenic
1003527807 6:6912492-6912514 CTAGGCACTGGGGATGAGGCAGG + Intergenic
1003550888 6:7101218-7101240 GGAGGCACTGGCTGTAGGGGTGG - Intergenic
1003920894 6:10832098-10832120 CCAGCTACTGGGGGTCGGGGTGG - Intronic
1003995803 6:11538198-11538220 CGAGGCTCGGGGGGCGGCGGCGG - Intergenic
1004298061 6:14432087-14432109 TGGGGGAATGGGGGTGGGGGAGG + Intergenic
1004335799 6:14763254-14763276 GATGGCACTGGGGGTCGGGGCGG + Intergenic
1004742294 6:18473747-18473769 TGCTGCACTGGGGGTGGGAGAGG - Intergenic
1004905711 6:20235333-20235355 AGAGGCAGTGGGGGGTGGGGGGG + Intergenic
1005048752 6:21665448-21665470 CAAGGCAGTGGGGGAGGGGAAGG + Intergenic
1005157224 6:22820278-22820300 GGTGGCAGTGAGGGTGGGGGTGG + Intergenic
1006176614 6:32126234-32126256 CCAGGCTCTTGGGGTAGGGGAGG - Exonic
1006302112 6:33199275-33199297 GGTGGCATCGGGGGTGGGGGTGG + Exonic
1006342112 6:33452634-33452656 CAACACACTGGGGGAGGGGGGGG - Exonic
1006362574 6:33595001-33595023 GCAGGCCCTGGGGGTGCGGGCGG + Intergenic
1006371432 6:33646371-33646393 AGAGGCAGTGGTGGAGGGGGTGG - Intronic
1006377307 6:33678578-33678600 CGGGGGATGGGGGGTGGGGGCGG + Intronic
1006440078 6:34048446-34048468 GGAGGGGCTGGGGCTGGGGGTGG + Intronic
1006454222 6:34122767-34122789 CCAGGCACTGGAAGTAGGGGGGG + Intronic
1006470483 6:34226053-34226075 GGAGGGTCTGGGGGTGGGGTGGG - Intergenic
1006601770 6:35231139-35231161 CCAGGCACAGGGGGGAGGGGAGG + Intronic
1006745154 6:36336552-36336574 AGAGGCAATGGGGGTGGAGGTGG - Intronic
1006971441 6:38049874-38049896 GGAGGGGGTGGGGGTGGGGGTGG - Intronic
1007431432 6:41779672-41779694 CGGAGCACCGGGGCTGGGGGCGG - Intronic
1007586216 6:42991434-42991456 CGAGGTCCTGGGGATAGGGGTGG - Intronic
1007764982 6:44154917-44154939 CGTGGGAGTGGGGGTGGGGTGGG - Exonic
1008159712 6:48062346-48062368 CCAAGGACTTGGGGTGGGGGTGG - Intronic
1008505674 6:52227288-52227310 GGAGGCACTGGAAGTGGAGGAGG + Intergenic
1009994120 6:70880079-70880101 CGTGGGGGTGGGGGTGGGGGTGG + Intronic
1010083187 6:71887051-71887073 GGAGGCACCGTGGGTGGGCGAGG - Exonic
1010322803 6:74532514-74532536 CCATGAGCTGGGGGTGGGGGTGG + Intergenic
1010682940 6:78817942-78817964 GGTGGCAATGGGGCTGGGGGAGG + Intergenic
1011127174 6:84019665-84019687 CGAGGCGGTGGGGTTGGGGGGGG + Intergenic
1011408255 6:87038897-87038919 CAAGGCAGTGAGGCTGGGGGAGG - Intergenic
1011418816 6:87151645-87151667 CCAGACTCTGGGGGTGGGGGTGG + Intergenic
1011693021 6:89887465-89887487 TGAGGGAGTGGGGGTGGGGGAGG - Intergenic
1012555340 6:100504937-100504959 GGAGGCAGTGGTGGTGGTGGGGG + Intergenic
1012571671 6:100737167-100737189 GGAGGCAGTGGGGGTGGGTAGGG + Intronic
1012625017 6:101393905-101393927 GGAGGGACTGCGGGTGGGCGAGG + Intergenic
1013657763 6:112263189-112263211 TGTGGTACTGGGAGTGGGGGTGG - Intergenic
1014172014 6:118289006-118289028 TGAGGAGCTGGGGGTGGGTGAGG - Intronic
1014246976 6:119079203-119079225 CCGGGCACTCGGGGTGGGAGGGG - Intronic
1014531361 6:122563491-122563513 AGAGGGACTGGTGGTGGGTGGGG + Intronic
1015149509 6:130020827-130020849 CGAGGCGTTGGGGGTGGGGGCGG - Intronic
1016890948 6:149006237-149006259 CGTGTCAGTGGGGTTGGGGGAGG - Intronic
1017146645 6:151240760-151240782 CGGGTCTTTGGGGGTGGGGGTGG + Intronic
1017522724 6:155216191-155216213 CATGGCACAGGGGGTGGGGCGGG - Intronic
1017838243 6:158199960-158199982 CCAGCTACTGGGGCTGGGGGAGG + Intergenic
1018650529 6:165988322-165988344 GGAGGTGCTGGGGCTGGGGGAGG + Intergenic
1019381519 7:726723-726745 GGCGGCGCTGGGGGTGGCGGAGG + Exonic
1019488611 7:1300794-1300816 AGAGGCAGTGATGGTGGGGGTGG + Intergenic
1019525998 7:1480816-1480838 CGAGGTACTGGGGAGGGGTGGGG - Exonic
1019562358 7:1665244-1665266 CGGGGCACTTGGGGGCGGGGAGG - Intergenic
1019664436 7:2244453-2244475 GGAGGCAGTGGGGGGCGGGGGGG - Intronic
1019709488 7:2511725-2511747 GGAGGCTGTGGGGGTGGTGGGGG + Intergenic
1019884803 7:3894433-3894455 CCAGGCTCCGGGGGTGGTGGGGG + Intronic
1019994226 7:4713287-4713309 CTAGGCTCTGGGGTTGGGGCGGG + Intronic
1020044411 7:5030527-5030549 CCTAGGACTGGGGGTGGGGGGGG - Intronic
1020116538 7:5479548-5479570 CCAGGAACTGTGGGTGGGGGGGG + Intronic
1020125712 7:5531482-5531504 CTAGGCACTGCGGGGCGGGGGGG + Intronic
1020137566 7:5595207-5595229 CATGGCAGTGGGGGTGAGGGTGG + Intronic
1020524675 7:9244132-9244154 TGAGGAATTGGGGTTGGGGGTGG - Intergenic
1020799823 7:12719753-12719775 TGAGTCACTGTGGGTGGTGGGGG + Intergenic
1020822783 7:12991083-12991105 CCTAGCACTGGGGGTGAGGGTGG + Intergenic
1021680072 7:23121408-23121430 CCAGTGACTGGAGGTGGGGGTGG - Intronic
1021969358 7:25951370-25951392 CGCGGGGCTGGGGGCGGGGGCGG + Intergenic
1022204385 7:28149467-28149489 AGAGAGACTGGGGGTGGGGTGGG - Intronic
1022378148 7:29834740-29834762 GGAGGCAGAGGAGGTGGGGGTGG - Exonic
1022494913 7:30846751-30846773 CCATGGACTGGAGGTGGGGGTGG + Intronic
1023034595 7:36119308-36119330 CAAGTCACTGGAGGTGGGTGTGG + Intergenic
1023861712 7:44220802-44220824 TGAGTCCCTGGGGCTGGGGGGGG - Intronic
1023938608 7:44756327-44756349 TCAGGCCCTGGGGTTGGGGGTGG + Intronic
1024738232 7:52328525-52328547 GGAGGCAGTGAGGCTGGGGGAGG - Intergenic
1024872608 7:53983518-53983540 CTCTGCACGGGGGGTGGGGGAGG + Intergenic
1025852659 7:65257387-65257409 CGAGGGAGAGGGGGAGGGGGAGG - Intergenic
1026104665 7:67411246-67411268 GGAGGCCGAGGGGGTGGGGGTGG + Intergenic
1026110183 7:67453358-67453380 AGAGACAGTGGGGGTTGGGGGGG + Intergenic
1026468466 7:70674492-70674514 CGAGGGAGTGAGGGTGGGGTAGG + Intronic
1026840430 7:73667772-73667794 CGCGGCGCCGGGGCTGGGGGTGG - Intergenic
1026841373 7:73671431-73671453 CCAGGCAGTGGGGGAGGAGGAGG - Exonic
1026909386 7:74083676-74083698 CGTGGCCTTGGGCGTGGGGGCGG + Intronic
1026986760 7:74559659-74559681 AGAGGCACTGGCTGTGGAGGGGG + Intronic
1027171937 7:75878888-75878910 CCACGCACGGGGGGGGGGGGGGG + Intronic
1027218290 7:76198216-76198238 GAAGGCCCTGGGAGTGGGGGGGG - Intergenic
1027247866 7:76379581-76379603 CGAGGGGTTGGGGGGGGGGGGGG + Intergenic
1027421327 7:78020107-78020129 CTCGGCAGTGAGGGTGGGGGTGG - Intronic
1028129444 7:87152673-87152695 CGGGGCACTGCGGGCGGGGTCGG + Exonic
1028394131 7:90348620-90348642 AGAGGCAGAAGGGGTGGGGGTGG + Intronic
1028853488 7:95563711-95563733 CCAGGGACTGGGGCTAGGGGTGG + Intergenic
1029227836 7:99040983-99041005 CGAGGGAGTGGTGGTGGAGGAGG - Intronic
1029276769 7:99409755-99409777 GGAGGCTCTGTGGGCGGGGGGGG + Intronic
1029291474 7:99505086-99505108 CGAGTCACTGAGGGTGGGCTGGG + Exonic
1029325415 7:99803313-99803335 GGAGGCAGTGAGGCTGGGGGAGG - Intergenic
1029436296 7:100565831-100565853 CCAGGCTCTGGGGATGGTGGGGG - Exonic
1029444348 7:100604303-100604325 CTAGGCACTGGGGCGCGGGGTGG - Intronic
1029453578 7:100656020-100656042 CGAGGTCCTGGGACTGGGGGTGG + Intronic
1029456932 7:100676202-100676224 CGCGGGACGGGGGCTGGGGGAGG - Exonic
1029542636 7:101193247-101193269 CCAGACACTGGGGATGGGCGGGG - Intergenic
1029592196 7:101514611-101514633 CCAGGCTCTGGGGGTGGGTGGGG + Intronic
1029639810 7:101814090-101814112 GGAGGCGGCGGGGGTGGGGGGGG - Intergenic
1029661485 7:101965260-101965282 CGAGGCACTGTGCGGCGGGGAGG + Intronic
1029704468 7:102268798-102268820 AGAGAGAATGGGGGTGGGGGAGG + Intronic
1029729322 7:102429218-102429240 CTAGGCACTGGGGATGGTGGTGG + Intergenic
1029745002 7:102511899-102511921 CTCGGTCCTGGGGGTGGGGGCGG + Intronic
1029762994 7:102611060-102611082 CTCGGTCCTGGGGGTGGGGGCGG + Intronic
1030049023 7:105521976-105521998 CGGGGCCCTGGGGCTGGGGCTGG + Intronic
1030080149 7:105770592-105770614 AGAGGAAATGGGGGTGGAGGTGG + Intronic
1030097262 7:105911364-105911386 CCAGGAACTGGGGGAAGGGGAGG + Intronic
1030130442 7:106195039-106195061 TGAGGAAGTGGGGTTGGGGGAGG + Intergenic
1030295487 7:107921846-107921868 CAAGGGGATGGGGGTGGGGGAGG - Intronic
1030817520 7:114055351-114055373 GGAGGCAGTGAGGCTGGGGGAGG + Intronic
1030885567 7:114932296-114932318 TGAGGCACTGGTAGTGGGTGTGG + Intronic
1031010781 7:116524546-116524568 CGATGGGCGGGGGGTGGGGGAGG + Intergenic
1032018005 7:128392152-128392174 TGAGGTACTGGGGGTGGGGTGGG - Intergenic
1032545499 7:132738250-132738272 CGAGGCAGGGGTGGTGGTGGGGG + Intergenic
1033200039 7:139360335-139360357 CAGGGCCCTGGGGGTGGGGGAGG + Intronic
1033250958 7:139758739-139758761 CCATGGACTGGGGGTGGGGGTGG - Intronic
1033313778 7:140281411-140281433 CCAGGGACTGGGGGAGGGGAGGG + Intergenic
1033756976 7:144403834-144403856 CCTCGCCCTGGGGGTGGGGGTGG - Intronic
1034433698 7:151053251-151053273 TGAGACGGTGGGGGTGGGGGTGG + Intergenic
1034468964 7:151245665-151245687 CGGGGCGCTGGGGGTGGGCGGGG + Exonic
1034469549 7:151248124-151248146 CCCTGCCCTGGGGGTGGGGGTGG - Intronic
1034528776 7:151682808-151682830 AGAGGGCCTGAGGGTGGGGGTGG + Intronic
1034622116 7:152464174-152464196 CGCGGTAGTGGGGGTGGGGCAGG + Intergenic
1034816376 7:154175462-154175484 GGAGGCTCTGGGGGTGGGGTGGG - Intronic
1035021577 7:155803892-155803914 TGGGGCAGTGGGGTTGGGGGAGG - Intronic
1035035379 7:155891117-155891139 GGAGGTAGTGGGGATGGGGGAGG + Intergenic
1035431453 7:158826117-158826139 CGCGGCAGGGGTGGTGGGGGTGG - Intronic
1036398496 8:8387578-8387600 CAGGGATCTGGGGGTGGGGGTGG - Intergenic
1036756512 8:11474840-11474862 GGAGGCAGAGGGGGAGGGGGAGG + Intergenic
1037668812 8:20996986-20997008 GGAGGCACTGGGGCTGGAGACGG - Intergenic
1037902439 8:22695547-22695569 GGAGGCGGTGGGGGTGGGGGTGG + Intergenic
1037986099 8:23291605-23291627 TTAGGCACTGGGTGTGGGGCAGG - Intronic
1038038896 8:23707445-23707467 GGCGGGAGTGGGGGTGGGGGGGG + Intergenic
1038309306 8:26433843-26433865 GGATGCACTGGTGGAGGGGGAGG - Intronic
1038870735 8:31490145-31490167 GGAGCCCGTGGGGGTGGGGGCGG - Intergenic
1039509221 8:38077453-38077475 TCAGTCAGTGGGGGTGGGGGTGG + Intergenic
1040514000 8:48119812-48119834 CGAGGATGTGGGGGTGGGGTGGG + Intergenic
1040555544 8:48474730-48474752 TCAGGGACTGGGGGTAGGGGTGG + Intergenic
1040772311 8:50992191-50992213 GGAGGCAGTGAGGCTGGGGGAGG - Intergenic
1040915884 8:52565735-52565757 CGAGGCTCGGGGGGTGGAGGCGG - Intergenic
1040985254 8:53286900-53286922 GGAGGCACTGGAGGTGAGAGGGG - Intergenic
1041040746 8:53843499-53843521 CGAGGCACTAGGTCTGGGGGCGG - Intronic
1041054895 8:53974518-53974540 GGGGGTAGTGGGGGTGGGGGTGG + Intronic
1041167090 8:55101781-55101803 AGCGACACTGGGGGAGGGGGAGG - Intergenic
1041227792 8:55717306-55717328 GGAGGAACTGGTGGTGGGTGGGG - Intronic
1041281225 8:56212104-56212126 CAGGGAACTGGGGGTGGGGCCGG - Intronic
1041637130 8:60156632-60156654 GGAGGAACTGGTGGTGGGCGGGG - Intergenic
1041865165 8:62564344-62564366 GGAGGTAGTGGGGGTGAGGGTGG - Intronic
1042036531 8:64540086-64540108 CTAGGTACTGGGGGTGGGTGGGG + Intergenic
1042143853 8:65707057-65707079 GGAGGCAGGGGCGGTGGGGGAGG - Exonic
1042494793 8:69443931-69443953 CCAGCAACTGGGGGAGGGGGAGG - Intergenic
1042554366 8:70021809-70021831 TGAGGGACTGGGAGTGGAGGTGG - Intergenic
1043791559 8:84474866-84474888 GGTGGGGCTGGGGGTGGGGGTGG - Intronic
1044573023 8:93740822-93740844 CGGGGCGCCGGGGGTGGGGAGGG - Intronic
1044591446 8:93917272-93917294 CGGGGGGCTGGGGGCGGGGGCGG + Intronic
1044868073 8:96591846-96591868 CCAGGCACTGTGACTGGGGGAGG + Intronic
1045177277 8:99739256-99739278 GGAGGCAGTGAGGCTGGGGGAGG + Intronic
1045305372 8:100952586-100952608 CGAAGCACGGAGGGTGGGGCGGG - Intronic
1045338840 8:101233639-101233661 ACAGACACTGGGGGTGGAGGAGG + Intergenic
1046542430 8:115603849-115603871 TGAGGCATGGGGGGTGGGGTCGG - Intronic
1047238219 8:123061102-123061124 AGAGGAAGTGGGGCTGGGGGAGG - Intronic
1047732365 8:127737674-127737696 GGCGGTACTGGGGGTGGGGACGG + Intronic
1047760292 8:127949545-127949567 CCAGGGATGGGGGGTGGGGGTGG - Intergenic
1048044670 8:130762070-130762092 CCAGGAGCTGGGGGTGGGGATGG - Intergenic
1048469632 8:134695510-134695532 GCAGGGCCTGGGGGTGGGGGCGG - Intronic
1048888102 8:138924720-138924742 CTAAGCACATGGGGTGGGGGTGG - Intergenic
1049119322 8:140720046-140720068 CCAGGCACTGGGGGTGGTTTGGG + Intronic
1049273091 8:141706514-141706536 CAAGGGACTGAGGCTGGGGGAGG - Intergenic
1049273488 8:141708236-141708258 GGAGGACCTGGGGGTGGGAGAGG + Intergenic
1049463696 8:142741586-142741608 CCAGGCGCTGGAGGTGGGTGGGG - Intronic
1049555998 8:143282516-143282538 CACTGCACAGGGGGTGGGGGTGG - Intergenic
1049561832 8:143315933-143315955 CGAGGCTCTGGGGAGGGGGAGGG + Intronic
1049610471 8:143552777-143552799 CAAAGCCCTGGAGGTGGGGGTGG + Intergenic
1049700653 8:144010162-144010184 AGAGGCACTGGTGCTGGGAGAGG - Intronic
1049749651 8:144277161-144277183 AGAGGGGCTCGGGGTGGGGGCGG - Intronic
1049756792 8:144314358-144314380 CCCTGCACTGGGGGTGGGGGTGG - Exonic
1049762352 8:144337098-144337120 CCAGGAGCTGGGGGAGGGGGAGG + Intergenic
1049773446 8:144394186-144394208 TGAGGCTCTGGGGGTGGCCGGGG - Intronic
1049782263 8:144434436-144434458 TGAGGCCCTGGGGGCCGGGGTGG + Intronic
1049825812 8:144667175-144667197 ACAGGCAATGGGGGTGCGGGTGG - Intergenic
1050029211 9:1367470-1367492 GGCGGGAGTGGGGGTGGGGGTGG + Intergenic
1051364177 9:16309388-16309410 AGAGGCACTAGGGATTGGGGAGG + Intergenic
1051544435 9:18258601-18258623 GAAGGCACTGGCGGTGGGTGTGG - Intergenic
1051782334 9:20703173-20703195 TGAGGCTATGGGGGTGGTGGGGG + Intronic
1052299783 9:26941174-26941196 CAAAACACGGGGGGTGGGGGAGG + Intronic
1052350921 9:27457578-27457600 CTTGGGACTGGGGGTGGGGCGGG - Intronic
1053054900 9:34988477-34988499 CGAGGGAGCGGGGGTGGGGAGGG - Intergenic
1053136021 9:35650671-35650693 CTGGGCCCTGGGGGTGGGGCGGG - Intronic
1053143649 9:35697603-35697625 GAAGGCACTTGGGGTTGGGGAGG + Exonic
1053186712 9:36022512-36022534 CATGGCAGTGGGGGTTGGGGTGG + Intergenic
1053420568 9:37974983-37975005 CGCGGCACTGGGGGTTGGTGGGG - Intronic
1053430462 9:38038774-38038796 GGAGGCCCCGGGGGTGGGGCAGG + Intronic
1053433920 9:38062661-38062683 GCAGTCACTGGGGGTGGGGTGGG - Intronic
1053641013 9:40080223-40080245 AGAGGGAGTGGGGGTGGGAGGGG + Intergenic
1053697378 9:40650675-40650697 CGCGGCACCGGGGGGGGGGGTGG + Intergenic
1053765123 9:41385245-41385267 AGAGGGAGTGGGGGTGGGAGGGG - Intergenic
1054308688 9:63450124-63450146 CGCGGCACCGGGGGGGGGGGGGG + Intergenic
1054321757 9:63676519-63676541 AGAGGGAGTGGGGGTGGGAGGGG + Intergenic
1054323940 9:63703887-63703909 CGAGTAAGGGGGGGTGGGGGCGG - Intergenic
1054407335 9:64773768-64773790 CGCGGCACCGGGGAGGGGGGTGG + Intergenic
1054543739 9:66296407-66296429 AGAGGGAGTGGGGGTGGGAGGGG - Intergenic
1054832801 9:69645022-69645044 TGGGGGACTGGGGGTGGGAGAGG + Intronic
1054855721 9:69897726-69897748 AGGGGCAATGGGGGTGGAGGTGG + Intronic
1055266365 9:74499087-74499109 AGAGGGACTGGGAGTGGGGGTGG - Intronic
1055420764 9:76138921-76138943 AGAGTCAGTGGGGATGGGGGAGG - Intronic
1056322703 9:85451924-85451946 AGAGGGACTGGCGGTGGGTGGGG + Intergenic
1056451525 9:86721724-86721746 GGGGGCGGTGGGGGTGGGGGGGG - Intergenic
1056759898 9:89406958-89406980 CTATGGATTGGGGGTGGGGGTGG - Intronic
1057007431 9:91573036-91573058 CAAGGCATGGGGGGTGGGGCTGG + Intronic
1057259204 9:93575102-93575124 CTGGGCACTGGGGAAGGGGGCGG - Intergenic
1057724206 9:97556757-97556779 GGAGGCACTTGGGGTAGGGCTGG + Intronic
1057988074 9:99737911-99737933 GGGTGCACTGGGTGTGGGGGTGG - Intergenic
1058308379 9:103471202-103471224 AGAGGGACTGGTGGTGGGCGGGG + Intergenic
1058424254 9:104862741-104862763 AGAAACTCTGGGGGTGGGGGTGG - Intronic
1058581877 9:106467410-106467432 CAAGGGAATGGGGGTGGGGTGGG - Intergenic
1058723932 9:107784366-107784388 CCAGGCAGTGGGGTGGGGGGCGG + Intergenic
1059047381 9:110883950-110883972 CTAGAAAATGGGGGTGGGGGAGG - Intronic
1059151754 9:111955363-111955385 CTAGGCCCGGGGGATGGGGGAGG + Intergenic
1059191608 9:112333077-112333099 CGCGGCGCTGGGGGAGGCGGAGG - Intronic
1059311808 9:113393473-113393495 GGAGGCATTGAGGGTGGTGGTGG + Exonic
1059450820 9:114370528-114370550 AGTGGCGGTGGGGGTGGGGGTGG + Intronic
1059529992 9:115026858-115026880 GGAGGGGGTGGGGGTGGGGGTGG + Intronic
1059666151 9:116448269-116448291 CATGGCAGTGGGGGTGGGAGGGG - Intronic
1059731025 9:117057267-117057289 AGAGTCCCTGGGGGTGGGGTAGG - Intronic
1059894993 9:118853891-118853913 CCAGGTACTGGCAGTGGGGGTGG + Intergenic
1059965853 9:119612728-119612750 CCTGGCACTGGGGCTAGGGGAGG - Intergenic
1060287312 9:122265101-122265123 CGAGTCTCATGGGGTGGGGGCGG + Intronic
1060548775 9:124475621-124475643 CAGGGCACTGGGGGTGTGGGTGG + Intronic
1060713171 9:125890576-125890598 CAAGTCACTGGGGGTGGGATGGG - Intronic
1060949987 9:127595330-127595352 CAAGACACTGGTGCTGGGGGCGG - Intergenic
1061100249 9:128486678-128486700 GAAGGGACTGGGGGTGGGGCAGG + Intronic
1061153419 9:128842610-128842632 GGAGGCACTGGGGGAGGAAGGGG - Intronic
1061191387 9:129084794-129084816 GGGGGCACTGGGGGTGGGGTGGG - Intronic
1061283500 9:129610174-129610196 CGAGCCACAGGGGAGGGGGGAGG + Intronic
1061306575 9:129736136-129736158 GGAGGGAGTGGGGATGGGGGAGG - Intergenic
1061320191 9:129823669-129823691 CGGGGCCCGGGGGCTGGGGGTGG - Intronic
1061791470 9:133061408-133061430 AGAGGCTCAGGGGGTGTGGGTGG - Intergenic
1061795144 9:133081975-133081997 AGAGGCTCAGGGGGTGTGGGTGG - Intronic
1061884593 9:133585214-133585236 CGTGGAGCTGGGGGTGGGGCAGG + Intronic
1061913631 9:133737992-133738014 CCAGGCTCAGGGGGTGGTGGGGG + Intronic
1062048173 9:134433935-134433957 CCAGGCTCTGGGGGAGCGGGCGG + Intronic
1062218659 9:135402844-135402866 GGAGGCACGGAGGGTGGGAGAGG - Intergenic
1062264698 9:135681645-135681667 CTGGGGACTGGGGTTGGGGGGGG + Intergenic
1062334248 9:136058091-136058113 TCAGCCACTGGGGGCGGGGGGGG + Intronic
1062335901 9:136067305-136067327 GGGAGCAGTGGGGGTGGGGGAGG + Intronic
1062343428 9:136103881-136103903 CTATGCACGGGGTGTGGGGGCGG - Intergenic
1062405183 9:136392886-136392908 CGAGGCAGGGAGGGTGAGGGAGG - Intronic
1062463354 9:136671016-136671038 TGAGGCATTGGTGGGGGGGGGGG + Intronic
1062522668 9:136964781-136964803 CGAGGCCGTGGGAGTGGGAGAGG - Intergenic
1062526179 9:136978864-136978886 CGGGGGATTGGGCGTGGGGGCGG + Intronic
1062568345 9:137173077-137173099 TGGGACACGGGGGGTGGGGGGGG + Intergenic
1062573386 9:137195597-137195619 CGAGGCCTTGGGAGTGGAGGCGG + Intronic
1202779744 9_KI270717v1_random:24027-24049 CGCGGCACCGGGGGGGGGGGGGG + Intergenic
1202788784 9_KI270719v1_random:63298-63320 AGAGGGAGTGGGGGTGGGAGGGG + Intergenic
1203518460 Un_GL000213v1:25663-25685 GGAGGCGCTGGGAGTGGGAGTGG - Intergenic
1203736810 Un_GL000216v2:144826-144848 GAAGGCAGTGGGGGTGGGGAGGG - Intergenic
1185469454 X:373839-373861 CATGGCGCCGGGGGTGGGGGCGG + Intronic
1185506590 X:635628-635650 CCAGGCACTGGGGGGCGGAGGGG + Intronic
1185665087 X:1759310-1759332 AGAGGAGCTGGGGGTGGGTGGGG + Intergenic
1185705436 X:2263023-2263045 CCAGGGCCTGGGGGTGGGGAGGG + Intronic
1185723913 X:2404203-2404225 GGGGCCTCTGGGGGTGGGGGCGG - Intronic
1186190317 X:7061582-7061604 CCAGGCAGCGGGGGTGGGGGTGG - Intronic
1186356924 X:8799888-8799910 CGAGGCCCTGAGGGTGGGCTGGG - Intronic
1186357247 X:8801003-8801025 CGAGGCCCTGAGGGTGGGCTGGG - Intronic
1186378581 X:9033697-9033719 CGAGGCCCTGAGGGTGGGCTAGG - Intronic
1186463431 X:9765924-9765946 GCAGGCGCTGGGGGTTGGGGTGG - Exonic
1186467849 X:9797798-9797820 GGAGGCACAGTGGGTGGGGTGGG + Intronic
1186630380 X:11341955-11341977 AAAGTCAGTGGGGGTGGGGGTGG - Intronic
1186765628 X:12767957-12767979 GGAGCCACAGGGGCTGGGGGTGG + Intergenic
1186771410 X:12821437-12821459 TCAGGGTCTGGGGGTGGGGGGGG + Intronic
1187024213 X:15417062-15417084 CCAGCTACTGGGGGTGGAGGGGG - Intronic
1187229639 X:17408513-17408535 CTGGGCACTGGGGATGGGGCTGG - Intronic
1187375540 X:18749749-18749771 CGGGGGGGTGGGGGTGGGGGTGG - Intronic
1187481262 X:19657905-19657927 CCAGGGGCTGGGGGTGGGGGCGG + Intronic
1188004176 X:25005852-25005874 CAAGGCGGTGGGCGTGGGGGTGG - Intronic
1188482938 X:30653296-30653318 CGTGTCAGGGGGGGTGGGGGTGG - Intergenic
1189309598 X:40010177-40010199 CCAGGCTTTGGGGGAGGGGGTGG - Intergenic
1189364981 X:40381145-40381167 GGAGGGGTTGGGGGTGGGGGAGG + Intergenic
1189768176 X:44393506-44393528 TGAAACACTGGGGGTAGGGGAGG - Intergenic
1189903586 X:45734511-45734533 CGGGGCACGGGTGGTGGTGGCGG - Intergenic
1189915216 X:45850406-45850428 CTAGGTAGTGGGGGTGGAGGTGG - Intergenic
1189948409 X:46203821-46203843 CCAGGAAATGGGGGTGGGGGTGG - Intergenic
1190144140 X:47875076-47875098 TGAGGCCACGGGGGTGGGGGTGG + Intronic
1190233630 X:48600405-48600427 CGAAGCACTGTGGGTGGGGCAGG - Exonic
1191085486 X:56563545-56563567 CGCGGAACTGGGGGAGGGGAAGG + Intergenic
1191675089 X:63785046-63785068 GGAGGAACTGGAGGTGGGGCTGG + Intronic
1191794921 X:65011427-65011449 CGAGGCCCTGGGTGAGGGAGAGG + Intronic
1192212522 X:69136958-69136980 CGCGGCACTGGGGGCGGGGCGGG - Intergenic
1192234040 X:69285026-69285048 AGAGGGACTGGGGTTGGGTGTGG - Intergenic
1192428231 X:71095929-71095951 CGGGGGGCGGGGGGTGGGGGGGG + Intergenic
1192881080 X:75284827-75284849 AGAGGGACTGGTGGTGGGTGGGG + Intronic
1193337832 X:80311958-80311980 AAAGTCACTTGGGGTGGGGGAGG + Intergenic
1193722716 X:85005395-85005417 GGAGGCCCGGGGGGGGGGGGGGG - Intronic
1194107563 X:89790637-89790659 CCAGGGACTGGGGATGGGGTCGG + Intergenic
1195038487 X:100991915-100991937 CGGGGCGGTGGGGGTTGGGGCGG + Intergenic
1195068906 X:101261105-101261127 AGGGGCACTTGGGGTGGGGAAGG - Exonic
1195325146 X:103752315-103752337 AGAGGCACTGAGGTTGGGGTGGG + Intergenic
1195328357 X:103776332-103776354 CGTAGAGCTGGGGGTGGGGGTGG + Intronic
1195548452 X:106139161-106139183 AGATGCACTGGTGGTGGTGGTGG - Intergenic
1195732043 X:107977977-107977999 CAAGGTACCTGGGGTGGGGGTGG - Intergenic
1196218928 X:113088525-113088547 AGAGGGACTGGTGGTGGGTGGGG - Intergenic
1196253235 X:113486232-113486254 CAGTGGACTGGGGGTGGGGGTGG - Intergenic
1197243952 X:124149042-124149064 GGAGGTTGTGGGGGTGGGGGTGG + Intronic
1197278280 X:124505319-124505341 CAACGGACTGGGGGCGGGGGAGG + Intronic
1197647944 X:129037693-129037715 CCAGGAAGTGGGGGTGGGAGGGG + Intergenic
1197712773 X:129683812-129683834 AGAGGAAATGGGGGTGGGGGCGG + Intergenic
1197871838 X:131068674-131068696 TGGGGCTCGGGGGGTGGGGGCGG - Intronic
1198462704 X:136878628-136878650 CCAGCTACTGGGGGGGGGGGGGG + Intronic
1198534717 X:137574558-137574580 CGCGGGAGTGGGGGTGGGTGTGG - Intronic
1198807081 X:140503666-140503688 GGCGGGAGTGGGGGTGGGGGTGG + Exonic
1199679295 X:150214515-150214537 GGAGGGAGTGGGGTTGGGGGAGG - Intergenic
1199695931 X:150342534-150342556 GGAGGGAGTGGGGTTGGGGGAGG + Intergenic
1199846043 X:151693977-151693999 CCAGGCCCTGGGGGTTGGAGGGG + Intergenic
1199865657 X:151847808-151847830 GGTGGGAGTGGGGGTGGGGGTGG + Intergenic
1199892082 X:152094844-152094866 CTAGGGAGTGGGGGTGTGGGGGG + Intergenic
1199947106 X:152679063-152679085 GGTGGAAATGGGGGTGGGGGTGG - Intergenic
1199962575 X:152789391-152789413 GGTGGAAATGGGGGTGGGGGTGG + Intergenic
1200049778 X:153422568-153422590 TTAGGCACTGGTGGTGGGGCGGG - Intergenic
1200064310 X:153497302-153497324 CGAGGGGCTGGGGGTGGCGGTGG + Intronic
1200096356 X:153665957-153665979 CGACTCAATGGGGGTGGTGGGGG - Intergenic
1200102611 X:153695476-153695498 TGCAGCACTGTGGGTGGGGGTGG - Exonic
1200110381 X:153737886-153737908 AGAGTCCCTGGGGGTGGTGGGGG + Intronic
1200126184 X:153816119-153816141 CGAGGGGCTGGGGGTGGCGGTGG - Intronic
1200176114 X:154117441-154117463 CCAGGAACTGGAGCTGGGGGCGG - Intergenic
1200216037 X:154368677-154368699 AGAGGAAGTGGGGGTGGTGGCGG - Intronic
1200218964 X:154381258-154381280 CTTAGCAGTGGGGGTGGGGGTGG + Exonic
1200256528 X:154585672-154585694 GGAGGTAGAGGGGGTGGGGGTGG + Intronic
1200261241 X:154618731-154618753 GGAGGTAGAGGGGGTGGGGGTGG - Intronic
1200299447 X:154957966-154957988 CCAGGAGCTGGGGGTGAGGGAGG + Intronic
1200459519 Y:3438422-3438444 CCAGGGACTGGGGATGGGGTCGG + Intergenic
1201247086 Y:12015332-12015354 GGTGGCACTGAGGCTGGGGGAGG - Intergenic
1202579026 Y:26359643-26359665 TAAGGTACTGGGGGTGGGGAGGG - Intergenic